Abstract
Prostaglandin F2 α (PGF2 α) is a key factor in the triggering of the regression of the corpus luteum (CL). Furthermore, it has been reported that Slit/Robo signaling is involved in the regulation of luteolysis. However, the interactions between PGF2 α and Slit/Robo in the progression of luteolysis remain to be established. This study was designed to determine whether luteolysis is regulated by the interactions of PGF2 α and Slit/Robo in the mouse CL. Real-time PCR and immunohistochemistry results showed that Slit2 and its receptor Robo1 are highly and specifically co-expressed in the mouse CL. Functional studies showed that Slit/Robo participates in mouse luteolysis by enhancing cell apoptosis and upregulating caspase3 expression. Both in vitro and in vivo studies showed that PGF2 α significantly increases the expression of Slit2 and Robo1 during luteolysis through protein kinase C-dependent ERK1/2 and P38 MAPK signaling pathways, whereas an inhibitor of Slit/Robo signaling significantly decreases the stimulating effect of PGF2 α on luteolysis. These findings indicate that Slit/Robo signaling plays important roles in PGF2 α-induced luteolysis by mediating the PGF2 α signaling pathway in the CL.
Introduction
The corpus luteum (CL) is a transient endocrine gland that develops when the ovulated follicles are transformed through a terminal differentiation process termed luteinization (Stocco et al. 2007). The main functions of the CL are the regulation of the estrous cycle and the maintenance of pregnancy. If pregnancy does not occur, the CL regresses through a process termed luteolysis. In rodents, CL regression includes the functional and structural phases. The functional phase is associated with a marked decrease in progesterone production, which is followed by the structural phase in which the luteal cells die through programmed cell death (Hernandez et al. 2011).
CL structural regression is characterized by a reduction in both size and weight. The CL eventually becomes a cluster of cells termed the corpus albicans. The molecular mechanisms of CL structural regression are not yet clear, but the major events include the apoptosis of luteal and vascular cells (Stocco et al. 2007). It is well established that the apoptosis of luteal cells comprises two distinct signaling pathways: the intrinsic (mitochondrial) pathway and the extrinsic (death receptor) pathway (Yadav et al. 2005, Stocco et al. 2007). The intrinsic pathway is activated by apoptotic stimuli, such as drugs, radiations, and cytokines (Adams & Cory 1998), and the extrinsic pathway is activated by the interaction between the death ligands and death receptors (Kuranaga et al. 1999, Roughton et al. 1999, Sartorius et al. 2001). Several signals have been implicated in the induction of the apoptosis of luteal cells, including prostaglandin F2 α (PGF2 α), progesterone, prolactin, and Fas ligand (FasL; Bowen et al. 1996, Roughton et al. 1999, Gaytan et al. 2000, Kuranaga et al. 2000, Taniguchi et al. 2002, Carambula et al. 2003, Yadav et al. 2005). It has been reported that PGF2 α interacts with its G-protein-coupled receptor; this interaction increases the ratio of Bax to Bcl2, thus elevating the protein levels and activity of caspase9 and caspase3 (Yadav et al. 2005).
The Slit/Robo family comprises four transmembrane Robo (1–4) receptors that interact with their Slit (1–3) ligands. The Slit/Robo family regulates cell fate, including migration, death, angiogenesis, and organogenesis (Wu et al. 2001, Park et al. 2003, Dickinson et al. 2004, Hinck 2004, Koch et al. 2011). It has been documented that Slit/Robo suppresses the development of cancers by inhibiting cell migration and promoting apoptosis (Dickinson et al. 2008), and both Slits and Robos are inactivated in several tumors including cervical, prostatic, and ovarian tumors (Latil et al. 2003, Singh et al. 2007, Dai et al. 2011).
Under physiological conditions, Slit/Robo is expressed in both fetal and adult ovaries and participates in the regulation of follicle formation, oocyte survival (Dickinson et al. 2010), menstrual cycle (Duncan et al. 2010), and luteolysis by promoting the apoptosis of luteal cells (Dickinson et al. 2008). However, the factors affecting the expressions of Slit/Robo and their relationship with luteolysis require further investigation. Since PGF2 α is a key factor in the induction of CL regression, we hypothesized that Slit/Robo might interact with PGF2 α to affect CL regression. Our results indicate that PGF2 α stimulates the expression of Slit/Robo in both cultured isolated luteal cells and CL tissues and the effect of PGF2 α on the apoptosis of luteal cells is mediated by the Slit/Robo interaction.
Materials and methods
Reagents
Rabbit IgG anti-Slit2 polyclonal antibodies and mouse IgM anti-Robo1 MABs were purchased from Abcam, Inc. (Cambridge, MA, USA) and Developmental Studies Hybridoma Bank (DSHB, Iowa City, IO, USA) respectively. Biotin-conjugated goat anti-rabbit IgG was obtained from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). Biotin-conjugated goat anti-mouse IgM, HRP-conjugated goat anti-rabbit IgG, goat anti-mouse IgM, and goat anti-mouse IgG were obtained from ZSGB-Bio, Inc. (Beijing, China). Fluorescein isothiocyanate (FITC) and tetraethyl rhodamine isothiocyanate-conjugated streptavidin were obtained from Southern Biotech (Birmingham, AL, USA). PGF2 α, collagenase II, PKA inhibitor (H89), PKC inhibitor (CH), and JNK inhibitor (SP600125) were obtained from Sigma–Aldrich. ERK inhibitor (PD98059), P38 inhibitor (SB203580), and Moloney Murine Leukemia Virus (M-MLV) were purchased from Promega. DMEM/F12 and fetal bovine serum (FBS) were obtained from Gibco, and 0.25% pancreatin was obtained from Amresco, Inc. (Solon, OH, USA). Percoll was purchased from GE Healthcare Life Sciences (Castle Hill, NSW, Australia). Recombinant rat ROBO1/Fc chimera was obtained from R&D Systems (Minneapolis, MN, USA). In situ apoptosis analysis kit was purchased from Roche Diagnostics. RIPA lysis buffer and BCA assay reagent were purchased from Biotech Corporation (Beijing, China). PVDF membranes were obtained from Bio-Rad Laboratories. SuperSignal West Pico kit was purchased from Thermo Scientific (Rockford, IL, USA). All the other reagents were purchased from Takara (Tokyo, Japan) or TianGen Biotech Co., Ltd (Beijing, China).
