Abstract
Bisphosphonates (BPs) are a major class of antiresorptive drug, and their molecular mechanisms of antiresorptive action have been extensively studied. Recent studies have suggested that BPs target bone-forming cells as well as bone-resorbing cells. We previously demonstrated that local application of a nitrogen-containing BP (N-BP), alendronate (ALN), for a short period of time increased bone tissue in a rat tooth replantation model. Here, we investigated cellular mechanisms of bone formation by ALN. Bone histomorphometry confirmed that bone formation was increased by local application of ALN. ALN increased proliferation of bone-forming cells residing on the bone surface, whereas it suppressed the number of tartrate-resistant acid phosphatase (TRAP)-positive osteoclasts in vivo. Moreover, ALN treatment induced more alkaline phosphatase-positive and osteocalcin-positive cells on the bone surface than PBS treatment. In vitro studies revealed that pulse treatment with ALN promoted osteocalcin expression. To track the target cells of N-BPs, we applied fluorescence-labeled ALN (F-ALN) in vivo and in vitro. F-ALN was taken into bone-forming cells both in vivo and in vitro. This intracellular uptake was inhibited by endocytosis inhibitors. Furthermore, the endocytosis inhibitor dansylcadaverine (DC) suppressed ALN-stimulated osteoblastic differentiation in vitro and it suppressed the increase in alkaline phosphatase-positive bone-forming cells and subsequent bone formation in vivo. DC also blocked the inhibition of Rap1A prenylation by ALN in the osteoblastic cells. These data suggest that local application of ALN promotes bone formation by stimulating proliferation and differentiation of bone-forming cells as well as inhibiting osteoclast function. These effects may occur through endocytic incorporation of ALN and subsequent inhibition of protein prenylation.
Introduction
Bisphosphonates (BPs) are a major class of antiresorptive drug. BPs are divided into nitrogen-containing BPs (N-BPs) and non-N-BPs. The P–C–P backbone structure of BPs exhibits a high affinity for bone mineral, and therefore BPs accumulate on bone surfaces (Sato et al. 1991, Azuma et al. 1995, Masarachia et al. 1996). Osteoclasts internalize accumulated BPs during the bone resorption process (Thompson et al. 2006, Coxon et al. 2008, Roelofs et al. 2010). Interestingly, uptake of fluorescence-labeled BPs such as alendronate (ALN) and risedronate by phagocytic cells was observed in vitro and in vivo, and was inhibited by endocytosis inhibitors in vitro (Thompson et al. 2006, Roelofs et al. 2010), suggesting that cellular uptake of BPs is a prerequisite for their effects on osteoclastic bone resorption.
Molecular analysis of their effect on bone resorption revealed that N-BPs such as ALN, risedronate, and zoledronate inhibit farnesyl diphosphate synthase, a key enzyme of the mevalonate pathway. They subsequently prevent the synthesis of isoprenoids required for prenylation of small GTPases such as Rap, Rac, Rho, Rab, and Cdc42. Accumulation of unprenylated small GTPases by N-BPs causes disruption of the actin cytoskeleton, altered trafficking of intracellular components, and impaired integrin signaling in osteoclasts (Luckman et al. 1998, Dunford et al. 2006, Rogers et al. 2011).
N-BPs may also target other cell types such as bone-forming cells. N-BPs stimulate proliferation and differentiation of osteoblasts at low concentrations. At high concentrations, N-BPs inhibit proliferation and bone nodule formation (Giuliani et al. 1998, Reinholtz et al. 2000). It has also been pointed out that higher concentrations of N-BPs are likely to be necessary for intracellular inhibition of small GTPase prenylation in osteoblasts (Coxon et al. 2008, Idris et al. 2008) and the antiapoptotic effects of N-BPs at low concentrations on osteoblasts may be exerted through activation of ERKs (Bellido & Plotkin 2011).
Local application of N-BPs has been shown to promote bone formation around N-BP-coated implants in vivo (Tanzer et al. 2005, Gao et al. 2009). Previously, we reported that bone tissues were increased around replanted teeth to which ALN was locally applied for a short duration of time (Shibata et al. 2004, Komatsu et al. 2008). Thus far, however, the precise biological mechanisms of this anabolic action on bone have remained unclear.
In this study, we extended our previous research to investigate the mechanisms of bone formation by local application of ALN. We adopted two approaches, histochemical analysis of an in vivo tooth replantation model and cellular analysis using in vitro primary osteoblastic cells, with a particular focus on intracellular ALN uptake into cells. We found that ALN affects proliferation and differentiation of osteoblasts as well as osteoclast function, and these effects possibly occur through endocytic intracellular uptake of ALN into those cells.
Materials and methods
All animal studies were approved by the Animal Care Committee of Tsurumi University School of Dental Medicine.
Local application of ALN in tooth replantation model
To assess local effects of N-BPs on bone remodeling, a tooth replantation model (Shibata et al. 2004) was used (Supplementary Figure 1, see section on supplementary data at the end of this article). Briefly, rat molars were extracted, immersed in 1 mM ALN (ALN group, n=35) or PBS alone (PBS group, n=28) for 5 min at room temperature, and put back into their sockets under anesthesia. In normal control rats (nonRL group, n=22), the teeth were not extracted. For local application of ALN with endocytosis inhibitor dansylcadaverine (Haigler et al. 1980, Thompson et al. 2006, Chen et al. 2009) (DC, a clathrin-mediated endocytosis inhibitor), extracted teeth were immersed in PBS (n=4), 1 mM ALN (n=4), 1 mM ALN+1 mM DC (n=4), and 1 mM DC (n=4) for 5 min at room temperature, and put back into their sockets. At certain time points, tissues were fixed and subjected to bone histomorphometry and immunohistochemistry (see below).
Bone histomorphometry
Animals in the ALN (n=6), PBS (n=5), and nonRL (n=4) groups received s.c. injections of calcein (5 mg/kg) on day 2 after tooth replantation and of Alizarin red (15 mg/kg) on day 16. Undecalcified sections were prepared (Schenk et al. 1984) from maxillae dissected on day 18, and observed with a confocal laser scanning microscope (CLSM, PCM2000, Nikon, Tokyo, Japan). We used CLSM images for bone histomorphometry (Parfitt et al. 1987). The whole inter-radicular area between the mesial and distal roots (tissue volume (TV) (mm2); Fig. 1A, upper panel) was measured by manually tracing the boundaries between tooth root surfaces or bone surfaces and soft tissues on histological sections using Image J (NIMH, Bestheda, MD, USA). The area of bone (bone volume (BV) (mm2)) within the TV was measured by manually tracing the boundaries between the bone surfaces and soft tissues using Image J. BV/TV was then calculated. In addition, mineral apposition rate (MAR (μm/day)) was measured as the distance between two consecutive labels (Fig. 1A, lower panel) divided by 14 days. Mineralizing surface per bone surface (MS/BS (%)) was measured as 100×(double label surface+0.5×single label surface)/bone surface (Parfitt et al. 1987) in selected areas (0.65×0.65 mm), for trabecular bones of the inter-radicular region between the mesial and distal roots using Image J. Then, bone formation rate (BFR) was determined as product of MAR and MS/BS/100.
