Estradiol stimulates mitochondrial biogenesis and adiponectin expression in skeletal muscle

in Journal of Endocrinology
Authors:
Gabriela Capllonch-Amer Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain

Search for other papers by Gabriela Capllonch-Amer in
Current site
Google Scholar
PubMed
Close
,
Miquel Sbert-Roig Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain

Search for other papers by Miquel Sbert-Roig in
Current site
Google Scholar
PubMed
Close
,
Bel M Galmés-Pascual Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain

Search for other papers by Bel M Galmés-Pascual in
Current site
Google Scholar
PubMed
Close
,
Ana M Proenza Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain
Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain

Search for other papers by Ana M Proenza in
Current site
Google Scholar
PubMed
Close
,
Isabel Lladó Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain
Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain

Search for other papers by Isabel Lladó in
Current site
Google Scholar
PubMed
Close
,
Magdalena Gianotti Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain
Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain

Search for other papers by Magdalena Gianotti in
Current site
Google Scholar
PubMed
Close
, and
Francisco J García-Palmer Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain
Grup Metabolisme Energètic i Nutrició, Centro de Investigación Biomédica en Red Fisiopatología de la Obesidad y la Nutrición (CIBERobn, Departament de Biologia Fonamental i Ciències de la Salut, Institut Universitari d'Investigació en Ciències de la Salut (IUNICS), Universitat de les Illes Balears, Ctra. Valldemossa, km 7,5. E-07122 Palma de Mallorca, Illes Balears, Spain

Search for other papers by Francisco J García-Palmer in
Current site
Google Scholar
PubMed
Close

Correspondence should be addressed to M Gianotti; Email: magdalena.gianotti@uib.es
Free access

Sign up for journal news

Sexual dimorphism has been found in mitochondrial features of skeletal muscle, with female rats showing greater mitochondrial mass and function compared with males. Adiponectin is an insulin-sensitizing adipokine whose expression has been related to mitochondrial function and that is also expressed in skeletal muscle, where it exerts local metabolic effects. The aim of this research was to elucidate the role of sex hormones in modulation of mitochondrial function, as well as its relationship with adiponectin production in rat skeletal muscle. An in vivo study with ovariectomized Wistar rats receiving or not receiving 17β-estradiol (E2) (10 μg/kg per 48 h for 4 weeks) was carried out, in parallel with an assay of cultured myotubes (L6E9) treated with E2 (10 nM), progesterone (Pg; 1 μM), or testosterone (1 μM). E2 upregulated the markers of mitochondrial biogenesis and dynamics, and also of mitochondrial function in skeletal muscle and L6E9. Although in vivo E2 supplementation only partially restored the decreased adiponectin expression levels induced by ovariectomy, these were enhanced by E2 and Pg treatment in cultured myotubes, whereas testosterone showed no effects. Adiponectin receptor 1 expression was increased by E2 treatment, both in vivo and in vitro, but testosterone decreased it. In conclusion, our results are in agreement with the sexual dimorphism previously reported in skeletal muscle mitochondrial function and indicate E2 to be its main effector, as it enhances mitochondrial function and diminishes oxidative stress. Moreover, our data support the idea of the existence of a link between mitochondrial function and adiponectin expression in skeletal muscle, which could be modulated by sex hormones.

Abstract

Sexual dimorphism has been found in mitochondrial features of skeletal muscle, with female rats showing greater mitochondrial mass and function compared with males. Adiponectin is an insulin-sensitizing adipokine whose expression has been related to mitochondrial function and that is also expressed in skeletal muscle, where it exerts local metabolic effects. The aim of this research was to elucidate the role of sex hormones in modulation of mitochondrial function, as well as its relationship with adiponectin production in rat skeletal muscle. An in vivo study with ovariectomized Wistar rats receiving or not receiving 17β-estradiol (E2) (10 μg/kg per 48 h for 4 weeks) was carried out, in parallel with an assay of cultured myotubes (L6E9) treated with E2 (10 nM), progesterone (Pg; 1 μM), or testosterone (1 μM). E2 upregulated the markers of mitochondrial biogenesis and dynamics, and also of mitochondrial function in skeletal muscle and L6E9. Although in vivo E2 supplementation only partially restored the decreased adiponectin expression levels induced by ovariectomy, these were enhanced by E2 and Pg treatment in cultured myotubes, whereas testosterone showed no effects. Adiponectin receptor 1 expression was increased by E2 treatment, both in vivo and in vitro, but testosterone decreased it. In conclusion, our results are in agreement with the sexual dimorphism previously reported in skeletal muscle mitochondrial function and indicate E2 to be its main effector, as it enhances mitochondrial function and diminishes oxidative stress. Moreover, our data support the idea of the existence of a link between mitochondrial function and adiponectin expression in skeletal muscle, which could be modulated by sex hormones.

Introduction

Sexual dimorphism in mitochondrial functionality has been described in many rat tissues such as liver, adipose tissue, brain, and skeletal muscle (Colom et al. 2007a,b, Valle et al. 2007a,b, Gómez-Pérez et al. 2008, 2012, Guevara et al. 2009, Nadal-Casellas et al. 2011a, 2012, Amengual-Cladera et al. 2012b). In all these tissues, female rats present higher oxidative capacity than males, which is associated with greater mitochondrial biogenesis and with morphological differences consisting of larger mitochondria with greater cristae size and density. Oxidative stress status associated with physiopathological situations such as caloric restriction, high-fat-diet feeding, or aging, also shows sexual dimorphism, as female rats show lower oxidative damage than males, a fact that has been related to their higher antioxidant defences (Colom et al. 2007b, Valle et al. 2007b, Gómez-Pérez et al. 2008, Viña et al. 2011, Amengual-Cladera et al. 2012b). In this sexual dimorphism, 17β-estradiol (E2) would be a key factor, as it plays a relevant role in mitochondrial modulation in tissues such as adipose tissue, liver, and brain (Mattson et al. 1997, Chen et al. 1999, Rodríguez-Cuenca et al. 2007, Moreira et al. 2011, Nadal-Casellas et al. 2011b, Amengual-Cladera et al. 2012a,c). As E2 is known to activate the expression of specific proteins of the mitochondrial machinery and of genes controlling mitochondrial biogenesis and mitochondrial DNA transcription (Klinge 2008, Mattingly et al. 2008), this hormone ameliorates mitochondrial functionality, although its effects are tissue-specific (Moreira et al. 2011). The role of E2 in sexual dimorphism of skeletal muscle mitochondrial function remains to be fully elucidated.

E2 also plays a role in the regulation of body weight, and a loss of E2 is associated with the development of obesity (Chen et al. 2009), which is related to a decrease in adiponectin levels in serum. Adiponectin is an insulin-sensitizing hormone secreted mainly by white adipose tissue (WAT; Harwood 2012). Circulating levels of adiponectin show sexual dimorphism in both humans and rodents, with females presenting higher serum concentrations than males (Riestra et al. 2013). Adiponectin expression in WAT is also greater in females than in males (Amengual-Cladera et al. 2012a,b,c), a fact that in humans has been associated with sex hormone milieu (Riestra et al. 2013, Wildman et al. 2013). Proper mitochondrial function is essential for the production of adiponectin in adipocytes (Koh et al. 2007), so impaired mitochondrial function in WAT also has negative effects on the insulin response in other tissues through a decrease in the expression and secretion of adiponectin (Wang et al. 2013). Furthermore, adiponectin plays an important role in the regulation of mitochondrial content and function in other tissues such as skeletal muscle (Civitarese et al. 2006). Although it was originally proposed that adiponectin was expressed and secreted only in adipose tissue, it has been shown to be also expressed in non-adipose tissues such as liver and muscle (Ding et al. 2007, Krause et al. 2008, Uribe et al. 2008). In skeletal muscle, adiponectin can be detected within the myofibers and is involved in muscle contractile function, phenotype, and metabolism (Krause et al. 2008, Liu et al. 2009a).

As skeletal muscle from female rats exhibits greater mitochondrial mass, antioxidant protection, and oxidative–phosphorylative capacities than that from males (Colom et al. 2007a, Català-Niell et al. 2008, Gómez-Pérez et al. 2008), and E2 has been shown to play a role in mitochondrial modulation in other tissues (Mattson et al. 1997, Chen et al. 1999, Rodríguez-Cuenca et al. 2007, Moreira et al. 2011, Nadal-Casellas et al. 2011b, Amengual-Cladera et al. 2012a,c), the aim of the present study was to elucidate the role of sex hormones in these differences, as well as their relationship with adiponectin production in skeletal muscle. This was accomplished by using a model of ovariectomized (OVX) rats to test the effects of a decrease in ovarian hormone levels and of E2 replacement, combined with in vitro experiments with L6E9 myotubes, which were treated with E2, progesterone (Pg), and testosterone.

Materials and methods

Animals and treatments

Animal experiments were carried out in accordance with general guidelines approved by our institutional ethics committee and EU regulations (2010/63/UE). At 10 weeks of age, Wistar rats (Charles River Laboratories, Barcelona, Spain) were distributed into three experimental groups: control female (n=6), OVX (n=6), and OVX supplemented with E2 (OVX+E2, n=6). Ovariectomy and sham surgery were performed at 5 weeks of age at Charles River Laboratories. Animals were housed in a controlled environment (22 °C and 65±3% humidity) under a 12 h light:12 h darkness cycle with free access to water and pelleted standard diet (A04, Panlab, Barcelona, Spain). Every week, animals were weighed and food intake was measured. For the OVX+E2 group, E2 (10 μg/kg per 48 h) was dissolved in corn oil and administered via s.c. injection for the 4 weeks preceding killing, whereas the OVX group was treated only with the vehicle. At 14 weeks of age and after a period of 12 h fasting, rats were killed by cervical decapitation. Trunk blood was collected and white gastrocnemius muscle (WGM) was quickly removed, frozen in liquid N2, and stored at −80 °C until analysis was performed. The estrous cycle stage was regularly determined by measuring the vaginal wall impedance (Impeast, Cibertec, Madrid, Spain) and by microscopic evaluation of the vaginal smears. All the control animals were in diestrus phase at the time they were killed.

Serum and blood parameters

Blood was allowed to clot for 20 min and then it was centrifuged (1000 g, 20 min, 4 °C) to obtain serum, which was immediately used to assay total antioxidant capacity using the TAC Assay Kit (BioVision, Inc., San Francisco, CA, USA). The remaining serum was aliquoted and stored at −20 °C until analyzed. Nonesterified fatty acid (NEFA) levels were determined spectrophotometrically using a kit from Wako Diagnostics (Richmond, VA, USA). Enzyme immunoassay kits were used for measuring serum E2 and Pg (DRG Instruments, Marburg, Germany), adiponectin (Merck-Millipore, Billerica, MA, USA), and resistin (USCN Life Science, Houston, TX, USA). Before E2 analysis, the serum organic fraction was concentrated using a sample extraction procedure (Dighe & Sluss 2004).