Animals
Twenty-one-day-old female Kunming white mice were purchased from the Animal Institute of the Chinese Medical Academy (Beijing, China) and were raised under standard conditions of temperature (25±1 °C) and light (12 h light:12 h darkness cycle). These mice were i.p. injected with 10 IU pregnant mare serum gonadotropin (PMSG) to stimulate follicle development, which was followed 48 h later by an injection of 10 IU human chorionic gonadotropin (hCG) to promote ovulation and to obtain luteinized ovaries. These mice were then mated with castrated male mice. Day 0 was taken as the day of hCG injection. According to previous studies (Olofsson & Selstam 1988, Hasumoto et al. 1997), the ovaries were categorized as early (D0–D5), mid- (D6–D10), and late (D11–D15) luteal phase, and the PGF2 α content and DNA fragmentation in the CL was increased at D11 of this animal model. All animal procedures were approved by the Chinese Association for Laboratory Animal Sciences.
Mouse CL collection
Ovary collection in the mice at different luteal phases
PMSG–hCG-synchronized ovulation and luteinization were induced and the ovaries were collected from the mice at the early, mid-, and late luteal stages (n≥3 at each stage).
Ovary collection in the mice after cloprostenol injection
On D6 after hCG injection, the mice were i.p. injected with cloprostenol, a synthetic analog of PGF2 α, and the ovaries were collected at 0, 4, 12, and 18 h after cloprostenol injection (n≥3 mice/time point).
The ovaries were collected and washed in PBS. Under sterile conditions, CL tissues were enucleated from the ovaries under a microscope with the aid of fine forceps. The CL tissues were stored at −80 °C until analysis.
CL tissue isolation and luteal cell culture
CL tissues obtained from the mice on D6 after hCG injection were transferred into a centrifuge tube containing 0.1% collagenase II as described previously (Thordarson et al. 1997). Enzymatic digestion was carried out in a shaking bath (130 r.p.m./min) at 37 °C for 1 h. In order to obtain individual cells, tissue pieces were further dispersed by withdrawing and expelling at the end of the digestion. The supernatant, containing individual cells, was removed and transferred into another centrifuge tube. Undissociated clumps were further incubated in 0.25% pancreatin in a shaking bath at 37 °C for 10 min. After the termination of digestion, the cell suspension was filtered and layered onto a 2 ml cushion of 44% percoll in a centrifuge tube and centrifuged at 400 g for 30 min. The luteal cells that banded at the interface between the percoll and the medium were harvested, washed, and resuspended in DMEM/F12 medium containing 10% FBS. The cells were then counted and viability was assessed using trypan blue exclusion test; the viability varied from 85 to 95% in cell preparations used for further study. For the assay, the cells were plated (1.0×105 cells/well) onto six-well plates for 24 h at 37 °C in a humidified atmosphere of 5% CO2. The cells were then serum starved for an additional 24 h and then incubated using different treatments. Luteal cells from 20 to 25 mice were collected for each culture.
Immunohistochemistry
Frozen sections of the ovaries (7 μm) were fixed with cold methanol for 10 min, subjected to microwave antigen retrieval in 0.01 M citric acid (pH 6.0) for 15 min, and left to cool at room temperature (RT). All sections were then treated with 10% normal goat serum at RT for 1 h and incubated with rabbit IgG anti-Slit2 (1:100) antibodies at 4 °C overnight. The sections were then incubated with biotin-conjugated goat anti-rabbit IgG (1:400) at RT for 3 h. Subsequently, the slides were incubated with FITC-conjugated streptavidin (1:25) for 3 h at RT. For dual staining, the slides were further incubated with mouse IgM anti-Robo1 (1:100) at 4 °C overnight and biotin-conjugated goat anti-mouse IgM (1:100), and tetraethyl rhodamine isothiocyanate-conjugated streptavidin (1:25) at RT for 3 h. The sections were counterstained with DAPI (1:1000) to enable cell identification. As negative controls, the sections were processed as described above, except that the primary antibody was replaced with blocking serum containing nonspecific immunoglobulins at the same concentration. The slides were imaged using a fluorescence microscope (Leica Microsystems, Cambridge, UK).
Expression analysis
According to the protocols provided by the manufacturer, total RNA of the CL tissues and primary luteal cells were isolated using the TRIzol reagent, purified by DNase I, and quantified by spectrophotometry. Purified total RNA (1 μg) was used as a template for cDNA synthesis using the M-MLV, according to the manufacturer's instructions. All reverse transcriptase reactions included no-template controls and minus controls. In all, 2 μl of each cDNA were used for amplification reactions. Primers were designed using Primer 5.0, and they are described in Table 1. The PCR was continued for 35 cycles after an initial denaturation step at 94 °C for 10 min. Each PCR cycle consisted of steps carried out at 94 °C for 30 s and annealing temperature at 72 °C for 30 s, as well as a final extension step for 10 min at 72 °C. The PCR products were subsequently size verified by agarose gel electrophoresis with ethidium bromide and were observed and photographed under u.v. light. The relative intensity of each blot was assessed and analyzed using the AlphaImager 2200 Software package (Alpha Innotech Corp., San Leandro, CA, USA). For quantification, Slit2/Robo1 mRNA levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (Gapdh), which was used as the housekeeping gene.