Local ALN treatment accelerates bone formation in vivo. (A) Confocal laser scanning microscopy of undecalclfled longitudinal sections of rat maxillary first molars 18 days after replantation. The teeth were replanted after pretreatment with PBS (middle column) or 1 mM alendronate (ALN, right column). Sections were also prepared from nonreplanted teeth (nonRL, left column). (Lower panels) Magnified images of white squares in the upper panels showing double bone labels by Alizarin red (arrowheads) and calcein (arrows). m, mesial root; d, distal root. Scale bars for upper panel, 0.5 mm and for lower panel, 100 μm. (B) Bone histomorphometry. Bone volume (BV (mm2)) and bone volume/tissue volume (BV/TV (%)) were determined within the area (TV) surrounded by the white dotted line in (A). Mineral apposition rate (MAR (μm/day)) was determined from the distance, as indicated by white arrows, between two consecutive labels and mineralizing surface per bone surface (MS/BS (%)) for trabecular bones of the inter-radicular region between the mesial and distal roots. Then, bone formation rate (BFR) was determined as product of MAR and MS/BS. Each column and bar indicate mean+1 s.d. Significant differences from the PBS group: **P<0.01 and ***P<0.001.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
Procedures of immunohistochemistry for BrdU and osteocalcin, and of tartrate-resistant acid phosphatase (TRAP) and alkaline phosphatase (ALP) staining
Local application of a fluorescence-labeled ALN analog in replanted teeth
To track the target cells of ALN after tooth replantation, a fluorescence-labeled analog of ALN (F-ALN) was prepared by covalent conjugation of ALN to N-hydroxysuccinimide-5-(and 6-)-carboxyfluorescein (Pierce, Rockford, IL, USA; Zaheer et al. 2001, Thompson et al. 2006; Supplementary Methods, see section on supplementary data at the end of this article). To determine the ratio of labeled ALN:non-labeled ALN in the prepared solution, we measured the absorbance at 494 nm. The concentration of F-ALN was calculated to be 1.1 mM. Different mobilities of the F-ALN and of the fluorescence probe by thin layer chromatography (TLC) were confirmed (Zaheer et al. 2001). The mobile phase was 32.5% acetonitrile/67.5% H2O. Non-labeled ALN was detected with 0.25% ninhydrin in acetone and heat (110 °C) on TLC plate, and the concentration of non-labeled ALN in the F-ALN solution was estimated to be 3.1 mM. Thus, the F-ALN solution prepared in our laboratory contained 26% labeled ALN and 74% free ALN.
Extracted teeth were immersed in 1 mM F-ALN (F-ALN group), 1 mM non-labeled ALN (ALN group), or 1 mM fluorescein for 5 min at room temperature, and put back into their sockets. In normal control rats (nonRL group), the teeth were not extracted. On days 1, 4, 7, and 56, the maxillae were dissected. Supplementary Table 1, see section on supplementary data at the end of this article, shows the allocated numbers of rats used for experiments to investigate localization of F-ALN. Undecalcified sections were prepared (Schenk et al. 1984) and examined with a fluorescence microscope (ECLIPSE E800 or 80i, Nikon). Some sections were counterstained with DAPI. Fluoresence microscopic images were taken under the same exposure times.
Culture of primary rat calvarial osteoblasts and ROS 17/2.8 cell line
Primary osteoblastic cells were isolated from calvariae of newborn rats by serial enzymatic digestion (Wada et al. 1998). Cells were cultured in α-MEM (growth medium) containing 10% FCS and antibiotics (100 IU/ml penicillin G and 100 μg/ml streptomycin). Cells at the second passage were used for experiments. To differentiate osteoblasts, 5 mM β-glycerophosphate and 50 μg/ml ascorbic acid with or without 10−8 M dexamethasone were added to growth medium (differentiation medium). The osteoblast-like cell line ROS 17/2.8 was maintained in F-12 medium containing 5% FCS. Cell culture dishes were incubated in a humidified atmosphere of 5% CO2 in air at 37 °C. The medium was changed every 2 or 3 days.
Methyl thiazolyl tetrazorium (MTT) assay
Cells were plated in 96-well plates at 5×103 cells/well and cultured for 2 days (until subconfluence) in growth medium. On day 2, the medium was replaced with differentiation medium. On day 3, ALN was added to the medium at 10−6 or 10−5 M in the presence or absence of 100 μM DC or 20 μM geranylgeraniol (GO). On day 6, the medium was replaced with fresh medium, and the culture continued. On days 7 and 14, MTT assay was performed.
Real-time RT-PCR analysis
Cells (105) were plated in six-well plates and treated as described for the MTT assay. On days 7 and 14, total RNA was extracted and real-time RT-PCR analysis was performed (Ideno et al. 2009). The primer sequences are listed in Table 1.
Primers for real-time PCR experiments
| Accession numbers | Forward primers | Reverse primers | |
|---|---|---|---|
| GAPDH | M32599 | GCCAAACGGGTCATCATCTC | GTCATGAGCCCTTCCACAAT |
| ALP | NM_013059 | GACAAGAAGCCCTTCACAGC | GGGGGATGTAGTTCTGCTCA |
| Osteocalcin | NM_013414.1 | CAAGCAGGAGGGCAGTAAGG | CCATAGATGCGCTTGTAGGC |
ALP activity assay and Alizarin red staining
Cells (2×104) were plated in 24-well plates and treated as described for the MTT assay. On days 7, 14, and 21, ALP activity assay and Alizarin red staining were performed (Ideno et al. 2009).
Cellular uptake of F-ALN
Cells were plated onto glass coverslips and cultured in growth medium. We also prepared a fluorescently labeled analog of ALN (AX-ALN) by covalent conjugation of ALN to Alexa Fluor 488 carboxylic acid, succinimidyl ester (Molecular Probes, Eugene, OR, USA), in a procedure similar to that for F-ALN. The AX-ALN solution prepared in our laboratory contained 10% labeled ALN and 90% free ALN. Cells were incubated with AX-ALN or F-ALN (10−4, 10−5, and 10−6 M) in the presence or absence of 100 μM DC and 20 μM chlorpromazine (CP), a clathrin-mediated endocytosis inhibitor, or 1 mM methyl-β-cyclodextrin (MB), a caveolin-mediated endocytosis inhibitor (Thompson et al. 2006, Kelley et al. 2009, Masaike et al. 2010). After treatment for 1 and 4 h, the coverslip-bound cells were fixed in 3.7% formaldehyde, and examined in a CLSM (TCS-SP5, Leica, Tokyo, Japan). CLSM images were acquired under identical laser and detection values (Blue Diode 405 nm laser and Ar 488 nm laser, sequential scan mode, PL APO 63× oil immersion objective lens, image size 1024×1024 pixel, z-step size 0.5–0.6 μm, z volume 11–16 μm) by using LAS AF Software (Leica, Tokyo, Japan). Some cells were counterstained with DAPI.