WGM homogenate preparation and determinations

WGM portions were homogenized with a disperser (IKA T10 basic ULTRA-TURAX) in the solubilization buffer (250 mM sucrose, 20 mM Tris–HCl, 40 mM KCl, and 2 mM EGTA, pH 7.4). The homogenates were sonicated at 20 W, centrifuged (at 600 g, 4 °C, for 10 min), and immediately used to assess the enzymatic activities of citrate synthase (CS) (Nakano et al. 2005), glutathione peroxidase (GPx) (Smith et al. 2001), superoxide dismutase (SOD) (Quick et al. 2000), and cytochrome c oxidase (COX) (Chrzanowska-Lightowlers et al. 1993) by using spectrophotometric methods. The remaining volume was stored at −20 °C with phosphatase and protease inhibitors (1 mM sodium vanadate, 2 mM phenylmethylsulphonyl fluoride, 0.1 mg/ml aprotinin, 10 μM leupeptin) until analysis. Triglycerides were measured spectrophotometrically using a commercial kit (Spinreact, Girona, Spain), DNA measurement was carried out by a fluorimetric method based on the 3,5-diaminobenzoic acid dihydrochloride reaction (Thomas & Farquhar 1978), and total protein content was measured by Bradford's protein–dye binding assay (Bradford 1976). Protein carbonyl groups, an index of protein oxidation, were determined in the homogenates by immunoblotting using the Oxyselect Protein Carbonyl Immunoblot Kit (Cell Biolabs, San Diego, CA, USA) according to the manufacturer's protocol with minor modifications. 4-Hydroxynoneal (HNE) was used as a lipid damage marker, and was assessed by western blot (see below) using the anti-HNE antibody from Alpha Diagnostics (San Antonio, TX, USA).

Western blot analysis

Briefly, 30 μg protein from the homogenates were fractioned by using SDS–PAGE (10–12% acrylamide) and electrotransferred onto a nitrocellulose membrane. The membranes were blocked with blocking solution (5% nonfat powdered milk in PBS, pH 7.5, containing 0.1% Tween 20) and were incubated with the corresponding primary antibody. The antibodies for mitofusin 1 (MFN1, 86 kDa), mitofusin 2 (MFN2, 80 and 86 kDa), optic atrophy protein 1 (OPA1, 120 kDa), dynamin-related protein 1 (DRP1, 80 kDa), uncoupling protein 3 (UCP3, 34 kDa), and α tubulin (55 kDa) were from Santa Cruz; COX subunit 4 (COX4, 16 kDa) was from MitoSciences (Eugene, OR, USA); and adiponectin receptor 1 (AdipoR1, 49 kDa) from Alpha Diagnostics. Development of the immunoblots was carried out using an enhanced chemiluminescence kit (Immun-star Western Chemilumenescence kit, Bio-Rad). Immunoblot bands were visualized using the ChemiDoc XRS system (Bio-Rad) and analyzed using the image analysis program, Quantity One (Bio-Rad). Precision Plus Protein (TM) Dual Color Standard (Bio-Rad) was used as a molecular weight marker. The band density of each protein was quantified in relation to the loading control (actin) from its own gel. Representative immunoblots are shown in Fig. 1.

Figure 1
Figure 1

Representative immunoblots from white gastrocnemius muscle. C, control; OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; COX4, cytochrome c oxidase subunit 4; UCP3, uncoupling protein 3; MFN1, mitofusin 1; MFN2, mitofusin 2; OPA1, optic atrophy protein 1; DRP1, dynamin-related protein 1; AdipoR1, adiponectin receptor 1. When immunoblot bands or marker are grouped from different parts of the same gel, this is indicated by lines in the figure. Each protein was quantified in relation to the loading control from its gel, but only one representative immunoblot for actin is shown in this figure.

Citation: Journal of Endocrinology 221, 3; 10.1530/JOE-14-0008

Detection of H2O2 production in permeabilized myofibers

Myofibers were obtained from WGM and permeabilized following a protocol published previously (Burelle & Hochachka 2002). The rate of H2O2 production was determined by measuring the oxidation of the fluorogenic indicator, Amplex Red (Molecular Probes, Paisley, UK), in the presence of HRP. WGM myofibers (4–5 mg) were placed in buffer Z (110 mM K-methanesulfonate, 35 mM KCl, 1 mM EGTA, 3 mM MgCl2, 10 mM K2HPO4, pH 7.1) supplemented with 5 mg/ml fatty-acid-free BSA. Amplex Red reagent (10 mM) and HRP (10 U/ml) were added and then incubated at 37 °C for 5 min. H2O2 production was initiated by the addition of substrates (glutamate/malate, 5 mM/2.5 mM) and fluorescence was recorded in a microplate reader (FLx800; Bio-Tek Instruments, Winooski, VT, USA) with 530 nm excitation and 590 nm emission wavelengths. Rates were determined by converting fluorescence readings, using standard curves generated over a range of H2O2 concentrations. Myofibers were recovered and placed into 500 μl solubilization buffer for determination of CS activity. H2O2 production was expressed per unit of CS activity in relation to mitochondrial mass.

Measurement of O2 consumption in permeabilized myofibers

Mitochondrial O2 consumption in WGM permeabilized myofibers was measured polarographically. Myofibers (10 mg) were incubated in a water thermostatically regulated chamber with a computer-controlled Clark-type O2 electrode (Oxygraph; Hansatech, Norfolk, UK) in 500 μl of buffer B (2.77 mM CaK2EGTA, 7.23 mM K2EGTA, 1.38 mM MgCl2, 3 mM K2HPO4, 0.50 mM dithiothreitol, 20 mM imidazole, 100 mM K-methanesulfonate, 20 mM taurine, pH 7.3) supplemented with fatty-acid-free BSA (2 mg/ml). Glutamate and malate (5 and 2.5 mM respectively) were added in the absence of ADP and the decrease of O2 concentration in the chamber was recorded. O2 consumption was expressed per unit of CS activity in relation to mitochondrial mass.

Analysis of gene expression in WGM

RT-PCR was used to determine the gene expression of adiponectin, AdipoR1, adaptor protein containing PH domain, PTB domain, and leucine zipper motif 1 (Appl1), carnitin-palmitoyl transferase 1m (Cpt1m (Cpt1b)), nuclear respiratory factor 1 (Nrf1), peroxisome proliferator-activated receptor coactivator 1α (Pgc1a (Ppargc1a)), sirtuins 1 and 3 (Sirt1 and Sirt3), mitochondrial transcription factor A (Tfam). 18S (Rn18s) was used as a housekeeping gene for WGM and actin for L6E9 myotubes. Total RNA was obtained from 0.1 g WGM using TriPure Isolation Reagent (Roche Diagnostics) following the manufacturer's instructions, and quantified using the Take3 Microplate in a PowerwaveXS spectrophotometer (BioTek, Winooski, VT, USA). A 1 μg sample of total RNA was reverse transcribed to cDNA using 25 U MuLV reverse transcriptase in 5 μl retrotranscription mixture (10 mM Tris–HCl pH 9.0, 50 mM KCl, 0.1% Triton X-100, 2.5 mM MgCl2, 2.5 μM random hexamers, 10 U RNase inhibitor, and 500 μM of each dNTP) for 60 min at 42 °C in a Gene Amp 9700 thermal cycler (Applied Biosystems). cDNA solutions were diluted 1/10, and aliquots were frozen (−20 °C) until analyzed. Real-time PCR was carried out using SYBR Green technology in a LightCycler rapid thermal cycler (Roche Diagnostics). The amplification program consisted of a preincubation step for denaturation of template cDNA (95 °C, 10 min) followed by 45 cycles consisting of a denaturation, an annealing, and an extension step under the conditions given in Table 1. After each cycle, fluorescence was measured at 72 °C. Product specificity was confirmed in the initial experiments by agarose gel electrophoresis and then routinely by melting curve analysis.

Table 1

Oligonucleotide primer sequences and conditions used in real-time PCR amplification in white gastrocnemius muscle and in L6E9 myotubes. The amplification program consisted of a preincubation step for denaturation of the template cDNA (2 min, 94 °C), followed by 40 cycles consisting of a denaturation step (95 °C, 10s), annealing (primer-dependent temperature, 10s), extension (72 °C, 12s), and fluorescence capture step. Product length was assessed by agarose gel electrophoresis

GeneForward primer (5′→3′)Reverse primers (5′→3′)Annealing temperature (°C)Product length (bp)
18SCCTCCAATGGATCCTCGTAAACGGCTACCACATCCA54 160
ActinGAGACCTTCAACACCCCGTGGTGGTGAAGCTGTAGCC56219
AdiponectinCTGGCTCCAAGTGTATGGGGAAGCCTGTCGCCTGTTCTTT55161
AdipoR1GTCGACAGGCCTAAGTGTCCCTAGAAGGAGCCCCATTGCC60165
Appl1AGTGCAGCAACTCACCTGACGGAACATCATGGCATCAGCG60159
Cpt1mTTTGAGATGCACGGCAAGACCTGGACAAGAGGCGAACACA5964
Nrf1CCTCTGATGCTTGCGTCGTCTTTACTCTGCTGTGGCTGATGG5587
Pgc1aATCTACTGCCTGGGGACCTTATGTGTCGCCTTCTTGCTCT60179
Sirt1CAGTGTCATGGTTCCTTTGCCACCGAGGAACTACCTGAT56103
Sirt3AGGCCCATATCCCTCTCTGTACTCCCTGGGGATCTGAAGT55185
TfamGCTAAACACCCAGATGCAAAACGAGGTCTTTTTGGTTTTCC53248

AdipoR1, adiponectin receptor 1; Appl1, adaptor protein containing PH domain, PTB domain, and leucine zipper motif 1; Cpt1m, carnitin-palmitoyl transferase 1m; Nrf1, nuclear respiratory factor 1; Pgc1a, peroxisome proliferator-activated receptor coactivator 1α; Sirt1 and 3, sirtuins 1 and 3; Tfam, mitochondrial transcription factor A.

Cell culture of L6E9 myotubes

Rat L6E9 myoblasts, a subclone of the L6 cell line obtained from the muscle of newborn rats (Yaffe 1968), were routinely maintained at 37 °C in a humidified atmosphere of 5% CO2 in DMEM/high-glucose medium (Gibco by Invitrogen) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin, both from Biological Industries (Beit-Haemek, Israel). After the cells reached confluence, myotube formation was induced by restricting serum in media (2% FBS). Differentiation medium was replaced 24 h before treatment by phenol-red-free DMEM/high-glucose medium (Gibco by Invitrogen) supplemented with 2% charcoal-stripped FBS (Biological Industries) and 1% penicillin–streptomycin. Preliminary experiments were carried out to determine the appropriate concentration for each compound, and cell death was ruled out by the LDH Cytotoxicity Assay Kit II (Biovision, Inc., San Francisco, CA, USA). The cells were treated with either E2 (1 nM), Pg, or testosterone, both at 10 μM, or the vehicle (ethanol) for 18 (for mRNA determination) or 24 h (for confocal analysis). For all the experiments, the cell line had undergone between 15 and 20 passages.