Primers used in the expression analysis of candidate genes. Each of the genes investigated, primer sequences, specific annealing temperature used to amplify each product, and product size are given
| Gene | Primer sequence (5′–3′) | AT (°C) | Product size (bp) |
|---|---|---|---|
| Slit1 | F: GGGCCATGTCCGTGTTAG | 60 | 179 |
| R: TGTAGTGCTTGCCAAAGTTGT | |||
| Slit2 | F: ATTAGTGAAGCGGTGGGTAC | 60 | 159 |
| R: CCTTGGGAACTGATGTGAA | |||
| Slit3 | F: GGACAATGGCATCCTTCTTT | 60 | 246 |
| R: CCCACTGCTGGTTGCTTCT | |||
| Robo1 | F: GCATAGGTATCAGGCTTGACC | 60 | 196 |
| R: TTCCCTTAGAACTGCACATCC | |||
| Robo2 | F: AGTCACGGCAGACCCAA | 60 | 167 |
| R: TTCATAGCCCTGTAGTCTCCTA | |||
| Robo3 | F: CACCCAGATGCTGCACTTC | 60 | 196 |
| R: GGCTCCGGCTTCGACTT | |||
| Robo4 | F: TAAAGGAGAAAGGTCGTGGATG | 60 | 140 |
| R: GAGTGGCGGTAGAATGAGAATAG | |||
| Bax | F: TTTCATCCAGGATCGAGCAGG | 56 | 264 |
| R: GCAAAGTAGAAGAGGGCAACCAC | |||
| Bcl2 | F: CTACCGTCGTGACTTCGCA | 56 | 268 |
| R: TACCCAGCCTCCGTTATCC | |||
| Caspase9 | F: CGGAATCACCAATCATTACAT | 53 | 346 |
| R: AGAAACGCCCACAACTGC | |||
| Caspase3 | F: AGAGGAATGATTGGGGGTG | 56 | 133 |
| R: TTGCTAGGCAGTGGTAGCG | |||
| Gapdh | F: GGTTGTCTCCTGCGACTTCA | 60 | 186 |
| R: GGGTGGTCCAGGGTTTCTTA |
F, forward primer; R, reverse primer; AT, annealing temperature.
Real-time quantitative PCR
RNA was extracted and reverse transcribed as described above. Real-time PCR was performed using a standard Takara SYBR Premix Ex Taq protocol on an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems). Primers used were the same as those used for the expression analysis, and they are described in Table 1. The reaction mixtures were incubated in 96-well plates at 95 °C for 5 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Each sample was assayed in triplicate. The PCR products were confirmed to be Slits/Robos by sequencing. The melting curve in the PCR indicated a single product yield using this method, and the relative abundance of the genes was determined using the ABI PRISM 7500 equipped software (Applied Biosystems). The results of real-time PCR products were normalized to their respective control, Gapdh, which was used as the housekeeping gene.
Western blotting
To detect SLIT2 and ROBO1 protein levels in the CL by western blotting, CL tissues were first lysed using RIPA lysis buffer. The protein concentration of each group was determined using the BCA assay reagent. Equal amounts of protein (50 μg) were electrophoresed on 8 and 12% SDS–PAGE gel for SLIT2/ROBO1 and GAPDH (internal control) respectively, and the bands were transferred onto PVDF membranes. The membranes were blocked and incubated at 4 °C overnight with rabbit IgG anti-Slit2 (1:500), mouse IgM anti-Robo1 (1:500), or mouse IgG anti-GAPDH (1:40 000) antibodies in TBS. The PVDF membranes were then washed three times for 30 min in TBST (0.1% Tween 20 in TBS) and incubated for 2 h with HRP-conjugated goat anti-rabbit IgG (1:3000), goat anti-mouse IgM (1:3000), or goat anti-mouse IgG (1:3000). After washing for 30 min, the membranes were treated with the SuperSignal West Pico kit substrate at RT for 1–5 min. As negative controls, membranes were processed as described above, except that the primary antibody was replaced with nonimmune bovine serum at the same concentration. The relative intensity of each blot was assessed and analyzed using the AlphaImager 2200 Software package, and the levels of SLIT2/ROBO1 were determined by normalization against the density of GAPDH.
In situ apoptosis analysis
The in situ apoptosis of cells was detected using the TUNEL technique. Briefly, cell samples were fixed with a freshly prepared fixation solution (4% PFA) for 1 h at 15–25 °C and then incubated with a permeabilization solution (0.1% Triton X-100 in 0.1% sodium citrate) for 2 min on ice. The cells were washed three times in PBS and incubated with the TUNEL reaction mixture containing TdT and fluorescein-dUTP for 1 h at 37 °C in the dark. After washing with PBS, the cells were counterstained with DAPI (1:1000) for 15 min. As negative controls, the fixed and permeabilized cells were further incubated with fluorescein-dUTP solution (without TdT) instead of with the TUNEL reaction mixture. Lastly, the incorporated fluorescein was visualized with a fluorescence microscope.
Statistical analysis
All experiments were independently performed three times with different mice (n≥3 mice/group) or cell preparations in each experiment. Qualitative data reported are representative results obtained in the replicate experiments and presented as means± s.e.m.. Statistical analysis was performed using SPSS 10.0 (SPSS, Inc.). The t-test was used to compare the treatment and control samples, and one-way ANOVA was used when more than two groups were compared. When differences were observed using ANOVA, pairwise comparisons were made using the t-test. Differences are given as *P<0.05; **P<0.01; or ***P<0.001. A P value <0.05 was considered to be statistically significant.