Western blot analysis
Cells (105) were plated in six-well plates and cultured in F-12 medium containing 5% FCS. After subconfluence, to examine the inhibition of protein prenylation by ALN, cells were starved in F-2 medium containing 0.1% BSA overnight, and then treated with 10−6, 10−5, or 10−4 M ALN for 24 h in the presence or absence of DC (100 μM) or GO (20 μM) for 24 h. To examine activation of ERK by ALN, cells were treated as described above and treated with ALN (10−6 or 10−5 M) for 3 or 10 min in the presence or absence of DC (100 μM), or bFGF (10 ng/ml) for 15 min as positive control. Cell lysates were subjected to 12% SDS–PAGE and immunoblot analyses using antibodies against Rap1A (1:300, sc-1482, Santa Cruz), which specifically recognizes the unprenylated form of Rap1A (Reszka et al. 2001, Thompson et al. 2006), Rap1 (1:300, sc-65, Santa Cruz), phosphorylated ERK1/2 (1:1000, sc-783, Santa Cruz), or total ERK1/2 (1:1000, sc-94, Santa Cruz). The immunoreactive protein bands were detected using HRP-conjugated secondary antibodies and chemiluminescence (Ideno et al. 2009).
Statistical analysis
For the tooth replantation model, data are shown as mean and s.d. of three to five rats. For cell culture, data are presented from a typical one of two or three repeated experiments and are shown as the mean and s.d. of two to five samples. Statistical differences were evaluated using ANOVA followed by post hoc Scheffé's test or t-test.
Results
Effects of local ALN treatment on bone formation
To examine whether locally applied ALN affects bone formation, we performed double-fluorochrome labeling. Double labels in the ALN group were observed in broad areas around the replanted teeth, and interlabel distances were wider than in the PBS and nonRL groups (white arrows in Fig. 1A, lower panels). BV and BV/TV were greater in the ALN group than in the nonRL and PBS groups (P<0.01 or 0.001; Fig. 1B). MAR, MS/BS, and BFR were also greater in the ALN group than in the PBS and nonRL groups (P<0.01 or 0.001; Fig. 1B). These results indicate that bone formation was significantly accelerated in the trabecular bone around the replanted teeth in the ALN-treated group.
ALN inhibits TRAP-positive bone resorbing cells in vivo
The morphology, localization, and number of TRAP-positive, attached multinuclear cells remained similar in the PBS and ALN groups (Fig. 2) at 1 day after the operation. However, the number of TRAP-positive, attached multinuclear cells were significantly less in the ALN than in the PBS group at 4 and 7 days (Fig. 2). While large multinuclear TRAP-positive cells attached to active bone resorption sites in the PBS group, many TRAP-positive multinuclear cells in the ALN group were detached from resorption sites and demonstrated a round shape (Fig. 2), suggesting that they are less active. Thus, ALN inhibits TRAP-positive bone resorbing cell function in vivo.
ALN inhibits tartrate-resistant acid phosphatase (TRAP)-positive bone resorbing cells in vivo. (A) TRAP staining 7 days after replantation showing characteristic morphologies of TRAP-positive cells. Pictures were taken from areas similar to those in the magnified images (lower panels) of Fig. 1A. Scale bar, 10 μm. (B) Numbers of multinuclear TRAP-positive cells attached to trabecular bone surfaces (as indicated by arrowheads) between the mesial and distal roots of the replanted teeth 1, 4, and 7 days after replantation. Multinuclear TRAP-positive, attached cells are presented as number per bone surface (BS (mm)). b, bone; bm, bone marrow. Significant differences from the PBS group: *P<0.05.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
ALN activates bone-forming cells in vivo
Since locally applied ALN stimulates bone formation, we examined effects of ALN on proliferation and differentiation of bone-forming cells in vivo. We analyzed proliferation by BrdU uptake and evaluated differentiation by ALP staining and osteocalcin. BrdU-positive cells were observed within the bone marrow and close to the bone surfaces (Fig. 3A). To count BrdU-positive bone-forming cells adjacent to bone surfaces, we measured them in the area within ±24 μm from the bone surfaces. The number of BrdU-positive bone-forming cells was greater in the ALN group than the PBS group at days 1, 4, and 7 (Fig. 3B), although the difference was significant only at day 7 (P<0.05). The ratio of ALP-positive cell surface:bone surface was significantly higher in the ALN group than in the PBS group at day 7 (Fig. 3C and D, P<0.05). The ratio of osteocalcin-positive cell surface:bone surface was greater at days 4 and 7 in the ALN group than in the PBS group, although the difference was significant only at day 7 (Fig. 3E and F, P<0.01). These results suggest that ALN promoted proliferation and differentiation of bone-forming cells in vivo.
ALN activates bone-forming ceils in vivo. (A) Immunostaining of BrdU-labeled cells between the mesial and distal roots of replanted teeth 2 h (day 1) and 6 days (day 7) after BrdU injection. Pictures were taken from areas similar to those in the magnified images (lower panels) of Fig. 1A. Arrowheads indicate BrdU-labeled cells in the area within ±24 μm (as indicated by arrows) from bone surfaces (as traced by red dotted lines). Scale bar, 20 μm. (B) Ratios of BrdU-positive cells in the area within ±24 μm from bone surfaces including bone matrix. (C) Alkaline phosphatase (ALP) staining 7 days after replantation. Pictures were taken from areas similar to those in (A). Arrowheads indicate ALP-positive cells. Scale bar, 20 μm. (D) ALP-positive cell surface/bone surface (%). (E) Immunostaining for osteocalcin 7 days after replantation. Pictures were taken from areas similar to those in (A and C). Scale bar, 20 μm. (F) Osteocalcin (Oc)-positive cell surface/bone surface (%). Each column and bar indicate mean+1 s.d. Significant differences from the PBS group: *P<0.05 and **P<0.01.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
The stimulating effect was only found for osteocalcin but not for ALP in vitro
We next examined the effects of ALN on proliferation and differentiation of bone-forming cells in vitro. The number of primary osteoblastic cells markedly reduced after treatment with 10−4 M ALN for 3 days, but did not change after treatment with 10−5–10−8 M (Supplementary Figure 2A, see section on supplementary data at the end of this article). It has been reported that short-term treatment (for 1–5 days) with 10−6–10−5 M zoledronic acid upregulates osteogenic gene expression (Chaplet et al. 2004, Pan et al. 2004). Therefore, we analyzed osteoblast differentiation in vitro after treatment with 10−5 and 10−6 M ALN for 3 days. ALN concentrations of 10−6 and 10−5 M did not affect cell viability (Supplementary Figure 2B), ALP gene expression, and ALP activity (Supplementary Figure 2C and D) at days 7 and 14. However, osteocalcin gene expression (Fig. 4A) and osteocalcin-positive cells (Fig. 4B and C) significantly increased at day 14 after treatment with 10−6 and 10−5 M ALN. Similar effects of ALN on osteocalcin gene expression were also observed when 10−8 M dexamethasone was added (Supplementary Figure 3).