Analysis of L6E9 mRNA levels by real-time reverse transcriptase PCR

mRNA of L6E9 rat myotubes was obtained from a six-well plate using 1 ml TriPure Isolation Reagent (Roche Diagnostics) per well and following the manufacturer's instructions. It was quantified with the Nanodrop system (BioTek). RT and real-time PCR were carried out as described earlier for Pgc1a, Tfam, adiponectin, and AdipoR1.

Confocal microscopy

L6E9 were seeded, differentiated, and treated as described previously for 24 h in Nunc Lab-Tek II Chamber Slide (Thermo-Fisher Scientific, Madrid, Spain). At the time of the analysis, 0.5 μM MitoTracker Green (MTG, Invitrogen) was added. The cells were incubated for 1 h and then washed three times with fresh media. Fluorescence was viewed using a Leica confocal microscope and images were acquired using a 40× objective lens and the Leica Application Suite (LAS) software, version Advanced Fluorescence 2.3.6 build 5381.

Statistical analysis

All data from in vivo experiments are expressed as the mean±s.e.m. of six animals per group. Hormone effects were analyzed by one-way ANOVA. Least significant difference (LSD) was applied as a post hoc analysis of hormone effects. In vitro data were analyzed from three individual experiments carried out in duplicate (n=6) and statistical differences between groups were assessed by independent-samples Student's t-test.

All statistical analyses were carried out using a statistical software package (SPSS 21.0 for Windows, Inc.), and a P value <0.05 was considered statistically significant. Ct values of the real-time PCR were analyzed using GenEx Standard Software 5.3.6 (MultiD Analyses, Goteborg, Sweden), and the efficiency of the reaction was taken into account for each gene.

Results

Effects of ovariectomy and E2 replacement on serum levels of sex hormones, adipokines, and NEFA

Ovariectomy induced a decrease in E2 and Pg serum levels, although only the latter reached statistical significance (Table 2). With the administration of E2, the levels of both hormones increased, but while Pg did not reach control values, E2 exceeded them more than twofold. Ovariectomy did not induce changes in adiponectin levels, whereas resistin concentration was increased. E2 replacement decreased both adiponectin and resistin serum levels. NEFA levels were not affected either by OVX or E2 administration.

Table 2

Effects of ovariectomy and 17β-estradiol replacement on serum levels of sex hormones, adipokines, and NEFA. E2 concentration is expressed in arbitrary units (AU) with control values set as 100. Values are expressed as the mean±s.e.m. of six animals per group

ControlOVXOVX+E2ANOVA
17β-estradiol (AU)100±2461.3±9.7240±103a,bH
Progesterone (ng/ml)24.6±2.13.42±1.28a10.7±2.3a,bH
Adiponectin (μg/ml)39.9±4.744.4±3.422.6±0.3a,bH
Resistin (ng/ml)137±16250±20a177±23bH
NEFA (mmol/l)0.891±0.0340.777±0.0180.886±0.105NS

OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; NEFA, nonesterified fatty acids. Hormone effects were analyzed by one-way ANOVA (P<0.05): H indicates hormone effect and NS stands for nonsignificant. LSD was applied as a post hoc analysis of hormone effects (P<0.05).

Significant difference from control.

Significant difference from OVX.

Effects of ovariectomy and E2 replacement on body and gastrocnemius weight, adiposity index, and WGM composition

Ovariectomy induced 36 and 39% increases in body and gastrocnemius weight, respectively, compared with control rats (Table 3). Although E2 replacement produced a 19% decrease in both parameters compared with the OVX group, the values remained higher than those of controls. The adiposity index also rose with ovariectomy, and E2 treatment reversed this increase. Triglyceride and DNA levels were not modified by ovariectomy or by E2 administration, and protein content increased with E2 administration.

Table 3

Effects of ovariectomy and 17β-estradiol replacement on body and gastrocnemius weight, adiposity index, and white gastrocnemius muscle composition. Gastrocnemius weight represents the total weight of gastrocnemius muscle (white plus red). Adiposity index is the sum of gonadal, mesenteric, and retroperitoneal depot weights relative to 100 g of body weight. Values are expressed as the mean±s.e.m. of six animals per group

ControlOVXOVX+E2ANOVA
BW (g)219±5298±6a242±5a,bH
Adiposity index (%)4.80±0.687.27±0.44a5.30±0.28bH
Gastrocnemius weight
 (g)2.64±0.053.67±0.05a2.94±0.02a,bH
 (g/100 g BW)1.22±0.011.24±0.011.25±0.03NS
Protein (mg/g tissue)43.3±1.142.6±0.747.8±0.9a,bH
TG (mg/g tissue)16.5±2.731.3±4.823.2±4.4NS
DNA (mg/g tissue)0.298±0.0310.281±0.0270.374±0.039NS

OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; BW, body weight; TG, triglycerides. Hormone effects were analyzed by one-way ANOVA (P<0.05): H indicates hormone effects and NS stands for nonsignificant. LSD was applied as a post hoc analysis of hormone effects (P<0.05).

Significant difference from control.

Significant difference from OVX.

Effects of ovariectomy and E2 replacement on markers of mitochondrial oxidative capacity in WGM

Myofiber oxygen consumption determined using glutamate and malate was lower in the OVX group compared with the control group (Table 4), but administration of E2 reversed this decrease, although it did not reach statistical significance (P=0.050). COX and CS activities, as well as COX4 (COX4I1) protein levels (Table 4, representative immunoblots are shown in Fig. 1), were not modified by ovariectomy but were increased over control values by E2 administration. Cpt1m mRNA levels were unaffected by hormonal manipulation.

Table 4

Effects of ovariectomy and 17β-estradiol replacement on markers of mitochondrial oxidative capacity in white gastrocnemius muscle. Glutamate/malate was used as a substrate for O2 consumption measurement. CS activity is expressed as international units (μmol/min). For mRNA levels, GenEx software was used to analyze the Ct values normalized to 18S Ct. Values are expressed as the mean±s.e.m. of six animals per group

ControlOVXOVX+E2ANOVA
O2 consumption (VO2/min.IU CS) 137±1744.9±3.9a85.6±20.9aH
CS activity (mIU/g tissue)3.00±0.223.08±0.193.86±0.09a,bH
COX activity (AU/mg tissue)100±13113±12158±12a,bH
COX4 (%) 100±1884.9±12.6152±7a,bH
Cpt1m mRNA (normalized data)1.61±0.171.49±0.132.07±0.12NS

OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; CS, citrate synthase; COX, cytochrome c oxidase; COX4, cytochrome c oxidase subunit 4; Cpt1m, carnitin-palmitoyl transferase 1m; AU, arbitrary units. Hormone effects were analyzed by one-way ANOVA (P<0.05): H indicates hormone effect and NS stands for nonsignificant. LSD was applied as a post hoc analysis of hormone effects (P<0.05).

Significant difference from control.

Significant difference from OVX.

Effects of ovariectomy and E2 replacement on oxidative stress markers in WGM

The H2O2 generation of WGM-permeabilized myofibers was measured in state 4 using glutamate/malate as a substrate (Table 5). Myofibers from OVX groups generated more H2O2 than those of controls, and this increase was accompanied by higher GPx activity. WGM SOD activity and serum TAC were not altered by hormonal manipulations. Protein carbonyl groups and lipid peroxides (HNE) decreased in the OVX+E2 group when comparing with OVX animals. UCP3 protein levels decreased with ovariectomy and returned to control values after E2 administration (Table 5, representative immunoblots are shown in Fig. 1).

Table 5

Effects of ovariectomy and 17β-estradiol replacement on oxidative stress markers in white gastrocnemius muscle. GPx and SOD activities are expressed as international units (μmol/min). Glutamate/malate was used as a substrate for H2O2 production. Values are expressed as the mean±s.e.m. of six animals per group

ControlOVXOVX+E2ANOVA
H2O2 production (pmolH2O2/IU CS.min)0.035±0.0080.116±0.006a0.122±0.032aH
TAC (nmol Trolox/μl serum)81.4±4.478.8±1.784.9±5.4NS
GPx (IU/g tissue)0.363±0.0360.490±0.041a0.521±0.041aH
SOD (IU/g tissue)1.08±0.110.969±0.0491.12±0.02NS
4HNE (%)100±8112±494.6±2.7bH
Protein carbonyl groups (%)100±4104±1291.9±0.45bH
UCP3 (%)100±1056.3±6.4a84.7±4.6bH

OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; CS, citrate synthase; GPx, glutathione peroxidase; SOD, superoxide dismutase; TAC, total antioxidant capacity; 4HNE, 4-hydroxynonenal; UCP3, uncoupling protein 3. Hormone effects were analyzed by one-way ANOVA (P<0.05): H indicates hormone effect and NS stands for nonsignificant. LSD was applied as a post hoc analysis of hormone effects (P<0.05).

Significant difference from control.

Significant difference from OVX.

Effects of ovariectomy and E2 replacement on the expression of the markers of mitochondrial function, biogenesis, and dynamics in WGM

Ovariectomy decreased mRNA levels of the main markers of mitochondrial biogenesis, Pgc1a and Tfam (Table 6). Ovariectomy also reduced the protein levels of mitochondrial dynamics markers MFN1, MFN2, and OPA1, as well as DRP1 (DNM1L) (representative immunoblots are shown in Fig. 1), although it did not reach statistical significance (P=0.054) (Table 6). This decrease was reversed by E2 administration for all the biogenesis and dynamics parameters except for OPA1. The expression of Nrf1, Sirt1, and Sirt3 was unaffected by OVX but increased with E2 administration.