Results
Slit2 and Robo1 are highly expressed in the mouse CL
We initially determined the expression of the Slit and Robo family members in the mid-luteal-phase CL (mid-CL) using real-time PCR. The results showed that the relative abundance of Slit2 mRNA was much higher than that of both Slit1 and Slit3 mRNAs. Among the Robo family, Robo1 mRNA levels were higher than Robo1, Robo2, Robo3 and Robo4 mRNA levels in the CL (Fig. 1A). We then assessed Slit2 and Robo1 mRNA levels at different luteal phases, and the results showed that Slit2 mRNA levels were significantly higher at the late stage than at the early and mid-luteal stages (Fig. 1B, P<0.05). It is interesting to note that the expression level of Robo1 was also highest at the late stage corresponding to that of its ligand Slit2 (Fig. 1B, P<0.01). Using immunohistochemistry (IHC), we then located SLIT2 and ROBO1 in the late-luteal-stage ovaries of mice. The results showed that SLIT2 and ROBO1 were co-localized in the luteal cells of the mouse CL, and almost no positive signal was observed in the follicular and stromal cells (Fig. 1C). These demonstrate that Slit2 and Robo1 are highly and specifically expressed in the mouse CL during the late stage and are probably involved in the regulation of luteolysis.
Expression of the Slit and Robo family members in mouse ovary. (A) mRNA levels of the Slit and Robo family members in the mid-CL of mice, as measured by real-time PCR. (B) Real-time PCR analysis of Slit2 and Robo1 mRNA levels in the staged mouse CL. Data in (A) and (B) are all means±s.e.m. of three independent experiments done in triplicate and normalized to their respective control (*P<0.05 and **P<0.01, by ANOVA). (C) Dual labeling of SLIT2 and ROBO1 was carried out in the late-luteal-phase ovaries of mice. Green fluorescence indicates the localization of SLIT2. ROBO1-positive cells in the same field of the same slide were stained red fluorescence and the sections were counterstained with DAPI. NC, negative control. Arrows indicate representative double-stained cell, and all the scale bars represent 50 μm. Three mice were examined in this experiment; a representative result is shown. F, follicle; and S, stroma.
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0088
Slit/Robo interaction in the apoptosis of mouse luteal cells
In order to determine whether the Slit/Robo interaction is involved in the apoptosis of luteal cells in mice, we blocked Slit/Robo signaling in cultured luteal cells with a ligand trap consisting of a recombinant ROBO1/Fc chimera (0.1 μg/ml) or an equivalent volume of PBS/0.01% (w/v) BSA (control) for 72 h, and cell apoptosis was measured using an in situ cell death detection kit (Fig. 2A). We detected apoptosis in more than 5000 cells per treatment. In the ROBO1/Fc chimera-treated group, there were roughly 38% less apoptotic cells than in the control group (Fig. 2B). In addition, the expression of caspase3 was significantly decreased in the ROBO1/Fc chimera-treated group than in the control group (Fig. 2C, P<0.05). These data confirm that Slit/Robo signaling enhances the apoptosis of luteal cells.
Effect of the Slit/Robo interaction on the apoptosis of mouse luteal cells. (A) Luteal cell apoptosis after 72 h treatment with ROBO1/Fc chimera or PBS/0.01% (w/v) BSA (control). The enlarged images of the boxed regions are shown on the right side of the merged pictures. Arrows indicate apoptotic nuclei. All the scale bars represent 50 μm. (B) Percentages of apoptotic cells accounting for the total luteal cells. (C) Caspase3 mRNA expression in the control and ROBO1/Fc chimera treatment groups was examined using real-time PCR. Results are means±s.e.m. of three independent experiments done in triplicate and normalized to the control group (*P<0.05, by t-test).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0088
PGF2 α increases Slit2/Robo1 expression in cultured luteal cells
Since PGF2 α is known to be a key factor in the induction of luteolysis (Pharriss et al. 1972), we hypothesized that PGF2 α induces luteolysis by affecting the expression of Slit/Robo in the CL. To confirm this presumption, luteal cells were cultured in DMEM/F12 medium with the addition of 0 (control), 0.01, 0.1, and 1 μM PGF2 α for 6 h, and the effect of PGF2 α on the expression of Slit2/Robo1 in the luteal cells was measured. The results showed that 0.1 and 1 μM PGF2 α significantly increased Slit2 mRNA levels (P<0.05), but 0.01 μM PGF2 α had no obvious effect on the expression of Slit2. However, all doses of PGF2 α used increased Robo1 mRNA levels in a dose-dependent manner (Fig. 3A, P<0.01 and P<0.001).
Upregulation of the expression of Slit2/Robo1 in luteal cells by PGF2 α in vitro. (A) Expression levels of Slit2 and Robo1 were measured using real-time PCR after incubating the luteal cells with 0 (control), 0.01, 0.1, and 1 μM PGF2 α for 6 h. (B) mRNA levels of Slit2 and Robo1 at 0 (control), 3, 6, 12, and 24 h after incubating the luteal cells with 1 μM PGF2 α. Results are means±s.e.m. of three independent experiments conducted in triplicate and normalized to their respective control (*P<0.05, **P<0.01, and ***P<0.001, by ANOVA).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0088
We then examined Slit2 and Robo1 mRNA levels after incubating the cells with 1 μM PGF2 α for 0, 3, 6, 12, and 24 h. The results showed that there was a gradual increase in Slit2 and Robo1 mRNA levels from 0 to 12 h. However, the enhancing effect of 1 μM PGF2 α on the expression of Slit2 and Robo1 decreased after the cells were cultured for 24 h (Fig. 3B). These data reveal that PGF2 α upregulates the expression of Slit2 and Robo1 in a dose-dependent and time-dependent manner.