Effect of ALN on osteoblast differentiation in primary rat calvarial osteoblastic cells. Cells were treated with 10−6 or 10−5 M ALN from day 3 to day 6. (A) Gene expression of osteocalcin (Oc). (B) Immunofluorescence staining of osteocalcin at day 14. After fixation, cells were incubated with anti-osteocalcin primary antibody, stained with Alexa Fluor 594 conjugated secondary antibody (red) and counterstained with DAPI (blue). Scale bar, 30 μm. (C) Ratio of osteocalcin-positive cells (%) on day 14. Each column+bar represents the mean+1 s.d. Significant differences from the control: **P<0.01.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
F-ALN is taken into bone-forming cells in vivo
To determine the fate of locally applied ALN in vivo, we introduced F-ALN to visualize localization of ALN. Fluorescence microscopic analyses revealed extensive binding of F-ALN to mineralized surfaces of tooth roots of replanted teeth and their surrounding alveolar bones from days 1 through 56 after the operation (Supplementary Figure 4, see section on supplementary data given at the end of this article). We also observed binding of F-ALN to the trabecular bone surfaces of bone marrows distant from the replanted teeth (Supplementary Figure 4ii and iv) and around the replanted teeth (Supplementary Figure 4iii). Multinuclear cells residing around and distant from the replanted teeth incorporated large amounts of F-ALN at days 4 and 7 (Supplementary Figure 5). In addition to monocyte-lineage cells, bone-forming cells such as bone marrow stromal cells and osteoblast-like cells adjacent to the trabecular bone surfaces of bone marrows around (Fig. 5B, upper panels) and distant from (Fig. 5B, lower panels) the F-ALN-treated replanted teeth incorporated small amounts of F-ALN at days 1, 4, and 7. No fluorescence was detected in similar sites of non-labeled ALN-treated teeth (Fig. 5A, lower panel). These findings suggest that bone-forming cells or their progenitor cells directly incorporate ALN when ALN is applied locally in vivo even for a short period.
Fluorescence-labeled ALN (F-ALN) is taken into bone-forming cells in vivo. (A, Upper panel) Undemineralized longitudinal section of replanted teeth pretreated with F-ALN showing observation sites, proxinnal (Pro) and distal (Dis) sites for (B), 4 days after replantation. m, mesial root; d, distal root. Scale, 0.2 mm. (Lower panel) Negative control (NC). Sections were obtained from replanted teeth pretreated with non-labeled ALN, 4 days after replantation. No fluorescence was detected on bone surfaces (as indicated by the dotted line) and in cells under the same exposure time as in sections from replanted teeth pretreated with labeled ALN. Scale bar, 10 μm. (B) Incorporation of F-ALN by bone-forming cells adjacent to bone surfaces in bone marrows around replanted teeth (approximate sites indicated by white square Pro in (A); upper panels) and those in bone marrows distant from replanted teeth (approximate sites indicated by white square Dis in (A); lower panels) on days 4 and 7. Arrows indicate mononuclear cells incorporating F-ALN. b, trabecular bone. Scale bar, 10 μm. Sections were counterstained with DAPI and observed by fluorescence microscopy.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
Cellular uptake of F-ALN by primary osteoblastic cells occurs through endocytosis
To examine the mechanism of ALN uptake by osteoblasts, primary osteoblastic cells were treated for 1 and 4 h with F-ALN in the presence or absence of endocytosis inhibitors. The concentrations of labeled ALN include the concentrations used to evaluate the effect on proliferation and differentiation in calvarial osteoblastic cells. Similar to in vivo results, osteoblastic cells incorporated F-ALN (Fig. 6A, upper panels) when incubated in 10−4 or 10−5 M AX-ALN and F-ALN in a dose-dependent manner, but we barely detected the intracellular incorporation at 10−6 M (not shown). Co-incubation with 100 μM DC or 20 μM CP, clathrin-mediated endocytosis inhibitors, considerably attenuated uptake of 10−5 M (Fig. 6A, lower panels) and 10−4M AX-ALN. A caveolin-mediated endocytosis inhibitor, MB (1 mM), did not markedly affect cellular uptake of AX-ALN. Vesicular localization of internalized labeled ALN closely resembled that of a fluorescence-labeled dextran analog, a general endocytosis marker (Supplementary Figure 6, see section on supplementary data given at the end of this article). These findings suggest that osteoblastic cells incorporate N-BPs through endocytosis.
Fluorescence-labeled ALN is taken into bone-forming cells through endocytosis. (A) Cellular uptake of AX-ALN by primary rat osteoblastic cells as observed by confocal laser scanning microscopy. (Upper panels) Cells were incubated with 10−4 M AX-ALN, 10−5 M AX-ALN, or without AX-ALN (cont) for 4 h at 37 °C. (Lower panels) Effects of endocytosis inhibitors, dansylcadaverine (DC), chlorpromazine (CP), and methyl-β-cyclodextrin (MB) on AX-ALN cellular uptake. Cells were incubated with 10−5 M AX-ALN in the absence (AX-ALN) or presence of 100 μM DC (AX-ALN+DC), 20 μM CP (AX-ALN+CP), or 1 mM MB (AX-ALN+MB) for 4 h at 37 °C. Sections were counterstained with DAPI. Scale bar, 10 μm. (B) Effect of DC on ALN-induced increase in mineralization in calvarial osteoblastic cell culture. (Upper panels) Alizarin red staining at day 21. (Lower panels) Quantification of Alizarin red-stained nodule areas (mineralized area). Each column+bar represents the mean+1 s.d. Significant difference from the control (cont): *P<0.05.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
Endocytosis inhibition blocked ALN-enhanced osteoblastic differentiation in vitro
Since ALN uptake was mediated by endocytosis, one can assume that inhibition of endocytosis of ALN may inhibit ALN action on osteoblastic cells. We treated primary osteoblastic cells with ALN in the presence or absence of endocytosis inhibitor, DC. Mineralized area demonstrated a concentration-dependent increase at 21 days after treatment with ALN (Fig. 6B). The ALN-induced increase in mineralized area was cancelled by co-incubation with 100 μM DC. The increases in osteocalcin gene expression and osteocalcin-positive cells were also blocked by DC (Supplementary Figure 7, see section on supplementary data at the end of this article). Thus, endocytosis inhibition blocked the ALN-stimulated osteoblast differentiation in vitro. Twenty micromoles GO, which restores geranylgeranylation (Dunford et al. 2006), also suppressed the increases in osteocalcin expression and osteocalcin-positive cells by ALN (Supplementary Figure 7).