Table 6

Effects of ovariectomy and 17β-estradiol replacement on the expression of markers of mitochondrial function, biogenesis, and dynamics in white gastrocnemius muscle. GenEx software was used to analyze the Ct values normalized to 18S Ct. Protein levels are expressed in arbitrary units per mg of protein and control values were set as 100. Values are expressed as the mean±s.e.m. of six animals per group

ControlOVXOVX+E2ANOVA
mRNA levels (normalized data)
 Pgc1a2.01±0.231.44±0.18a2.17±0.19bH
 Nrf11.50±0.081.51±0.131.97±0.15a,bH
 Tfam5.52±0.033.07±0.57a4.96±0.50bH
 Sirt11.61±0.101.42±0.122.18±0.09a,bH
 Sirt31.37±0.061.24±0.071.58±0.07a,bH
Protein levels (arbitrary units)
 MFN1 100±354.4±10.5a114±4a,bH
 MFN2 100±1259.8±10.5a103±11bH
 OPA1100±379.3±7.1a84.9±2.1H
 DRP1 100±2537.6±5.9141±16bH

OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; Pgc1a, peroxisome proliferator-activated receptor-γ coactivator 1α; Tfam, mitochondrial transcription factor A; Nrf1, nuclear respiratory factor 1; Sirt1 and 3, sirtuin 1 and 3; MFN1 and 2, mitofusin 1 and 2; OPA1, optic atrophy protein 1; DRP1, dynamin-related protein 1. Hormone effects were analyzed by one-way ANOVA (P<0.05): H indicates hormone effect and NS stands for nonsignificant. LSD was applied as a post hoc analysis of hormone effects (P<0.05).

Significant difference from control.

Significant difference from OVX.

Effects of hormonal treatments on the markers of mitochondrial biogenesis in L6E9 myotubes

Intensity of MTG staining was used as an indicator of mitochondrial mass in L6E9 myotubes (Fig. 2). E2 and Pg treatments increased both mitochondrial mass (Fig. 2A and B) and Pgc1a expression (Fig. 2C). Tfam mRNA levels also increased in E2-treated myotubes (Fig. 2D). No effect of testosterone treatment on any of these parameters was observed.

Figure 2
Figure 2

Mitochondrial mass and biogenesis markers in L6E9 myotubes treated with vehicle, E2 (10 nM), Pg, or testosterone (1 μM both). (A) Mitochondrial staining of L6E9 myotubes treated with E2, Pg, or testosterone (T). (B) Green fluorescence quantification in L6E9 myotubes. Fluorescence of control cells was set as 100 (C and D) mRNA levels of Pgc1a and Tfam in L6E9 myotubes. GenEx software was used to analyze the Ct values normalized to 18S Ct. MTG, Mitotracker Green; C, control; E2, 17β-estradiol; Pg, progesterone; Pgc1a, peroxisome proliferator-activated receptor coactivator 1α; Tfam, mitochondrial transcription factor A. Values are expressed as the mean±s.e.m. of three independent experiments carried out in duplicate (n=6). Student's t-test (P<0.05). *Significant difference vs control. A full colour version of this figure is available at http://dx.doi.org/10.1530/JOE-14-0008.

Citation: Journal of Endocrinology 221, 3; 10.1530/JOE-14-0008

Effects of hormonal manipulation on adiponectin, AdipoR1, and Appl1 levels in WGM and in L6E9 myotubes

Ovariectomy decreased adiponectin expression in WGM (Fig. 3A). ADIPOR1 protein levels from WGM also decreased in OVX rats and they were fully restored in OVX+E2 animals (Fig. 3B). Appl1 mRNA levels decreased with ovariectomy, although this decrease did not reach statistical significance (P=0.052), and E2 replacement returned Appl1 expression to control levels (Fig. 3C). In L6E9 myotubes, E2 and Pg administration increased adiponectin expression (Fig. 3D). AdipoR1 mRNA levels were also increased by E2 treatment but they decreased in testosterone-treated cells (Fig. 3E). Appl1 mRNA levels were also decreased by testosterone treatment, but E2 treatment had no effect (Fig. 3F).

Figure 3
Figure 3

Effects of ovariectomy and E2 supplementation on adiponectin (A) and on Appl1 (C) mRNA and on ADIPOR1 protein levels (B) in white gastrocnemius muscle. Effects of sex hormone administration on adiponectin (D), AdipoR1 (D), and Appl1 (F) mRNA levels in L6E9 myotubes. OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; C, control; E2, 17β-estradiol; Pg, progesterone; AdipoR1, adiponectin receptor 1; APPL1, adaptor protein containing PH domain, PTB domain, and leucine zipper motif 1. Protein levels are expressed in arbitrary units per mg of protein. α-tubulin was used as a loading control. For mRNA, GenEx software was used to analyze the Ct values normalized to 18S Ct. Values in (A), (B), and (C) are expressed as the mean±s.e.m. of six animals per group. Hormone effects were analyzed by one-way ANOVA (P<0.05): H indicates hormone effect. LSD was applied as a post hoc analysis of hormone effects (P<0.05): asignificant difference from control; bsignificant difference from OVX. In (D), (E), and (F) L6E9 cells were treated with either E2 (10 nM), Pg, or testosterone (1 μM both). Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments carried out in duplicate (n=6). Student's t-test (P<0.05). *Significant difference from control.

Citation: Journal of Endocrinology 221, 3; 10.1530/JOE-14-0008

Discussion

Previous studies have reported that skeletal muscle of female rats shows greater mitochondrial differentiation and content accompanied by a higher OXPHOS capacity and better antioxidant response than that of males, which could explain the greater capacity of females to adapt to altered metabolic energy situations (Colom et al. 2007a, Gómez-Pérez et al. 2012). In addition, this sexual dimorphism in mitochondrial functionality has also been associated with the greater susceptibility of male rats to development of skeletal muscle insulin resistance in response to both aging (Gómez-Pérez et al. 2011) and high -fat-diet intake (Gómez-Pérez et al. 2012). In the present study, we used OVX rats to evaluate the effects of both a decrease in ovarian hormone levels and E2 replacement on skeletal muscle mitochondrial function and adiponectin expression. In order to identify the specific role of sex hormones, we treated cultured L6E9 myotubes with E2, Pg, or testosterone. Our results confirm the role of E2 in the maintenance of proper mitochondrial content and function in skeletal muscle, and support the idea of E2-mediated modulation of adiponectin expression, a fact that indicates the existence of a link between mitochondrial function and adiponectin expression in skeletal muscle.

In the present study, more than 2 months separated ovariectomy from killing, which could explain the lack of a significant decrease in E2 serum levels for OVX animals, a fact that has been previously described (Pantaleao et al. 2010, Nadal-Casellas et al. 2011b, Amengual-Cladera et al. 2012a,c). It is plausible to consider that compensatory mechanisms that alleviate the effects of ovariectomy could have been activated in OVX females. In this sense, it is worth noting that estrogen production has been reported to shift from ovaries to extragonadal sites when ovarian function fails in young females (Simpson 2003). Moreover, results described in previous reports have shown that circulating estrogen concentration increases gradually with time after ovariectomy in rats, which has been attributed to greater aromatase activity in adipose tissue, among other factors (Zhao et al. 2005).

Mitochondrial biogenesis involves both mitochondrial proliferation (increase in mitochondrial content) and differentiation (improvement of mitochondrial capacities) (Attardi & Schatz 1988). Our data show E2-induced enhancement of mitochondrial biogenesis in rat skeletal muscle. We found that E2 replacement in OVX rats upregulates mRNA levels of Pgc1a, a master regulator of mitochondrial biogenesis (Puigserver & Spiegelman 2003), contrary to results reported for smooth muscle in a previous study (Macari et al. 2010). In accordance with the increase in Pgc1a, Tfam and Nrf1 mRNA levels were also upregulated by E2. Tfam products have been determined to drive transcription and replication of mitochondrial DNA (Ventura-Clapier et al. 2008), and Tfam is activated by Pgc1a through the induction of the expression of Nrf1 (Wu et al. 1999). This stimulatory role of E2 replacement in mitochondrial proliferation is supported by our in vitro results, because E2 treatment of L6E9 myotubes increases mitochondrial mass, probably through the upregulation of Pgc1a, as both parameters show the same profile. Pg treatment brings about the same effects as E2, although to a lesser extent, whereas testosterone does not seem to be involved in the enhancement of skeletal muscle mitochondrial proliferation.

The E2-induced increase in mitochondrial proliferation runs in parallel with a higher oxidative capacity in E2-treated animals (indicated by COX and CS activities and by COX4 protein levels), which is accompanied by a slight recovery of oxygen consumption. These results support the idea that E2 also increases mitochondrial differentiation in skeletal muscle. This increase in oxidative capacity might be due to the aforementioned rise in Nrf1 mRNA levels, as this factor triggers the expression of nuclear genes encoding mitochondrial proteins (Scarpulla 2011), and also due to the enhanced mRNA expression of Sirt3 that we found in OVX+E2 rats, as this protein is involved in the regulation of mitochondrial respiratory chain subunits through the reversible acetylation of lysine residues (Schwer et al. 2006, Lombard et al. 2007).

E2 replacement also induced a reduction in oxidative stress markers compared with OVX animals, in spite of their higher H2O2 production. This fact could be attributed to the maintenance of both SOD and GPx activities, and also to the E2-associated reestablishment of UCP3 protein levels with E2 replacement. In fact, UCP3 has been proposed to play a relevant role in protection against ROS production in skeletal muscle (Vidal-Puig et al. 2000, Brand et al. 2002), and females have been shown to have a better ability to counteract oxidative-stress-associated pathologies induced by high-fat diet in part through greater UCP3 expression (Gómez-Pérez et al. 2008). Moreover, the intrinsic antioxidant role of E2 (Ayres et al. 1996) cannot be ruled out, especially considering the high E2 serum levels reached by OVX+E2 animals. Mitochondrial function and the response to oxidative stress can be strongly affected by fiber composition (Anderson & Neufer 2006, Picard et al. 2008, 2012). Ovariectomy has been reported to modify muscle contractile properties, phenotype, metabolism, and force-generating capacity (Moran et al. 2006, Liu et al. 2009c), whereas estradiol replacement reverses these alterations (Moran et al. 2007, Liu et al. 2009b, Cavalcanti-de-Albuquerque et al. 2014). In this sense, it is not possible to rule out the hypothesis that the changes observed in white gastrocnemius mitochondrial function and oxidative stress response from OVX and OVX+E2 rats are mediated by a change in fiber metabolism or phenotype; further studies would be necessary.

Mitochondrial biogenesis requires a continuous cycle of fusion and fission events (Ventura-Clapier et al. 2008) to maintain proper mitochondrial dynamics (Chen & Chan 2004). E2 replacement enhances both fusion and fission processes, as shown by the upregulation of mitofusins and DRP1, paralleling the profile observed for mitochondrial biogenesis markers. This is in agreement with the existence of a connection between both mitochondrial dynamics and biogenesis, which would be modulated by E2.