PGF2 α specifically increases Slit2/Robo1 expression through PKC-dependent ERK1/2 and P38 MAPK signaling pathways
It has been reported that PGF2 α binds with its G-protein-coupled receptor and activates PKC and ERK1/2, which subsequently enhance related gene transcriptions in bovine luteal cells (Chen et al. 2001). In order to identify the signaling pathways that PGF2 α uses to affect the expression of Slit2/Robo1 in mouse luteal cells, cultured luteal cells were separately pretreated with H89 (a PKA inhibitor), CH (a PKC inhibitor), PD98059 (an ERK1/2 inhibitor), SB203580 (a P38 inhibitor), and SP600125 (a JNK inhibitor) for 1 h, followed by incubation with 1 μM PGF2 α for 6 h. Slit2 and Robo1 mRNA levels were detected using real-time PCR. The results showed that CH, PD98059, and SB203580 blocked the enhancing effect of PGF2 α on the expression of Slit2 and Robo1, whereas H89 and SP600125 did not modify Slit2 and Robo1 mRNA levels induced by PGF2 α (Fig. 4). These results indicate that PKC-dependent ERK1/2 and P38 MAPK signaling pathways are involved in the PGF2 α-induced Slit2/Robo1 expression in mouse luteal cells.
Relative mRNA levels of Slit2 (A) and Robo1 (B) in cultured luteal cells that were treated with PGF2 α and several specific inhibitors. Inhibitors were added 1 h before the addition of PGF2 α, and all the inhibitors were of a final concentration of 20 μM. After 6 h of exposure to PGF2 α, the expression of Slit2/Robo1 in each group was determined using real-time PCR. Results are all means±s.e.m. of three independent experiments done in triplicate and normalized to the control group (*P<0.05 and **P<0.01, by ANOVA; NS, no statistical significance).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0088
PGF2 α increases Slit2/Robo1 expression in the mouse CL
On D6 after hCG injection, the mice were i.p. injected with 10 μg cloprostenol, a synthetic analog of PGF2 α. CL tissues were collected at 0 h (control), 4, 12, and 18 h after cloprostenol injection. The mRNA levels of Bax, Bcl2, caspase9, caspase3, and Slit2/Robo1 were detected using real-time PCR. The results showed that Bax, Bax/Bcl2, caspase9, and caspase3 mRNA levels were upregulated at 12 h (Fig. 5B and C, P<0.01), while Slit2 and Robo1 mRNA levels were significantly increased at 4 h (P<0.05), reaching a maximum at 12 h (P<0.05 and P<0.01 respectively), followed by a significant decline at 18 h (Fig. 5D and E). The protein levels of SLIT2 and ROBO1 were increased at 12 and 18 h (Fig. 5F and G, P<0.05 and P<0.01). These data confirm the in vitro results and demonstrate that PGF2 α enhances the expression of Slit2/Robo1 and enhances cell apoptosis in the CL in vivo.
Cloprostenol increases apoptosis-related genes and Slit2/Robo1 expressions in CL in vivo. (A) Schematic representation of the experimental procedure for cloprostenol injection and CL collection in mice. (B) mRNA levels of Bax, Bax/Bcl2, caspase9, and caspase3 in the CL following cloprostenol injection. (D) mRNA levels of Slit2 and Robo1 in the CL following cloprostenol injection. (F) Protein levels of SLIT2 and ROBO1 in the CL at 0, 4, 12, and 18 h following cloprostenol injection. (C, E and G) Quantification of the gene/protein levels shown in (B), (D) and (F) respectively relative to those of GAPDH. GAPDH is an internal control. Results are means±s.e.m. of three independent experiments done in triplicate and normalized to 0 h of injection (*P<0.05 and **P<0.01, by ANOVA).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0088
Slit/Robo mediates the effects of PGF2 α on the apoptosis of luteal cells
In order to determine whether the regulating effects of PGF2 α on CL regression are mediated by the Slit/Robo interaction, cultured luteal cells were treated either with or without PGF2 α in the presence or absence of ROBO1/Fc chimera for 24 h. Cell apoptosis was measured using an in situ apoptosis analysis kit. We detected apoptosis in more than 5000 cells per treatment, and the results showed that the number of apoptotic cells after treatment with PGF2 α and the ROBO1/Fc chimera decreased by about 50% compared with that of cells treated with PGF2 α only (Fig. 6A and B). In addition, the expression of Bax, caspase9, and caspase3 was measured as shown in Fig. 6C. In the PGF2 α with ROBO1/Fc chimera-treated group, the expression of caspase9 and caspase3 was significantly decreased compared with that in the PGF2 α treatment group (P<0.05). However, the expression level of Bax was not decreased. These data indicate that the blockade of the Slit/Robo interaction reduces the apoptosis of luteal cells induced by PGF2 α.