Endocytosis inhibition blocked ALN-induced bone formation in vivo
To examine whether endocytic inhibition affects the ALN-induced bone formation in vivo, we added DC to the ALN solution, immersed extracted teeth in the solution, and then replanted them. More bone tissue was observed in ALN-treated tissue than in PBS-treated tissue on day 7 (Fig. 7A and B; P<0.01). The addition of DC (1 mM) to the ALN solution significantly reduced the increase in the bone tissue induced by ALN pretreatment (P<0.05). The addition of DC also reduced the ALN-induced increase in ALP-positive cell ratios (Fig. 7C and D; P<0.01) and the ALN-induced decrease of attached TRAP-positive cells (Fig. 8A and B; P<0.05). Thus, these results suggest that endocytosis inhibition cancelled the effects of ALN on bone-resorbing cells, bone-forming cells, and net bone volume in the tooth replantation model.
Effect of an endocytosis inhibitor DC on the ALN-induced bone formation in vivo. Replanted teeth pretreated with PBS, ALN (1 mM), ALN+DC (1 mM), or DC (1 mM) were dissected on day 7 after tooth replantation. (A) Hematoxylin and eosin staining. m, mesial root; d, distal root. Scale bar, 0.2 mm. (B) Bone volume (BV)/tissue volume (TV) between the mesial and distal roots of replanted teeth was determined. (C) ALP staining. Pictures were taken from the bone marrow region between the two roots of the replanted teeth. Arrowheads indicate ALP-positive cells on bone surfaces. b, bone. Scale bar, 20 μm. (D) ALP-positive cell surface/bone surface (%). Significant differences from the PBS group: **P<0.01 and *P<0.05. Significant differences from the ALN group: ##P<0.01 and #P<0.05.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
Effect of an endocytosis inhibitor DC on TRAP-positive cells in ALN-treated bone. Replanted teeth pretreated with PBS, ALN (1 mM) ALN+DC (1 mM), or DC (mM) were dissected on day 7 after tooth replantation. (A) TRAP staining. Pictures were taken from bone marrows between the two roots of the replanted teeth. Arrowheads indicate multinuclear TRAP-positive cells attached to bone surfaces. b, bone. Scale bar, 20 μm. (B) Numbers of multinuclear TRAP-positive attached cells between the two roots per bone surface (BS (/mm)). Significant differences from the PBS group: *P<0.05. Significant differences from the ALN group: ##P<0.01.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
DC and GO prevented inhibition of Rap1A prenylation by ALN in vitro
It has been proposed that N-BPs enhance osteogenic differentiation through inhibition of protein prenylation (Chaplet et al. 2004, Duque et al. 2011) or through activating ERK and JNK (Fu et al. 2008). To examine whether enodocytic incorporation of ALN is involved in inhibition of small GTPase prenylation, we performed western blot analysis for cell lysates of ROS 17/2.8 cells after treatment with ALN in the presence or absence of DC or GO for 24 h. We detected the unprenylated form of Rap1A markedly at 10−4 M ALN, but to a lesser extent at 10−6 and 10−5 M (Fig. 9A). Co-treatment with 100 μM DC or 20 μM GO prevented the accumulation of unprenylated Rap1A by ALN, suggesting that endocytic incorporation of ALN links to the inhibition of small GTPase prenylation in vitro by ALN.
(A) Endocytosis inhibitor DC prevents the inhibition of Rap1A prenylation by ALN. ROS 17/2.8 cells were treated with or without ALN at the indicated concentrations in the presence or absence of DC (100 μM) or geranylgeraniol (GO, 20 μM) for 24 h. Immunoblot analyses were performed for unprenylated Rap1A and Rap1. (B) DC does not affect ALN-induced phosphorylation of ERK. ROS 17/2.8 cells were treated with ALN (10−6 or 10−5 M) for 3 min (3 m) or 10 min (10 m) in the presence or absence of DC (100 μM) or with DC (100 μM) only for 10 min. Cells were also treated with or without bFGF (10 ng/ml) for 15 min as positive control or negative control (Ctl). Immunoblot analyses were performed for phosphorylated ERK and total ERK.
Citation: Journal of Endocrinology 219, 2; 10.1530/JOE-13-0040
We further tested whether endocytic incorporation of ALN is involved in ERK activation. ALN concentrations of 10−6 or 10−5 M induced a rapid and transient phosphorylation of ERK1/2 in a dose-dependent manner (Fig. 9B). However, 100 μM DC did not prevent the ALN-induced phosphorylation of ERKs, suggesting that endocytic incorporation of ALN does not link to the phosphorylation of ERKs.
Discussion
This study indicates that locally applied ALN promotes bone formation by stimulating proliferation and differentiation of bone-forming cells as well as inhibiting osteoclast function. Tracking of F-ALN demonstrated that ALN was taken into cells at bone surfaces of bone marrows in the replanted teeth and into osteoblastic cells in vitro. We further demonstrated that local ALN treatment enhanced proliferation and differentiation of bone-forming cells adjacent to the bone surfaces in our in vivo model.
Several reports have shown that N-BPs can directly affect osteoblast proliferation and differentiation. Treatment with ALN and zoledronate upregulated osteogenic gene expression in Saos2 osteosarcoma cells (Chaplet et al. 2004), human bone-derived cells (Pan et al. 2004), and rodent bone marrow stromal cells (Fu et al. 2008). ALP activity and osteocalcin production were enhanced by zoledronate in human osteoblasts from bone biopsies of healthy subjects (Ebert et al. 2009, Corrado et al. 2010). Mineralization was increased by zoledronate in human bone or bone marrow-derived cells (Pan et al. 2004, Ebert et al. 2009) and ALN in human mesenchymal stem cells (Duque & Rivas 2007). Here, we found that 3-day treatment of rat calvarial osteoblastic cells with ALN (10−6 or 10−5 M) at an early differentiation stage induced upregulation of osteocalcin expression and mineralization at a later differentiation stage. By contrast, treatment with a higher ALN concentration, 10−4 M, caused deleterious effects with decreased cell viability and the inhibition of cell differentiation, which are consistent with results from previous studies (Idris et al. 2008, Orriss et al. 2009). Concentrations of ALN released from the ALN-coated implants were estimated to be lower than 10−5 M adjacent to the implant surface in vitro (Tanzer et al. 2005, Gao et al. 2009). Similar concentrations (10−6 M) could be achieved in the circulation after a short-term intravenous infusion of zoledronate (Ebert et al. 2009). Once-yearly treatment with zoledronate for three years leads to increased trabecular bone volume and MAR in women with postmenopausal osteoporosis (Recker et al. 2008). Therefore, short-term i.v. infusion as well as short-term local application of N-BP may provide favorable concentrations and promote the differentiation and proliferation of bone-forming cells.