Mitochondrial function is linked with adiponectin synthesis in adipocytes (Koh et al. 2007, Wang et al. 2013). Adiponectin expressed in skeletal muscle can be posttranslationally modified within the myotubes, allowing the formation of biologically active forms that exert local metabolic effects that are independent of circulating levels of adiponectin (Liu et al. 2009a). Although in vivo E2 replacement only partially reinstated the decrease in the levels of expression of adiponectin induced by ovariectomy, in vitro E2 and Pg treatments (but not testosterone administration) clearly enhance adiponectin expression in cultured myotubes, as occurred with mitochondrial biogenesis. This indicates a relevant role of E2 in the stimulation of adiponectin expression in skeletal muscle. This stimulatory effect of E2 on adiponectin expression in skeletal muscle is not reflected in levels of circulating adiponectin, which is not surprising taking into account that the main contributor to serum levels of adiponectin is WAT. In fact, the serum adiponectin profile parallels noticeably the profile that we have previously observed in the expression of adiponectin mRNA in retroperitoneal WAT (Amengual-Cladera et al. 2012a,c). These results indicate that regulation of skeletal muscle adiponectin is independent of circulating levels.

AdipoR1 is the main adiponectin receptor in skeletal muscle (Yamauchi et al. 2003), and its action is mediated through APPL1, which acts as a positive regulator of adiponectin signaling in muscle cells (Deepa & Dong 2009). Our in vitro results indicate that E2 stimulates both adiponectin and AdipoR1 expression, whereas testosterone treatment has the opposite effects and impairs the expression of both adiponectin and key elements of its signaling pathway. The effects of E2 observed in vitro are in agreement with the results obtained in WGM, where the decrease in estrogen levels produced by ovariectomy induces impairment of adiponectin expression and its signaling pathway, which are restored by administration of E2. However, the E2-associated restoration of Appl1 mRNA levels in WGM of OVX rats is not observed in L6E9 myotubes. This lack of response to the sex hormone could be attributed to the absence of stimulation of the adiponectin signaling pathway by the adipokine.

As AdipoR1 has been reported to mediate the autocrine effects of adiponectin (Jortay et al. 2012, Patel et al. 2012), our results indicate a role of E2 in the enhancement of not only skeletal muscle adiponectin production but also of its local action. Moreover, the E2-mediated increase in Sirt1 expression at the mRNA level further supports the idea that this hormone could play a role in the stimulation of adiponectin signaling in skeletal muscle, given that Sirt1 is a downstream effector of the adiponectin signaling pathway that promotes PGC1a activation (Iwabu et al. 2010), which induces an improvement in mitochondrial function and biogenesis. These results lead to the idea of a potential link between adiponectin signaling and mitochondrial function in skeletal muscle in a similar way to that described for WAT (Koh et al. 2007, Wang et al. 2013) and that is supported by the similarities we observed in this study between the profiles of mitochondrial biogenesis and adiponectin expression under E2 stimulation.

On the whole, our data indicate that E2 can be established as a relevant stimulator of the mitochondrial biogenesis process in skeletal muscle, because it enhances mitochondrial proliferation and dynamics, as well as mitochondrial oxidative capacities, whereas oxidative stress is reduced. These results support a role of E2 in the sexual dimorphism in rat skeletal muscle that we have previously reported, whereby female rats show higher mitochondrial mass, greater oxidative capacity, and also a better antioxidant response than their male counterparts (Colom et al. 2007a, Gómez-Pérez et al. 2008, 2012). Furthermore, we demonstrate that ovarian hormones play a relevant role in adiponectin synthesis in skeletal muscle, and that E2 could be a key effector in the stimulation of skeletal muscle adiponectin sensitivity. In contrast, testosterone does not seem to play a relevant role in mitochondrial biogenesis or in modulation of adiponectin expression under the studied conditions, although it decreases adiponectin sensitivity. Finally, the similarities observed between E2-induced stimulation of mitochondrial function and biogenesis and enhanced adiponectin expression indicates the existence of a link between mitochondrial function and adiponectin expression in skeletal muscle, which could be modulated by sex hormones.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by Dirección General de Investigación y Gestión del Plan Nacional de investigación científica, desarrollo e innovación (SAF2010-21792) of the Spanish Government and by Comunitat Autònoma de les Illes Balears and the Federación Española de Asociaciones de Enfermedades Raras (FEDER) (31/2011). G C-A and M S-R were funded by a grant from the Conselleria d'Educació, Cultura i Universitats of the Balearic Islands Government, after being selected in the framework of an operating program co-financed by the European Social Fund. BM G-P was funded by a FPU grant from the Ministerio de Educación, Cultura y Deporte of the Spanish Government.

Acknowledgements

The authors are grateful to Dr A Zorzano from the Biomedical Research Institute (Barcelona, Spain) for kindly donating L6E9 cells.

References

  • Amengual-Cladera E, Llado I, Gianotti M & Proenza AM 2012a Retroperitoneal white adipose tissue mitochondrial function and adiponectin expression in response to ovariectomy and 17β-estradiol replacement. Steroids 77 659665. (doi:10.1016/j.steroids.2012.02.012)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Amengual-Cladera E, Llado I, Gianotti M & Proenza AM 2012b Sex differences in the effect of high-fat diet feeding on rat white adipose tissue mitochondrial function and insulin sensitivity. Metabolism 61 11081117. (doi:10.1016/j.metabol.2011.12.016)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Amengual-Cladera E, Llado I, Proenza AM & Gianotti M 2012c High-fat diet feeding induces a depot-dependent response on the pro-inflammatory state and mitochondrial function of gonadal white adipose tissue. British Journal of Nutrition 109 413424. (doi:10.1016/j.metabol.2011.12.016)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Anderson EJ & Neufer PD 2006 Type II skeletal myofibers possess unique properties that potentiate mitochondrial H2O2 generation. American Journal of Physiology. Cell Physiology 290 C844C851. (doi:10.1152/ajpcell.00402.2005)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Attardi G & Schatz G 1988 Biogenesis of mitochondria. Annual Review of Cell Biology 4 289333. (doi:10.1146/annurev.cb.04.110188.001445)

  • Ayres S, Tang M & Subbiah MT 1996 Estradiol-17β as an antioxidant: some distinct features when compared with common fat-soluble antioxidants. Journal of Laboratory and Clinical Medicine 128 367375. (doi:10.1016/S0022-2143(96)80008-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Analytical Biochemistry 72 248254. (doi:10.1016/0003-2697(76)90527-3)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brand MD, Pamplona R, Portero-Otin M, Requena JR, Roebuck SJ, Buckingham JA, Clapham JC & Cadenas S 2002 Oxidative damage and phospholipid fatty acyl composition in skeletal muscle mitochondria from mice underexpressing or overexpressing uncoupling protein 3. Biochemical Journal 368 597603. (doi:10.1042/BJ20021077)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Burelle Y & Hochachka PW 2002 Endurance training induces muscle-specific changes in mitochondrial function in skinned muscle fibers. Journal of Applied Physiology 92 24292438. (doi:10.1152/japplphysiol.01024.2001)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Català-Niell A, Estrany ME, Proenza AM, Gianotti M & Llado I 2008 Skeletal muscle and liver oxidative metabolism in response to a voluntary isocaloric intake of a high fat diet in male and female rats. Cellular Physiology and Biochemistry 22 327336. (doi:10.1159/000149811)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cavalcanti-de-Albuquerque JP, Salvador ID, Martins EG, Jardim-Messeder D, Werneck de Castro JP, Galina A & de Carvalho DP 2014 Role of estrogen on skeletal muscle mitochondrial function in ovariectomized rats: a time course study in different fiber types. Journal of Applied Physiology 116 779789. (doi:10.1152/japplphysiol.00121.2013)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen H & Chan DC 2004 Mitochondrial dynamics in mammals. Current Topics in Developmental Biology 59 119144. (doi:10.1016/S0070-2153(04)59005-1)

  • Chen J, Li Y, Lavigne JA, Trush MA & Yager JD 1999 Increased mitochondrial superoxide production in rat liver mitochondria, rat hepatocytes, and HepG2 cells following ethinyl estradiol treatment. Toxicological Sciences 51 224235. (doi:10.1093/toxsci/51.2.224)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen JQ, Brown TR & Russo J 2009 Regulation of energy metabolism pathways by estrogens and estrogenic chemicals and potential implications in obesity associated with increased exposure to endocrine disruptors. Biochimica et Biophysica Acta 1793 11281143. (doi:10.1016/j.bbamcr.2009.03.009)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chrzanowska-Lightowlers ZM, Turnbull DM & Lightowlers RN 1993 A microtiter plate assay for cytochrome c oxidase in permeabilized whole cells. Analytical Biochemistry 214 4549. (doi:10.1006/abio.1993.1454)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Civitarese AE, Ukropcova B, Carling S, Hulver M, DeFronzo RA, Mandarino L, Ravussin E & Smith SR 2006 Role of adiponectin in human skeletal muscle bioenergetics. Cell Metabolism 4 7587. (doi:10.1016/j.cmet.2006.05.002)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Colom B, Alcolea MP, Valle A, Oliver J, Roca P & Garcia-Palmer FJ 2007a Skeletal muscle of female rats exhibit higher mitochondrial mass and oxidative-phosphorylative capacities compared to males. Cellular Physiology and Biochemistry 19 205212. (doi:10.1159/000099208)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Colom B, Oliver J, Roca P & Garcia-Palmer FJ 2007b Caloric restriction and gender modulate cardiac muscle mitochondrial H2O2 production and oxidative damage. Cardiovascular Research 74 456465. (doi:10.1016/j.cardiores.2007.02.001)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Deepa SS & Dong LQ 2009 APPL1: role in adiponectin signaling and beyond. American Journal of Physiology. Endocrinology and Metabolism 296 E22E36. (doi:10.1152/ajpendo.90731.2008)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dighe AS & Sluss PM 2004 Improved detection of serum estradiol after sample extraction procedure. Clinical Chemistry 50 764766. (doi:10.1373/clinchem.2003.029553)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ding G, Qin Q, He N, Francis-David SC, Hou J, Liu J, Ricks E & Yang Q 2007 Adiponectin and its receptors are expressed in adult ventricular cardiomyocytes and upregulated by activation of peroxisome proliferator-activated receptor γ. Journal of Molecular and Cellular Cardiology 43 7384. (doi:10.1016/j.yjmcc.2007.04.014)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gómez-Pérez Y, Amengual-Cladera E, Catala-Niell A, Thomas-Moya E, Gianotti M, Proenza AM & Llado I 2008 Gender dimorphism in high-fat-diet-induced insulin resistance in skeletal muscle of aged rats. Cellular Physiology and Biochemistry 22 539548. (doi:10.1159/000185538)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gómez-Pérez Y, Gianotti M, Proenza AM & Llado I 2011 Age-related decline of skeletal muscle insulin sensitivity in rats: effect of sex and muscle type. Rejuvenation Research 14 153161. (doi:10.1089/rej.2010.1107)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gómez-Pérez Y, Capllonch-Amer G, Gianotti M, Llado I & Proenza AM 2012 Long-term high-fat-diet feeding induces skeletal muscle mitochondrial biogenesis in rats in a sex-dependent and muscle-type specific manner. Nutrition and Metabolism 9 15. (doi:10.1186/1743-7075-9-15)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Guevara R, Santandreu FM, Valle A, Gianotti M, Oliver J & Roca P 2009 Sex-dependent differences in aged rat brain mitochondrial function and oxidative stress. Free Radical Biology & Medicine 46 169175. (doi:10.1016/j.freeradbiomed.2008.09.035)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Harwood HJ Jr 2012 The adipocyte as an endocrine organ in the regulation of metabolic homeostasis. Neuropharmacology 63 5775. (doi:10.1016/j.neuropharm.2011.12.010)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Iwabu M, Yamauchi T, Okada-Iwabu M, Sato K, Nakagawa T, Funata M, Yamaguchi M, Namiki S, Nakayama R & Tabata M et al. 2010 Adiponectin and AdipoR1 regulate PGC-1α and mitochondria by Ca2+ and AMPK/SIRT1. Nature 464 13131319. (doi:10.1038/nature08991)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jortay J, Senou M, Abou-Samra M, Noel L, Robert A, Many MC & Brichard SM 2012 Adiponectin and skeletal muscle: pathophysiological implications in metabolic stress. American Journal of Pathology 181 245256. (doi:10.1016/j.ajpath.2012.03.035)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Klinge CM 2008 Estrogenic control of mitochondrial function and biogenesis. Journal of Cellular Biochemistry 105 13421351. (doi:10.1002/jcb.21936)