Reduction of PGF2 α-induced caspase-dependent apoptosis in mouse luteal cells by ROBO1/Fc chimera. (A) Mouse luteal cells treated with or without PGF2 α in the presence or absence of ROBO1/Fc chimera were probed using in situ apoptosis analysis. The enlarged images of the boxed regions are shown on the right side of the merged pictures. Arrows indicate apoptotic nuclei. All the scale bars represent 100 μm. (B) Percentages of apoptotic cells accounting for the total luteal cells. (C) mRNA levels ofBax, caspase9, and caspase3 in cultured luteal cells that were treated with or without PGF2 α in the presence or absence of ROBO1/Fc chimera for 24 h. Results are means±s.e.m. of three independent experiments conducted in triplicate and normalized to that of the control group (*P<0.05, by ANOVA; NS, no statistical significance).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0088
Discussion
PGF2 α is the main luteolytic agent in many species, including mouse (Carambula et al. 2003). The Slit/Robo family members have been detected in the human ovary and found to be required for luteolysis (Dickinson et al. 2008). However, the functional relationship between PGF2 α and Slit/Robo in the regulation of luteolysis has not been established. Our results showed that SLIT2 and ROBO1 are co-localized in luteal cells in the mouse ovary. Both in vitro and in vivo results first indicate that PGF2 α increases the expression of Slit2/Robo1 both at gene and protein levels and the blockade of Slit/Robo signaling decreases the levels of apoptosis in luteal cells induced by PGF2 α.
The Slit/Robo family comprises three ligands and four transmembrane receptors and their expressions have been detected in different tissues, such as neuronal tissue (Andrews et al. 2007), blood vessels (Jones et al. 2008, Koch et al. 2011), and the reproductive system (Dickinson et al. 2008, 2010, Duncan et al. 2010). The dominant cell types expressing SLIT2/ROBO1 in the human ovary are the granulosa luteal cells and theca luteal cells (Dickinson et al. 2008). In this study, the expression of the Slit/Robo family members in the mouse CL was detected and it was observed that Slit2 and Robo1 were co-expressed in luteal cells as indicated by IHC; these findings are in agreement with the results obtained in the human ovary (Dickinson et al. 2008). The real-time PCR results showed that the abundance of Slit2 was higher than that of Slit1 and Slit3, and Robo1 level was higher than Robo2, Robo3, and Robo4 levels. These findings indicate that Slit2 and Robo1 have a function in the mouse CL.
Most functional studies on Slit/Robo have focused on cell migration, apoptosis, and tissue remodeling (Dallol et al. 2002, Hinck 2004). Since CL structural regression is characterized by cell apoptosis (Juengel et al. 1993, McCormack et al. 1998), we postulate that Slit/Robo is involved in the regulation of the apoptosis of mouse luteal cells. Our results demonstrate that Slit2 and Robo1 mRNA levels are significantly higher in the late luteal phase during which the CL sharply regresses. When Slit/Robo signaling is blocked, there is a sharp reduction in the number of apoptotic luteal cells and in the expression of genes that are closely associated with cell apoptosis. These results demonstrate that the Slit/Robo interaction plays an important role in luteolysis in mice.
PGF2 α is important for luteolysis (Pharriss et al. 1972), and PGF2 α signaling involves its binding to a PGF2 α receptor and thus activating the PKC-dependent ERK1/2 pathway (Tai et al. 2001, Stocco et al. 2002). This study has proved that PGF2 α increases the expression of Slit2/Robo1 in luteal cells in vitro. Furthermore, PGF2 α induces the expression of Slit2/Robo1 in luteal cells through the PKC-dependent ERK1/2 and P38 MAPK signaling pathways, which subsequently enhance cell apoptosis in the CL. In addition, cloprostenol, a synthetic analog of PGF2 α, also upregulates the expression of Slit2/Robo1 in the CL in vivo. It is interesting that both Slit2 and its Robo1 receptor seem to be similarly regulated by cloprostenol at the same time, such a pattern of parallel ligand and receptor regulation indicates that the stimulation of this pathway has functional importance.
In order to assess whether the effect of PGF2 α on luteolysis depends on Slit/Robo signaling, we examined PGF2 α-induced luteal cell apoptosis with or without a Slit/Robo signaling inhibitor. Our results revealed that a Slit/Robo signaling inhibitor significantly decreases the levels of PGF2 α-induced luteal cell apoptosis. These findings demonstrate that PGF2 α and Slit2/Robo1 are involved in the regulation of mouse luteolysis by their interactions. However, other death receptor-activating cytokines such as tumor necrosis factor α (TNFα (TNF)) and FasL also mediate the effects of PGF2 α on luteolysis (Quirk et al. 2000, Pate & Landis Keyes 2001, Carambula et al. 2003).
Both the Robos and PGF2 α receptors are membrane receptors and their function is the promotion of cell apoptosis by the activation of apoptotic signaling cascades in the CL. It has been shown that PGF2 α interacts with its G-protein-coupled receptor to increase the ratio of Bax to Bcl2, which are closely associated with the elevation of the expression of caspase9 and caspase3 (Yadav et al. 2005). The mechanism by which Slit/Robo exerts this effect on apoptosis is unclear; however, the deleted in colorectal cancer (DCC) pathway may play a role in this progression. Slit2 can bind to netrin-1 directly or can activate the interaction between Robo and DCC (Stein & Tessier-Lavigne 2001), which could, in principle, interfere with the netrin-1–DCC interaction. DCC can transmit pro-apoptotic signals in the absence of netrin-1 by activating caspase3 and caspase9 (Forcet et al. 2001). These findings suggest that caspase9 and caspase3 may be the mediating molecules between PGF2 α and Slit/Robo in their interactions in the progression of luteolysis. In support of this hypothesis, our results demonstrate that the ROBO1/Fc chimera reduces cell apoptosis and caspase9 and caspase3 expression induced by PGF2 α in the luteal cells.
In conclusion, our results show that SLIT2 and ROBO1 are highly expressed and co-localized in the luteal cells of mice and they promote luteolysis by mediating the signaling pathway of PGF2 α-induced luteal cell apoptosis.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Basic Research Program of China (2012CB944703 and 2013CB945503) and the Natural Science Foundation of China (31172288).