In this study, proliferation and ALP activity of calvarial osteoblasts did not increase after pulse treatment with 10−6 and 10−5 M ALN in vitro, whereas BrdU uptake and ALP activity were increased in cells adjacent to bone surfaces in vivo. Previous studies reported that in vitro continuous treatment of bone marrow cells with 10−8–10−5 M ALN increased ALP activity (Fu et al. 2008) and that treatment with 10−13–10−8 M ALN increased cell proliferation (Giuliani et al. 1998). It has also been reported that bone marrow stromal cells from human mandibles are more susceptible to pamidronate than those from iliac crest based on decreased cell survival and lower ALP activity (Stefanik et al. 2008). It is possible that the effects of ALN on ALP activity and cell proliferation in osteoblastic cells may differ depending on the cell stage of bone-forming cells, origins of osteoblastic cells, concentrations of BPs, and duration of treatment time.
Here we found that mononuclear cells including bone marrow stromal cells and/or bone-forming cells took up ALN in vivo, and that primary osteoblastic cells incorporated ALN in vitro, whose incorporation was inhibited by the endocytosis inhibitor DC. In addition, DC prevented the ALN-induced increase of osteocalcin expression in vitro and the ALN-induced increases of bone mass and ALP-positive cells in vivo by blocking the endocytic incorporation of ALN. There are two possibilities regarding the inhibition of ALN uptake in vivo by DC. One possibility is that DC inhibited the cellular uptake of ALN at an early stage after replantation based on our observation that brief exposure to DC inhibited the uptake of F-ALN by osteoblasts in vitro (Fig. 6). Another possibility is that DC inhibited the cellular uptake of ALN following desorption of the ALN from the mineralized surfaces over the whole 7 days since osteoblastic cells incorporated N-BP released from dentin slices (Coxon et al. 2008). Further investigation would be needed to elucidate the mechanisms of inhibition of endocytosis in vivo by DC. Taken together, our findings suggest that endocytic uptake of N-BPs is indispensable for N-BP promotion of bone formation.
We used several inhibitors that interfere selectively with either clathrin-dependent or caveolin-mediated endocytosis (Haigler et al. 1980, Chen et al. 2009, Kelley et al. 2009) to determine the relative importance of these mechanisms for the internalization of N-BPs (Fig. 6A). DC arrests the endocytosis process at the clathrin-coated pit stage (Chen et al. 2009). Another inhibitor, CP induces a loss of clathrin-coated pits from the cell surface (Ivanov 2008), while MB inhibits a caveolae-like endocytosis (Ivanov 2008). Since DC and CP, but not MB, suppressed ALN incorporation in this study, we suggest that osteoblastic cells may incorporate N-BPs through clathrin-mediated endocytic pathways. In a previous study on endocytosis of fluorescently labeled N-BPs by macrophages and osteoclasts (Thompson et al. 2006), the authors observed that intracellular uptake of the labeled N-BPs was inhibited by DC and colocalized with dextran but not with markers of adsorptive (wheat germ agglutinin) or receptor-mediated (transferrin) endocytosis. The role of intracellular uptake pathways in osteoblastic cells in this study seems to be similar to those in the macrophages and osteoclasts.
Regarding the mechanisms of BP effects on osteoblastic function, several reports suggest the involvement of inhibition of small GTPase prenylation. Pitavastatin and zoledronate enhance expression of bone-related genes by inhibition of Rho GTPase in human osteoblastic cells and osteosarcoma Saos2 cells (Ohnaka et al. 2001, Chaplet et al. 2004). Geranylgeranyl-pyrophosphate synthase is downregulated during osteoblastic differentiation in MC3T3-EI (Yoshida et al. 2006). Recently, it has been reported that treatment with 10−8 M ALN or 5 μM GGTI-298, geranylgeranyltransferase inhibitor, increases osteocalcin expression, mineralization, and unprenylated Rap1 in human mesenchymal stem cells (Duque et al. 2011). In this study, addition of GO prevented the ALN-induced upregulation of osteocalcin in calvarial osteoblastic cells. We further detected the unprenylated form of Rap1A following treatment of ROS 17/2.8 cells with ALN, which was reduced by endocytosis inhibitor DC or GO. The present findings suggest that N-BP stimulates osteoblast differentiation through endocytic incorporation of N-BP, which subsequently inhibits small GTPase prenylation.
Some studies have proposed an extracellular mechanism of BP action and an involvement of intracellular signaling in N-BP induced osteoblastic differentiation (Mathov et al. 2001, Fu et al. 2008, Bellido & Plotkin 2011). Prevention of osteoblast and osteocyte apoptosis by BPs (10−9–10−6 M) is mediated by connexin 43 hemichannel opening and activation of Src and ERKs (Mathov et al. 2001, Bellido & Plotkin 2011). The ALN-induced upregulation of osteogenic markers in bone marrow stromal cells is possibly due to the activation of ERK and JNK (Fu et al. 2008). Here we detected an increase in ALN-induced phosphorylation of ERKs, which was not blocked by the addition of endocytosis inhibitor DC. Thus, the ALN-induced phosphorylation of ERKs may be mediated mainly through an extracellular mechanism, but not through direct incorporation of ALN. Therefore, we suggest that bone formation by direct incorporation of ALN may be mediated through inhibition of the mevalonate pathway rather than activation of the ERK pathway. Further investigation is needed to explore the molecular targets and downstream pathways for the anabolic effects of N-BPs.
N-BPs have been used to treat systemic bone metabolic disorders. This and earlier (Wilkinson & Little 2011) studies further add a possibility that local application of N-BPs may be useful for local bone augmentation. It has been reported that locally administered ALN increased bone mineral density in a rabbit model (Omi et al. 2007). Surface coatings of zoledronate and pamidronate have also been reported to cause bone increase around orthopedic implants in animal models (Tanzer et al. 2005, Wermelin et al. 2008, Gao et al. 2009). Local delivery of N-BPs is a reasonable approach because it reduces the amount of drug used and preferentially targets the site of interest, thereby avoiding systemic exposure and adverse side effects (Bobyn et al. 2009). A recent clinical trial of dental implants coated with N-BP has suggested that the use of local N-BP release might be a promising principle (Abtahi et al. 2012). Our results would further provide mechanistic bases for local effects by N-BPs.