  • Koh EH, Park JY, Park HS, Jeon MJ, Ryu JW, Kim M, Kim SY, Kim MS, Kim SW & Park IS et al. 2007 Essential role of mitochondrial function in adiponectin synthesis in adipocytes. Diabetes 56 29732981. (doi:10.2337/db07-0510)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Krause MP, Liu Y, Vu V, Chan L, Xu A, Riddell MC, Sweeney G & Hawke TJ 2008 Adiponectin is expressed by skeletal muscle fibers and influences muscle phenotype and function. American Journal of Physiology. Cell Physiology 295 C203C212. (doi:10.1152/ajpcell.00030.2008)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu Y, Chewchuk S, Lavigne C, Brule S, Pilon G, Houde V, Xu A, Marette A & Sweeney G 2009a Functional significance of skeletal muscle adiponectin production, changes in animal models of obesity and diabetes, and regulation by rosiglitazone treatment. American Journal of Physiology. Endocrinology and Metabolism 297 E657E664. (doi:10.1152/ajpendo.00186.2009)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu YH, Huang Y & Shao X 2009b Effects of estrogen on genioglossal muscle contractile properties and fiber-type distribution in chronic intermittent hypoxia rats. European Journal of Oral Sciences 117 685690. (doi:10.1111/j.1600-0722.2009.00681.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu YH, Jia SS & Hou YX 2009c Effects of ovariectomy on rat genioglossal muscle contractile properties and fiber-type distribution. Angle Orthodontist 79 509514. (doi:10.2319/031608-149.1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lombard DB, Alt FW, Cheng HL, Bunkenborg J, Streeper RS, Mostoslavsky R, Kim J, Yancopoulos G, Valenzuela D & Murphy A et al. 2007 Mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation. Molecular and Cellular Biology 27 88078814. (doi:10.1128/MCB.01636-07)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Macari C, Teyssier C, Tribollet V, Mouzat K, Forcet C, Horard B, Lobaccaro JM & Vanacker JM 2010 Estrogens repress PGC1-α expression in the uterus. Molecular and Cellular Endocrinology 330 3340. (doi:10.1016/j.mce.2010.08.003)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mattingly KA, Ivanova MM, Riggs KA, Wickramasinghe NS, Barch MJ & Klinge CM 2008 Estradiol stimulates transcription of nuclear respiratory factor-1 and increases mitochondrial biogenesis. Molecular Endocrinology 22 609622. (doi:10.1210/me.2007-0029)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mattson MP, Robinson N & Guo Q 1997 Estrogens stabilize mitochondrial function and protect neural cells against the pro-apoptotic action of mutant presenilin-1. Neuroreport 8 38173821. (doi:10.1097/00001756-199712010-00031)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moran AL, Warren GL & Lowe DA 2006 Removal of ovarian hormones from mature mice detrimentally affects muscle contractile function and myosin structural distribution. Journal of Applied Physiology 100 548559. (doi:10.1152/japplphysiol.01029.2005)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moran AL, Nelson SA, Landisch RM, Warren GL & Lowe DA 2007 Estradiol replacement reverses ovariectomy-induced muscle contractile and myosin dysfunction in mature female mice. Journal of Applied Physiology 102 13871393. (doi:10.1152/japplphysiol.01305.2006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moreira PI, Custodio JB, Nunes E, Oliveira PJ, Moreno A, Seica R, Oliveira CR & Santos MS 2011 Mitochondria from distinct tissues are differently affected by 17β-estradiol and tamoxifen. Journal of Steroid Biochemistry and Molecular Biology 123 816. (doi:10.1016/j.jsbmb.2010.09.004)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nadal-Casellas A, Proenza AM, Gianotti M & Lladó I 2011a Brown adipose tissue redox status in response to dietary-induced obesity-associated oxidative stress in male and female rats. Stress 14 174184. (doi:10.3109/10253890.2010.52468)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nadal-Casellas A, Proenza AM, Llado I & Gianotti M 2011b Effects of ovariectomy and 17-β estradiol replacement on rat brown adipose tissue mitochondrial function. Steroids 76 10511056. (doi:10.1016/j.steroids.2011.04.009)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nadal-Casellas A, Proenza AM, Llado I & Gianotti M 2012 Sex-dependent differences in rat hepatic lipid accumulation and insulin sensitivity in response to diet-induced obesity. Biochemistry and Cell Biology 90 164172. (doi:10.1139/o11-069)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nakano K, Tarashima M, Tachikawa E, Noda N, Nakayama T, Sasaki K, Mizoguchi E, Matsuzaki M & Osawa M 2005 Platelet mitochondrial evaluation during cytochrome c and dichloroacetate treatments of MELAS. Mitochondrion 5 426433. (doi:10.1016/j.mito.2005.10.002)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pantaleao TU, Mousovich F, Rosenthal D, Padron AS, Carvalho DP & da Costa VM 2010 Effect of serum estradiol and leptin levels on thyroid function, food intake and body weight gain in female Wistar rats. Steroids 75 638642. (doi:10.1016/j.steroids.2010.03.009)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Patel SA, Hoehn KL, Lawrence RT, Sawbridge L, Talbot NA, Tomsig JL, Turner N, Cooney GJ, Whitehead JP & Kraegen EW et al. 2012 Overexpression of the adiponectin receptor AdipoR1 in rat skeletal muscle amplifies local insulin sensitivity. Endocrinology 153 52315246. (doi:10.1210/en.2012-1368)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Picard M, Csukly K, Robillard ME, Godin R, Ascah A, Bourcier-Lucas C & Burelle Y 2008 Resistance to Ca2+-induced opening of the permeability transition pore differs in mitochondria from glycolytic and oxidative muscles. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 295 R659R668. (doi:10.1152/ajpregu.90357.2008)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Picard M, Hepple RT & Burelle Y 2012 Mitochondrial functional specialization in glycolytic and oxidative muscle fibers: tailoring the organelle for optimal function. American Journal of Physiology. Cell Physiology 302 C629C641. (doi:10.1152/ajpcell.00368.2011)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Puigserver P & Spiegelman BM 2003 Peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α): transcriptional coactivator and metabolic regulator. Endocrine Reviews 24 7890. (doi:10.1210/er.2002-0012)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Quick KL, Hardt JI & Dugan LL 2000 Rapid microplate assay for superoxide scavenging efficiency. Journal of Neuroscience Methods 97 139144. (doi:10.1016/S0165-0270(00)00179-5)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Riestra P, Garcia-Anguita A, Ortega L & Garces C 2013 Relationship of adiponectin with sex hormone levels in adolescents. Hormone Research in Paediatrics 79 8387. (doi:10.1159/000346898)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rodríguez-Cuenca S, Monjo M, Gianotti M, Proenza AM & Roca P 2007 Expression of mitochondrial biogenesis-signaling factors in brown adipocytes is influenced specifically by 17β-estradiol, testosterone, and progesterone. American Journal of Physiology. Endocrinology and Metabolism 292 E340E346. (doi:10.1152/ajpendo.00175.2006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Scarpulla RC 2011 Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochimica et Biophysica Acta 1813 12691278. (doi:10.1016/j.bbamcr.2010.09.019)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schwer B, Bunkenborg J, Verdin RO, Andersen JS & Verdin E 2006 Reversible lysine acetylation controls the activity of the mitochondrial enzyme acetyl-CoA synthetase 2. PNAS 103 1022410229. (doi:10.1073/pnas.0603968103)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Simpson ER 2003 Sources of estrogen and their importance. Journal of Steroid Biochemistry and Molecular Biology 86 225230. (doi:10.1016/S0960-0760(03)00360-1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Smith AD, Morris VC & Levander OA 2001 Rapid determination of glutathione peroxidase and thioredoxin reductase activities using a 96-well microplate format: comparison to standard cuvette-based assays. International Journal for Vitamin and Nutrition Research 71 8792. (doi:10.1024/0300-9831.71.1.87)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thomas PS & Farquhar MN 1978 Specific measurement of DNA in nuclei and nucleic acids using diaminobenzoic acid. Analytical Biochemistry 89 3544. (doi:10.1016/0003-2697(78)90724-8)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Uribe M, Zamora-Valdes D, Moreno-Portillo M, Bermejo-Martinez L, Pichardo-Bahena R, Baptista-Gonzalez HA, Ponciano-Rodriguez G, Uribe MH, Medina-Santillan R & Mendez-Sanchez N 2008 Hepatic expression of ghrelin and adiponectin and their receptors in patients with nonalcoholic fatty liver disease. Annals of Hepatology 7 6771.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Valle A, Garcia-Palmer FJ, Oliver J & Roca P 2007a Sex differences in brown adipose tissue thermogenic features during caloric restriction. Cellular Physiology and Biochemistry 19 195204. (doi:10.1159/000099207)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Valle A, Guevara R, Garcia-Palmer FJ, Roca P & Oliver J 2007b Sexual dimorphism in liver mitochondrial oxidative capacity is conserved under caloric restriction conditions. American Journal of Physiology. Cell Physiology 293 C1302C1308. (doi:10.1152/ajpcell.00203.2007)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ventura-Clapier R, Garnier A & Veksler V 2008 Transcriptional control of mitochondrial biogenesis: the central role of PGC-1α. Cardiovascular Research 79 208217. (doi:10.1093/cvr/cvn098)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vidal-Puig AJ, Grujic D, Zhang CY, Hagen T, Boss O, Ido Y, Szczepanik A, Wade J, Mootha V & Cortright R et al. 2000 Energy metabolism in uncoupling protein 3 gene knockout mice. Journal of Biological Chemistry 275 1625816266. (doi:10.1074/jbc.M910179199)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Viña J, Gambini J, Lopez-Grueso R, Abdelaziz KM, Jove M & Borras C 2011 Females live longer than males: role of oxidative stress. Current Pharmaceutical Design 17 39593965. (doi:10.2174/138161211798764942)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang CH, Wang CC, Huang HC & Wei YH 2013 Mitochondrial dysfunction leads to impairment of insulin sensitivity and adiponectin secretion in adipocytes. FEBS Journal 280 10391050. (doi:10.1111/febs.12096)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wildman RP, Wang D, Fernandez I, Mancuso P, Santoro N, Scherer PE & Sowers MR 2013 Associations of testosterone and sex hormone binding globulin with adipose tissue hormones in midlife women. Obesity 21 629636. (doi:10.1002/oby.20256)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B & Scarpulla RC et al. 1999 Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98 115124. (doi:10.1016/S0092-8674(00)80611-X)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yaffe D 1968 Retention of differentiation potentialities during prolonged cultivation of myogenic cells. PNAS 61 477483. (doi:10.1073/pnas.61.2.477)

  • Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K & Tsunoda M et al. 2003 Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423 762769. (doi:10.1038/nature01705)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhao H, Tian Z, Hao J & Chen B 2005 Extragonadal aromatization increases with time after ovariectomy in rats. Reproductive Biology and Endocrinology 3 6. (doi:10.1186/1477-7827-3-6)

    • PubMed
    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • Representative immunoblots from white gastrocnemius muscle. C, control; OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; COX4, cytochrome c oxidase subunit 4; UCP3, uncoupling protein 3; MFN1, mitofusin 1; MFN2, mitofusin 2; OPA1, optic atrophy protein 1; DRP1, dynamin-related protein 1; AdipoR1, adiponectin receptor 1. When immunoblot bands or marker are grouped from different parts of the same gel, this is indicated by lines in the figure. Each protein was quantified in relation to the loading control from its gel, but only one representative immunoblot for actin is shown in this figure.

  • Mitochondrial mass and biogenesis markers in L6E9 myotubes treated with vehicle, E2 (10 nM), Pg, or testosterone (1 μM both). (A) Mitochondrial staining of L6E9 myotubes treated with E2, Pg, or testosterone (T). (B) Green fluorescence quantification in L6E9 myotubes. Fluorescence of control cells was set as 100 (C and D) mRNA levels of Pgc1a and Tfam in L6E9 myotubes. GenEx software was used to analyze the Ct values normalized to 18S Ct. MTG, Mitotracker Green; C, control; E2, 17β-estradiol; Pg, progesterone; Pgc1a, peroxisome proliferator-activated receptor coactivator 1α; Tfam, mitochondrial transcription factor A. Values are expressed as the mean±s.e.m. of three independent experiments carried out in duplicate (n=6). Student's t-test (P<0.05). *Significant difference vs control. A full colour version of this figure is available at http://dx.doi.org/10.1530/JOE-14-0008.

  • Effects of ovariectomy and E2 supplementation on adiponectin (A) and on Appl1 (C) mRNA and on ADIPOR1 protein levels (B) in white gastrocnemius muscle. Effects of sex hormone administration on adiponectin (D), AdipoR1 (D), and Appl1 (F) mRNA levels in L6E9 myotubes. OVX, ovariectomized rats; OVX+E2, ovariectomized rats treated with 17β-estradiol; C, control; E2, 17β-estradiol; Pg, progesterone; AdipoR1, adiponectin receptor 1; APPL1, adaptor protein containing PH domain, PTB domain, and leucine zipper motif 1. Protein levels are expressed in arbitrary units per mg of protein. α-tubulin was used as a loading control. For mRNA, GenEx software was used to analyze the Ct values normalized to 18S Ct. Values in (A), (B), and (C) are expressed as the mean±s.e.m. of six animals per group. Hormone effects were analyzed by one-way ANOVA (P<0.05): H indicates hormone effect. LSD was applied as a post hoc analysis of hormone effects (P<0.05): asignificant difference from control; bsignificant difference from OVX. In (D), (E), and (F) L6E9 cells were treated with either E2 (10 nM), Pg, or testosterone (1 μM both). Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments carried out in duplicate (n=6). Student's t-test (P<0.05). *Significant difference from control.

  • Amengual-Cladera E, Llado I, Gianotti M & Proenza AM 2012a Retroperitoneal white adipose tissue mitochondrial function and adiponectin expression in response to ovariectomy and 17β-estradiol replacement. Steroids 77 659665. (doi:10.1016/j.steroids.2012.02.012)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Amengual-Cladera E, Llado I, Gianotti M & Proenza AM 2012b Sex differences in the effect of high-fat diet feeding on rat white adipose tissue mitochondrial function and insulin sensitivity. Metabolism 61 11081117. (doi:10.1016/j.metabol.2011.12.016)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Amengual-Cladera E, Llado I, Proenza AM & Gianotti M 2012c High-fat diet feeding induces a depot-dependent response on the pro-inflammatory state and mitochondrial function of gonadal white adipose tissue. British Journal of Nutrition 109 413424. (doi:10.1016/j.metabol.2011.12.016)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Anderson EJ & Neufer PD 2006 Type II skeletal myofibers possess unique properties that potentiate mitochondrial H2O2 generation. American Journal of Physiology. Cell Physiology 290 C844C851. (doi:10.1152/ajpcell.00402.2005)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Attardi G & Schatz G 1988 Biogenesis of mitochondria. Annual Review of Cell Biology 4 289333. (doi:10.1146/annurev.cb.04.110188.001445)

  • Ayres S, Tang M & Subbiah MT 1996 Estradiol-17β as an antioxidant: some distinct features when compared with common fat-soluble antioxidants. Journal of Laboratory and Clinical Medicine 128 367375. (doi:10.1016/S0022-2143(96)80008-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Analytical Biochemistry 72 248254. (doi:10.1016/0003-2697(76)90527-3)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brand MD, Pamplona R, Portero-Otin M, Requena JR, Roebuck SJ, Buckingham JA, Clapham JC & Cadenas S 2002 Oxidative damage and phospholipid fatty acyl composition in skeletal muscle mitochondria from mice underexpressing or overexpressing uncoupling protein 3. Biochemical Journal 368 597603. (doi:10.1042/BJ20021077)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Burelle Y & Hochachka PW 2002 Endurance training induces muscle-specific changes in mitochondrial function in skinned muscle fibers. Journal of Applied Physiology 92 24292438. (doi:10.1152/japplphysiol.01024.2001)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Català-Niell A, Estrany ME, Proenza AM, Gianotti M & Llado I 2008 Skeletal muscle and liver oxidative metabolism in response to a voluntary isocaloric intake of a high fat diet in male and female rats. Cellular Physiology and Biochemistry 22 327336. (doi:10.1159/000149811)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cavalcanti-de-Albuquerque JP, Salvador ID, Martins EG, Jardim-Messeder D, Werneck de Castro JP, Galina A & de Carvalho DP 2014 Role of estrogen on skeletal muscle mitochondrial function in ovariectomized rats: a time course study in different fiber types. Journal of Applied Physiology 116 779789. (doi:10.1152/japplphysiol.00121.2013)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen H & Chan DC 2004 Mitochondrial dynamics in mammals. Current Topics in Developmental Biology 59 119144. (doi:10.1016/S0070-2153(04)59005-1)

  • Chen J, Li Y, Lavigne JA, Trush MA & Yager JD 1999 Increased mitochondrial superoxide production in rat liver mitochondria, rat hepatocytes, and HepG2 cells following ethinyl estradiol treatment. Toxicological Sciences 51 224235. (doi:10.1093/toxsci/51.2.224)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen JQ, Brown TR & Russo J 2009 Regulation of energy metabolism pathways by estrogens and estrogenic chemicals and potential implications in obesity associated with increased exposure to endocrine disruptors. Biochimica et Biophysica Acta 1793 11281143. (doi:10.1016/j.bbamcr.2009.03.009)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chrzanowska-Lightowlers ZM, Turnbull DM & Lightowlers RN 1993 A microtiter plate assay for cytochrome c oxidase in permeabilized whole cells. Analytical Biochemistry 214 4549. (doi:10.1006/abio.1993.1454)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Civitarese AE, Ukropcova B, Carling S, Hulver M, DeFronzo RA, Mandarino L, Ravussin E & Smith SR 2006 Role of adiponectin in human skeletal muscle bioenergetics. Cell Metabolism 4 7587. (doi:10.1016/j.cmet.2006.05.002)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Colom B, Alcolea MP, Valle A, Oliver J, Roca P & Garcia-Palmer FJ 2007a Skeletal muscle of female rats exhibit higher mitochondrial mass and oxidative-phosphorylative capacities compared to males. Cellular Physiology and Biochemistry 19 205212. (doi:10.1159/000099208)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Colom B, Oliver J, Roca P & Garcia-Palmer FJ 2007b Caloric restriction and gender modulate cardiac muscle mitochondrial H2O2 production and oxidative damage. Cardiovascular Research 74 456465. (doi:10.1016/j.cardiores.2007.02.001)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Deepa SS & Dong LQ 2009 APPL1: role in adiponectin signaling and beyond. American Journal of Physiology. Endocrinology and Metabolism 296 E22E36. (doi:10.1152/ajpendo.90731.2008)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dighe AS & Sluss PM 2004 Improved detection of serum estradiol after sample extraction procedure. Clinical Chemistry 50 764766. (doi:10.1373/clinchem.2003.029553)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ding G, Qin Q, He N, Francis-David SC, Hou J, Liu J, Ricks E & Yang Q 2007 Adiponectin and its receptors are expressed in adult ventricular cardiomyocytes and upregulated by activation of peroxisome proliferator-activated receptor γ. Journal of Molecular and Cellular Cardiology 43 7384. (doi:10.1016/j.yjmcc.2007.04.014)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gómez-Pérez Y, Amengual-Cladera E, Catala-Niell A, Thomas-Moya E, Gianotti M, Proenza AM & Llado I 2008 Gender dimorphism in high-fat-diet-induced insulin resistance in skeletal muscle of aged rats. Cellular Physiology and Biochemistry 22 539548. (doi:10.1159/000185538)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gómez-Pérez Y, Gianotti M, Proenza AM & Llado I 2011 Age-related decline of skeletal muscle insulin sensitivity in rats: effect of sex and muscle type. Rejuvenation Research 14 153161. (doi:10.1089/rej.2010.1107)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gómez-Pérez Y, Capllonch-Amer G, Gianotti M, Llado I & Proenza AM 2012 Long-term high-fat-diet feeding induces skeletal muscle mitochondrial biogenesis in rats in a sex-dependent and muscle-type specific manner. Nutrition and Metabolism 9 15. (doi:10.1186/1743-7075-9-15)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Guevara R, Santandreu FM, Valle A, Gianotti M, Oliver J & Roca P 2009 Sex-dependent differences in aged rat brain mitochondrial function and oxidative stress. Free Radical Biology & Medicine 46 169175. (doi:10.1016/j.freeradbiomed.2008.09.035)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Harwood HJ Jr 2012 The adipocyte as an endocrine organ in the regulation of metabolic homeostasis. Neuropharmacology 63 5775. (doi:10.1016/j.neuropharm.2011.12.010)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Iwabu M, Yamauchi T, Okada-Iwabu M, Sato K, Nakagawa T, Funata M, Yamaguchi M, Namiki S, Nakayama R & Tabata M et al. 2010 Adiponectin and AdipoR1 regulate PGC-1α and mitochondria by Ca2+ and AMPK/SIRT1. Nature 464 13131319. (doi:10.1038/nature08991)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jortay J, Senou M, Abou-Samra M, Noel L, Robert A, Many MC & Brichard SM 2012 Adiponectin and skeletal muscle: pathophysiological implications in metabolic stress. American Journal of Pathology 181 245256. (doi:10.1016/j.ajpath.2012.03.035)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Klinge CM 2008 Estrogenic control of mitochondrial function and biogenesis. Journal of Cellular Biochemistry 105 13421351. (doi:10.1002/jcb.21936)