Author contribution statement
S C conceived and designed the experiments; X Z carried out the experiments; X Z, J L, and J L analyzed the data; H L and K G provided the reagents/materials/analysis tools; and S C and X Z wrote the manuscript.
References
Adams JM & Cory S 1998 The Bcl-2 protein family: arbiters of cell survival. Science 281 1322–1326. (doi:10.1126/science.281.5381.1322)
Andrews WD , Barber M & Parnavelas JG 2007 Slit–Robo interactions during cortical development. Journal of Anatomy 211 188–198. (doi:10.1111/j.1469-7580.2007.00750.x)
Bowen JM , Keyes PL , Warren JS & Townson DH 1996 Prolactin-induced regression of the rat corpus luteum: expression of monocyte chemoattractant protein-1 and invasion of macrophages. Biology of Reproduction 54 1120–1127. (doi:10.1095/biolreprod54.5.1120)
Carambula SF , Pru JK , Lynch MP , Matikainen T , Goncalves PB , Flavell RA , Tilly JL & Rueda BR 2003 Prostaglandin F2α- and FAS-activating antibody-induced regression of the corpus luteum involves caspase-8 and is defective in caspase-3 deficient mice. Reproductive Biology and Endocrinology 1 15. (doi:10.1186/1477-7827-1-15)
Chen D , Fong HW & Davis JS 2001 Induction of c-fos and c-jun messenger ribonucleic acid expression by prostaglandin F2α is mediated by a protein kinase C-dependent extracellular signal-regulated kinase mitogen-activated protein kinase pathway in bovine luteal cells. Endocrinology 142 887–895. (doi:10.1210/en.142.2.887)
Dai CF , Jiang YZ , Li Y , Wang K , Liu PS , Patankar MS & Zheng J 2011 Expression and roles of Slit/Robo in human ovarian cancer. Histochemistry and Cell Biology 135 475–485. (doi:10.1007/s00418-011-0806-2)
Dallol A , Da Silva NF , Viacava P , Minna JD , Bieche I , Maher ER & Latif F 2002 SLIT2, a human homologue of the Drosophila Slit2 gene, has tumor suppressor activity and is frequently inactivated in lung and breast cancers. Cancer Research 62 5874–5880.
Dickinson RE , Dallol A , Bieche I , Krex D , Morton D , Maher ER & Latif F 2004 Epigenetic inactivation of SLIT3 and SLIT1 genes in human cancers. British Journal of Cancer 91 2071–2078. (doi:10.1038/sj.bjc.6602222)
Dickinson RE , Myers M & Duncan WC 2008 Novel regulated expression of the SLIT/ROBO pathway in the ovary: possible role during luteolysis in women. Endocrinology 149 5024–5034. (doi:10.1210/en.2008-0204)
Dickinson RE , Hryhorskyj L , Tremewan H , Hogg K , Thomson AA , McNeilly AS & Duncan WC 2010 Involvement of the SLIT/ROBO pathway in follicle development in the fetal ovary. Reproduction 139 395–407. (doi:10.1530/REP-09-0182)
Duncan WC , McDonald SE , Dickinson RE , Shaw JL , Lourenco PC , Wheelhouse N , Lee KF , Critchley HO & Horne AW 2010 Expression of the repulsive SLIT/ROBO pathway in the human endometrium and fallopian tube. Molecular Human Reproduction 16 950–959. (doi:10.1093/molehr/gaq055)
Forcet C , Ye X , Granger L , Corset V , Shin H , Bredesen DE & P Mehlen 2001 The dependence receptor DCC (deleted in colorectal cancer) defines an alternative mechanism for caspase activation. PNAS 98 3416–3421. (doi:10.1073/pnas.051378298)
Gaytan F , Morales C , Bellido C , Aguilar R , Millan Y , Martin De Las Mulas J & Sanchez-Criado JE 2000 Progesterone on an oestrogen background enhances prolactin-induced apoptosis in regressing corpora lutea in the cyclic rat: possible involvement of luteal endothelial cell progesterone receptors. Journal of Endocrinology 165 715–724. (doi:10.1677/joe.0.1650715)
Hasumoto K , Sugimoto Y , Yamasaki A , Morimoto K , Kakizuka A , Negishi M & Ichikawa A 1997 Association of expression of mRNA encoding the PGF2α receptor with luteal cell apoptosis in ovaries of pseudopregnant mice. Journal of Reproduction and Fertility 109 45–51. (doi:10.1530/jrf.0.1090045)
Hernandez F , Peluffo MC , Stouffer RL , Irusta G & Tesone M 2011 Role of the DLL4-NOTCH system in PGF2α-induced luteolysis in the pregnant rat. Biology of Reproduction 84 859–865. (doi:10.1095/biolreprod.110.088708)
Hinck L 2004 The versatile roles of “axon guidance” cues in tissue morphogenesis. Developmental Cell 7 783–793. (doi:10.1016/j.devcel.2004.11.002)
Jones CA , London NR , Chen H , Park KW , Sauvaget D , Stockton RA , Wythe JD , Suh W , Larrieu-Lahargue F & Mukouyama YS et al. 2008 Robo4 stabilizes the vascular network by inhibiting pathologic angiogenesis and endothelial hyperpermeability. Nature Medicine 14 448–453. (doi:10.1038/nm1742)
Juengel JL , Garverick HA , Johnson AL , Youngquist RS & Smith MF 1993 Apoptosis during luteal regression in cattle. Endocrinology 132 249–254. (doi:10.1210/en.132.1.249)