Supplementary data
This is linked to the online version of the paper at http://dx.doi.org/10.1530/JOE-13-0040.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by grants from Japanese MEXT.HAITEKU (2005–2009, H050151) and from the Ministry of Education, Science and Culture of Japan (21659425 and 19390475).
References
Abtahi J, Tengvall P & Aspenberg P 2012 A bisphosphonate-coating improves the fixation of metal implants in human bone. A randomized trial of dental implants. Bone 50 1148–1151. (doi:10.1016/j.bone.2012.02.001)
Azuma Y, Sato H, Oue Y, Okabe K, Ohta T, Tsuchimoto M & Kiyoki M 1995 Alendronate distributed on bone surfaces inhibits osteoclastic bone resorption in vitro and in experimental hypercalcemia models. Bone 16 235–245. (doi:10.1016/8756-3282(94)00035-X)
Bellido T & Plotkin LI 2011 Novel actions of bisphosphonates in bone: preservation of osteoblast and osteocyte viability. Bone 49 50–55. (doi:10.1016/j.bone.2010.08.008)
Bobyn JD, McKenzie K, Karabasz D, Krygier JJ & Tanzer M 2009 Locally delivered bisphosphonate for enhancement of bone formation and implant fixation. Journal of Bone and Joint Surgery 91 23–31. (doi:10.2106/JBJS.I.00518)
Chaplet M, Detry C, Deroanine C, Fisher LW & Castronovo V 2004 Zolendronic acid up-regulates bone sialoprotein expression in osteoblastic cells through Rho GTPase inhibition. Biochemical Journal 384 591–598. (doi:10.1042/BJ20040380)
Chen CL, Hou WH, Liu IH, Hsiao G, Huang SS & Huang JS 2009 Inhibitors of clathrin-dependent endocytosis enhance TGFβ signaling and responses. Journal of Cell Science 122 1863–1871. (doi:10.1242/jcs.038729)
Corrado A, Neve A, Maruotti N, Gaudio A, Marucci A & Cantatore FP 2010 Dose-dependent metabolic effect of zoledronate on primary human osteoblastic cell cultures. Clinical and Experimental Rheumatology 28 873–879.
Coxon FP, Thompson K, Roelofs AJ, Ebetino FH & Rogers MJ 2008 Visualizing mineral binding and uptake of bisphosphonate by osteoclasts and non-resorbing cells. Bone 42 848–860. (doi:10.1016/j.bone.2007.12.225)
Dunford JE, Rogers MJ, Ebetino FH, Phipps RJ & Coxon FP 2006 Inhibition of protein prenylation by bisphosphonates causes sustained activation of Rac, Cdc42, and Rho GTPases. Journal of Bone and Mineral Research 21 684–694. (doi:10.1359/jbmr.060118)
Duque G & Rivas D 2007 Alendronate has an anabolic effect on bone through the differentiation of mesenchymal stem cells. Journal of Bone and Mineral Research 22 1603–1611. (doi:10.1359/jbmr.070701)
Duque G, Vidal C & Rivas D 2011 Protein isoprenylation regulates osteogenic differentiation of mesenchymal stem cells: effect of alendronate, and farnesyl and geranylgeranyl transferase inhibitors. British Journal of Pharmacology 162 1109–1118. (doi:10.1111/j.1476-5381.2010.01111.x)
Ebert R, Zeck S, Krug R, Meissner-Weigl J, Schneider D, Seefried L, Eulert J & Jakob F 2009 Pulse treatment with zoledronic acid causes sustained commitment of bone marrow derived mesenchymal stem cells for osteogenic differentiation. Bone 44 858–864. (doi:10.1016/j.bone.2009.01.009)
Fu L, Tang T, Miao Y, Zhang S, Qu Z & Dai K 2008 Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation. Bone 43 40–47. (doi:10.1016/j.bone.2008.03.008)
Gao Y, Luo E, Hu J, Xue J, Zhu S & Li J 2009 Effect of combined local treatment with zoledronic acid and basic fibroblast growth factor on implant fixation in ovariectomized rats. Bone 44 225–232. (doi:10.1016/j.bone.2008.10.054)
Giuliani N, Pedrazzoni M, Negri G, Passeri G, Impicciatore M & Girasole G 1998 Bisphosphonates stimulate formation of osteoblasts precursors and mineralized nodules in murine and human bone marrow cultures in vitro and promote early osteoblastogenesis in young and aged mice in vivo. Bone 22 455–461. (doi:10.1016/S8756-3282(98)00033-7)
Haigler HT, Maxfield FR, Willingham MC & Pastan I 1980 Dansylcadaverine inhibits internalization of 125I-epidermal growth factor in BALB 3T3 cells. Journal of Biological Chemistry 255 1239–1241.
Ideno H, Takanabe R, Shimada A, Imaizumi K, Araki R, Abe M & Nifuji A 2009 Protein related to DAN and cerberus (PRDC) inhibits osteoblastic differentiation and its suppression promotes osteogenesis in vitro. Experimental Cell Research 315 474–484. (doi:10.1016/j.yexcr.2008.11.019)
Idris AI, Rojas J, Greig IR, Van't Hof RJ & Ralston SH 2008 Aminobisphosphonates cause osteoblast apoptosis and inhibit bone nodule formation in vitro. Calcified Tissue International 82 191–201. (doi:10.1007/s00223-008-9104-y)
Ivanov AI 2008 Pharmacological inhibition of endocytic pathways: is it specific enough to be useful? In Exocytosis and Endocytosis, pp 15–33. Ed. Ivanov AI. Totowa, NJ: Human Press.