Koch AW , Mathivet T , Larrivee B , Tong RK , Kowalski J , Pibouin-Fragner L , Bouvree K , Stawicki S , Nicholes K & Rathore N et al. 2011 Robo4 maintains vessel integrity and inhibits angiogenesis by interacting with UNC5B. Developmental Cell 20 33–46. (doi:10.1016/j.devcel.2010.12.001)
Kuranaga E , Kanuka H , Bannai M , Suzuki M , Nishihara M & Takahashi M 1999 Fas/Fas ligand system in prolactin-induced apoptosis in rat corpus luteum: possible role of luteal immune cells. Biochemical and Biophysical Research Communications 260 167–173. (doi:10.1006/bbrc.1999.0858)
Kuranaga E , Kanuka H , Hirabayashi K , Suzuki M , Nishihara M & Takahashi M 2000 Progesterone is a cell death suppressor that downregulates Fas expression in rat corpus luteum. FEBS Letters 466 279–282. (doi:10.1016/S0014-5793(00)01090-5)
Latil A , Chene L , Cochant-Priollet B , Mangin P , Fournier G , Berthon P & Cussenot O 2003 Quantification of expression of netrins, slits and their receptors in human prostate tumors. International Journal of Cancer 103 306–315. (doi:10.1002/ijc.10821)
McCormack JT , Friederichs MG , Limback SD & Greenwald GS 1998 Apoptosis during spontaneous luteolysis in the cyclic golden hamster: biochemical and morphological evidence. Biology of Reproduction 58 255–260. (doi:10.1095/biolreprod58.1.255)
Olofsson J & Selstam G 1988 Changes in corpus luteum content of prostaglandin F2α and E in the adult pseudopregnant rat. Prostaglandins 35 31–40. (doi:10.1016/0090-6980(88)90272-9)
Park KW , Morrison CM , Sorensen LK , Jones CA , Rao Y , Chien CB , Wu JY , Urness LD & Li DY 2003 Robo4 is a vascular-specific receptor that inhibits endothelial migration. Developmental Biology 261 251–267. (doi:10.1016/S0012-1606(03)00258-6)
Pate JL & Landis Keyes P 2001 Immune cells in the corpus luteum: friends or foes? Reproduction 122 665–676. (doi:10.1530/rep.0.1220665)
Pharriss BB , Tillson SA & Erickson RR 1972 Prostaglandins in luteal function. Recent Progress in Hormone Research 28 51–89.
Quirk SM , Harman RM , Huber SC & Cowan RG 2000 Responsiveness of mouse corpora luteal cells to Fas antigen (CD95)-mediated apoptosis. Biology of Reproduction 63 49–56. (doi:10.1095/biolreprod63.1.49)
Roughton SA , Lareu RR , Bittles AH & Dharmarajan AM 1999 Fas and Fas ligand messenger ribonucleic acid and protein expression in the rat corpus luteum during apoptosis-mediated luteolysis. Biology of Reproduction 60 797–804. (doi:10.1095/biolreprod60.4.797)
Sartorius U , Schmitz I & Krammer PH 2001 Molecular mechanisms of death-receptor-mediated apoptosis. Chembiochem 2 20–29. (doi:10.1002/1439-7633(20010105)2:1<20::AID-CBIC20>3.0.CO;2-X)
Singh RK , Indra D , Mitra S , Mondal RK , Basu PS , Roy A , Roychowdhury S & Panda CK 2007 Deletions in chromosome 4 differentially associated with the development of cervical cancer: evidence of slit2 as a candidate tumor suppressor gene. Human Genetics 122 71–81. (doi:10.1007/s00439-007-0375-6)
Stein E & Tessier-Lavigne M 2001 Hierarchical organization of guidance receptors: silencing of netrin attraction by slit through a Robo/DCC receptor complex. Science 291 1928–1938. (doi:10.1126/science.1058445)
Stocco CO , Lau LF & Gibori G 2002 A calcium/calmodulin-dependent activation of ERK1/2 mediates JunD phosphorylation and induction of nur77 and 20α-hsd genes by prostaglandin F2α in ovarian cells. Journal of Biological Chemistry 277 3293–3302. (doi:10.1074/jbc.M110936200)
Stocco C , Telleria C & Gibori G 2007 The molecular control of corpus luteum formation, function, and regression. Endocrine Reviews 28 117–149. (doi:10.1210/er.2006-0022)
Tai CJ , Kang SK , Choi KC , Tzeng CR & Leung PC 2001 Role of mitogen-activated protein kinase in prostaglandin F(2α) action in human granulosa-luteal cells. Journal of Clinical Endocrinology and Metabolism 86 375–380. (doi:10.1210/jc.86.1.375)
Taniguchi H , Yokomizo Y & Okuda K 2002 Fas–Fas ligand system mediates luteal cell death in bovine corpus luteum. Biology of Reproduction 66 754–759. (doi:10.1095/biolreprod66.3.754)
Thordarson G , Galosy S , Gudmundsson GO , Newcomer B , Sridaran R & Talamantes F 1997 Interaction of mouse placental lactogens and androgens in regulating progesterone release in cultured mouse luteal cells. Endocrinology 138 3236–3241. (doi:10.1210/en.138.8.3236)
Wu JY , Feng L , Park HT , Havlioglu N , Wen L , Tang H , Bacon KB , Jiang Z , Zhang X & Rao Y 2001 The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors. Nature 410 948–952. (doi:10.1038/35073616)
Yadav VK , Lakshmi G & Medhamurthy R 2005 Prostaglandin F2α-mediated activation of apoptotic signaling cascades in the corpus luteum during apoptosis: involvement of caspase-activated DNase. Journal of Biological Chemistry 280 10357–10367. (doi:10.1074/jbc.M409596200)