Kelley R, Ren R, Pi X, Wu Y, Moreno I, Willis M, Moser M, Ross M, Podkowa M & Attisano L et al. 2009 A concentration-dependent endocytic trap and sink mechanism converts Bmper from an activator to an inhibitor of Bmp signaling. Journal of Cell Biology 184 597–609. (doi:10.1083/jcb.200808064)
Komatsu K, Shimada A, Shibata T, Shimoda S, Oida S, Kawasaki K & Nifuji A 2008 Long-term effects of local pretreatment with alendronate on healing of replanted rat teeth. Journal of Periodontal Research 43 194–200. (doi:10.1111/j.1600-0765.2007.01012.x)
Luckman SP, Hughes DE, Coxon FP, Graham R, Russell G & Rogers MJ 1998 Nitrogen-containing bisphosphonates inhibit the mevalonate pathway and prevent post-translational prenylation of GTP-binding proteins, including Ras. Journal of Bone and Mineral Research 13 581–589. (doi:10.1359/jbmr.1998.13.4.581)
Masaike Y, Takagi T, Hirota M, Yamada J, Ishihara S, Yung TM, Inoue T, Sawa C, Sagara H & Sakamoto S et al. 2010 Identification of dynamin-2-mediated endocytosis as a new target of osteoporosis drugs, bisphosphonates. Molecular Pharmacology 77 262–269. (doi:10.1124/mol.109.059006)
Masarachia P, Weinreb M, Balena R & Rodan GA 1996 Comparison of the distribution of 3H-alendronate and 3H-etidronate in rat and mouse bones. Bone 19 281–290. (doi:10.1016/8756-3282(96)00182-2)
Mathov I, Plotkin LI, Sgarlata CL, Leoni J & Bellido T 2001 Extracellular signal-regulated kinases and calcium channels are involved in the proliferative effect of bisphosphonates on osteoblastic cells in vitro. Journal of Bone and Mineral Research 16 2050–2056. (doi:10.1359/jbmr.2001.16.11.2050)
Ohnaka K, Shimoda S, Nawata H, Shimokawa H, Kaibuchi K, Iwamoto Y & Takayanagi R 2001 Pitavastatin enhanced BMP-2 and osteocalcin expression by inhibition of Rho-associated kinase in human osteoblasts. Biochemical and Biophysical Research Communications 287 337–342. (doi:10.1006/bbrc.2001.5597)
Omi H, Kusumi T, Kijima H & Toh S 2007 Locally administered low-dose alendronate increases bone mineral density during distraction osteogenesis in a rabbit model. Journal of Bone and Joint Surgery 89 984–988. (doi:10.1302/0301-620X.89B7.18980)
Orriss IR, Key ML, Colston KW & Arnett TR 2009 Inhibition of osteoblast function in vitro by aminobisphosphonates. Journal of Cellular Biochemistry 106 109–118. (doi:10.1002/jcb.21983)
Pan B, To LB, Farrugia AN, Findlay DM, Green J, Gronthos S, Evdokiou A, Lynch K, Atkins GJ & Zannettino ACW 2004 The nitrogen-containing bisphosphonate, zoledronic acid, increases mineralisation of human bone-derived cells in vitro. Bone 34 112–123. (doi:10.1016/j.bone.2003.08.013)
Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM & Recker RR 1987 Bone histomorphometry: standardization of nomenclature, symbols, and units. Journal of Bone and Mineral Research 2 595–610. (doi:10.1002/jbmr.5650020617)
Recker R, Delmas PD, Halse J, Reid IR, Boonen S, García-Hernandez PA, Supronik J, Lewiecki EM, Ochoa L & Miller P et al. 2008 Effects of intravenous zoledronic acid once yearly on bone remodeling and bone structure. Journal of Bone and Mineral Research 23 6–16. (doi:10.1359/jbmr.070906)
Reinholtz GG, Getz B, Pederson L, Sanders ES, Subramaniam M, Ingle JN & Spelsberg TN 2000 Bisphosphonates directly regulate cell proliferation, differentiation, and gene expression in human osteoblasts. Cancer Research 60 6001–6007.
Reszka AA, Halasy-Nagy J & Rodan GA 2001 Nitrogen-bisphosphonates block retinoblastoma phosphorylation and cell growth by inhibiting the cholesterol biosynthetic pathway in a keratinocyte model for esophageal irritation. Molecular Pharmacology 59 193–202. (doi:10.1124/mol.59.2.193)
Roelofs AJ, Coxon FP, Ebetino FH, Lundy MW, Henneman ZJ, Nancollas GH, Sun S, Blazewska KM, Bala JL & Kashemirov BA et al. 2010 Fluorescent risedronate analogues reveal bisphosphonate uptake by bone marrow monocytes and localization around osteocytes in vivo. Journal of Bone and Mineral Research 25 606–616. (doi:10.1359/jbmr.091009)
Rogers MJ, Crockett JC, Coxon FP & Monkkonen J 2011 Biochemical and molecular mechanisms of action of bisphosphonates. Bone 49 34–41. (doi:10.1016/j.bone.2010.11.008)
Sato M, Grasser W, Endo N, Akins R, Simmons H, Thompson DD, Golub E & Rodan G 1991 Bisphosphonate action: alendronate localization in rat bone and effects on osteoclast ultrastructure. Journal of Clinical Investigation 88 2095–2105. (doi:10.1172/JCI115539)
Schenk RK, Olah AJ & Herrmann W 1984 Preparation of calcified tissues for light microscopy. In Methods of Calcified Tissue Preparation, pp 1–56. Ed. Dickson GR. Amsterdam: Elsevier.
Shibata T, Komatsu K, Shimada A, Shimoda S, Oida S, Kawasaki K & Chiba M 2004 Effects of alendronate on restoration of biomechanical properties of periodontium in replanted rat molars. Journal of Periodontal Research 39 405–414. (doi:10.1111/j.1600-0765.2004.00755.x)
Stefanik D, Sarin J, Lam T, Levin L, Leboy PS & Akintoye SO 2008 Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Diseases 14 465–471. (doi:10.1111/j.1601-0825.2007.01402.x)
Tanzer M, Karabasz D, Krygier JJ, Cohen R & Bobyn JD 2005 Bone augmentation around and within porous implants by local bisphosphonates elution. Clinical Orthopaedics and Related Research 441 30–39. (doi:10.1097/01.blo.0000194728.62996.2d)
Thompson K, Rogers MJ, Coxon FP & Crockett JC 2006 Cytosolic entry of bisphosphonate drugs requires acidification of vesicles after fluid-phase endocytosis. Molecular Pharmacology 69 1624–1632. (doi:10.1124/mol.105.020776)
Wada Y, Kataoka H, Yokose S, Ishizuya T, Miyazono K, Gao Y-H, Shibasaki Y & Yamaguchi A 1998 Changes in osteoblasts phenotype during differentiation of enzymatically isolated rat calvarial cells. Bone 22 479–485. (doi:10.1016/S8756-3282(98)00039-8)
Wermelin K, Suska F, Tengvall P, Thomsen P & Aspenberg P 2008 Stainless steel screws coated with bisphosphonates gave stronger fixation and more surrounding bone. Histomorphometry in rats. Bone 42 365–371. (doi:10.1016/j.bone.2007.10.013)
Wilkinson JM & Little DG 2011 Bisphosphonates in orthopedic applications. Bone 49 95–102. (doi:10.1016/j.bone.2011.01.009)
Yoshida T, Asanuma M, Grossman L, Fuse M, Shibata T, Yonekawa T, Tanaka T, Ueno K, Yasuda T & Saito Y et al. 2006 Geranylgeranyl-pyrophosphate (GGPP) synthase is down-regulated during differentiation of osteoblastic cell line MC3T3-E1. FEBS Letters 580 5203–5207. (doi:10.1016/j.febslet.2006.08.060)
Zaheer A, Lenkinski RE, Mahmood A, Jones AG, Cantley LC & Frangioni JV 2001 In vivo near-infrared fluorescence imaging of osteoblastic activity. Nature Biotechnology 19 1148–1154. (doi:10.1038/nbt1201-1148)