  • Koh EH, Park JY, Park HS, Jeon MJ, Ryu JW, Kim M, Kim SY, Kim MS, Kim SW & Park IS et al. 2007 Essential role of mitochondrial function in adiponectin synthesis in adipocytes. Diabetes 56 29732981. (doi:10.2337/db07-0510)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Krause MP, Liu Y, Vu V, Chan L, Xu A, Riddell MC, Sweeney G & Hawke TJ 2008 Adiponectin is expressed by skeletal muscle fibers and influences muscle phenotype and function. American Journal of Physiology. Cell Physiology 295 C203C212. (doi:10.1152/ajpcell.00030.2008)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu Y, Chewchuk S, Lavigne C, Brule S, Pilon G, Houde V, Xu A, Marette A & Sweeney G 2009a Functional significance of skeletal muscle adiponectin production, changes in animal models of obesity and diabetes, and regulation by rosiglitazone treatment. American Journal of Physiology. Endocrinology and Metabolism 297 E657E664. (doi:10.1152/ajpendo.00186.2009)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu YH, Huang Y & Shao X 2009b Effects of estrogen on genioglossal muscle contractile properties and fiber-type distribution in chronic intermittent hypoxia rats. European Journal of Oral Sciences 117 685690. (doi:10.1111/j.1600-0722.2009.00681.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu YH, Jia SS & Hou YX 2009c Effects of ovariectomy on rat genioglossal muscle contractile properties and fiber-type distribution. Angle Orthodontist 79 509514. (doi:10.2319/031608-149.1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lombard DB, Alt FW, Cheng HL, Bunkenborg J, Streeper RS, Mostoslavsky R, Kim J, Yancopoulos G, Valenzuela D & Murphy A et al. 2007 Mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation. Molecular and Cellular Biology 27 88078814. (doi:10.1128/MCB.01636-07)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Macari C, Teyssier C, Tribollet V, Mouzat K, Forcet C, Horard B, Lobaccaro JM & Vanacker JM 2010 Estrogens repress PGC1-α expression in the uterus. Molecular and Cellular Endocrinology 330 3340. (doi:10.1016/j.mce.2010.08.003)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mattingly KA, Ivanova MM, Riggs KA, Wickramasinghe NS, Barch MJ & Klinge CM 2008 Estradiol stimulates transcription of nuclear respiratory factor-1 and increases mitochondrial biogenesis. Molecular Endocrinology 22 609622. (doi:10.1210/me.2007-0029)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mattson MP, Robinson N & Guo Q 1997 Estrogens stabilize mitochondrial function and protect neural cells against the pro-apoptotic action of mutant presenilin-1. Neuroreport 8 38173821. (doi:10.1097/00001756-199712010-00031)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moran AL, Warren GL & Lowe DA 2006 Removal of ovarian hormones from mature mice detrimentally affects muscle contractile function and myosin structural distribution. Journal of Applied Physiology 100 548559. (doi:10.1152/japplphysiol.01029.2005)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moran AL, Nelson SA, Landisch RM, Warren GL & Lowe DA 2007 Estradiol replacement reverses ovariectomy-induced muscle contractile and myosin dysfunction in mature female mice. Journal of Applied Physiology 102 13871393. (doi:10.1152/japplphysiol.01305.2006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moreira PI, Custodio JB, Nunes E, Oliveira PJ, Moreno A, Seica R, Oliveira CR & Santos MS 2011 Mitochondria from distinct tissues are differently affected by 17β-estradiol and tamoxifen. Journal of Steroid Biochemistry and Molecular Biology 123 816. (doi:10.1016/j.jsbmb.2010.09.004)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nadal-Casellas A, Proenza AM, Gianotti M & Lladó I 2011a Brown adipose tissue redox status in response to dietary-induced obesity-associated oxidative stress in male and female rats. Stress 14 174184. (doi:10.3109/10253890.2010.52468)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nadal-Casellas A, Proenza AM, Llado I & Gianotti M 2011b Effects of ovariectomy and 17-β estradiol replacement on rat brown adipose tissue mitochondrial function. Steroids 76 10511056. (doi:10.1016/j.steroids.2011.04.009)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nadal-Casellas A, Proenza AM, Llado I & Gianotti M 2012 Sex-dependent differences in rat hepatic lipid accumulation and insulin sensitivity in response to diet-induced obesity. Biochemistry and Cell Biology 90 164172. (doi:10.1139/o11-069)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nakano K, Tarashima M, Tachikawa E, Noda N, Nakayama T, Sasaki K, Mizoguchi E, Matsuzaki M & Osawa M 2005 Platelet mitochondrial evaluation during cytochrome c and dichloroacetate treatments of MELAS. Mitochondrion 5 426433. (doi:10.1016/j.mito.2005.10.002)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pantaleao TU, Mousovich F, Rosenthal D, Padron AS, Carvalho DP & da Costa VM 2010 Effect of serum estradiol and leptin levels on thyroid function, food intake and body weight gain in female Wistar rats. Steroids 75 638642. (doi:10.1016/j.steroids.2010.03.009)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Patel SA, Hoehn KL, Lawrence RT, Sawbridge L, Talbot NA, Tomsig JL, Turner N, Cooney GJ, Whitehead JP & Kraegen EW et al. 2012 Overexpression of the adiponectin receptor AdipoR1 in rat skeletal muscle amplifies local insulin sensitivity. Endocrinology 153 52315246. (doi:10.1210/en.2012-1368)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Picard M, Csukly K, Robillard ME, Godin R, Ascah A, Bourcier-Lucas C & Burelle Y 2008 Resistance to Ca2+-induced opening of the permeability transition pore differs in mitochondria from glycolytic and oxidative muscles. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 295 R659R668. (doi:10.1152/ajpregu.90357.2008)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Picard M, Hepple RT & Burelle Y 2012 Mitochondrial functional specialization in glycolytic and oxidative muscle fibers: tailoring the organelle for optimal function. American Journal of Physiology. Cell Physiology 302 C629C641. (doi:10.1152/ajpcell.00368.2011)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Puigserver P & Spiegelman BM 2003 Peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α): transcriptional coactivator and metabolic regulator. Endocrine Reviews 24 7890. (doi:10.1210/er.2002-0012)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Quick KL, Hardt JI & Dugan LL 2000 Rapid microplate assay for superoxide scavenging efficiency. Journal of Neuroscience Methods 97 139144. (doi:10.1016/S0165-0270(00)00179-5)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Riestra P, Garcia-Anguita A, Ortega L & Garces C 2013 Relationship of adiponectin with sex hormone levels in adolescents. Hormone Research in Paediatrics 79 8387. (doi:10.1159/000346898)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rodríguez-Cuenca S, Monjo M, Gianotti M, Proenza AM & Roca P 2007 Expression of mitochondrial biogenesis-signaling factors in brown adipocytes is influenced specifically by 17β-estradiol, testosterone, and progesterone. American Journal of Physiology. Endocrinology and Metabolism 292 E340E346. (doi:10.1152/ajpendo.00175.2006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Scarpulla RC 2011 Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochimica et Biophysica Acta 1813 12691278. (doi:10.1016/j.bbamcr.2010.09.019)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schwer B, Bunkenborg J, Verdin RO, Andersen JS & Verdin E 2006 Reversible lysine acetylation controls the activity of the mitochondrial enzyme acetyl-CoA synthetase 2. PNAS 103 1022410229. (doi:10.1073/pnas.0603968103)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Simpson ER 2003 Sources of estrogen and their importance. Journal of Steroid Biochemistry and Molecular Biology 86 225230. (doi:10.1016/S0960-0760(03)00360-1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Smith AD, Morris VC & Levander OA 2001 Rapid determination of glutathione peroxidase and thioredoxin reductase activities using a 96-well microplate format: comparison to standard cuvette-based assays. International Journal for Vitamin and Nutrition Research 71 8792. (doi:10.1024/0300-9831.71.1.87)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thomas PS & Farquhar MN 1978 Specific measurement of DNA in nuclei and nucleic acids using diaminobenzoic acid. Analytical Biochemistry 89 3544. (doi:10.1016/0003-2697(78)90724-8)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Uribe M, Zamora-Valdes D, Moreno-Portillo M, Bermejo-Martinez L, Pichardo-Bahena R, Baptista-Gonzalez HA, Ponciano-Rodriguez G, Uribe MH, Medina-Santillan R & Mendez-Sanchez N 2008 Hepatic expression of ghrelin and adiponectin and their receptors in patients with nonalcoholic fatty liver disease. Annals of Hepatology 7 6771.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Valle A, Garcia-Palmer FJ, Oliver J & Roca P 2007a Sex differences in brown adipose tissue thermogenic features during caloric restriction. Cellular Physiology and Biochemistry 19 195204. (doi:10.1159/000099207)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Valle A, Guevara R, Garcia-Palmer FJ, Roca P & Oliver J 2007b Sexual dimorphism in liver mitochondrial oxidative capacity is conserved under caloric restriction conditions. American Journal of Physiology. Cell Physiology 293 C1302C1308. (doi:10.1152/ajpcell.00203.2007)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ventura-Clapier R, Garnier A & Veksler V 2008 Transcriptional control of mitochondrial biogenesis: the central role of PGC-1α. Cardiovascular Research 79 208217. (doi:10.1093/cvr/cvn098)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vidal-Puig AJ, Grujic D, Zhang CY, Hagen T, Boss O, Ido Y, Szczepanik A, Wade J, Mootha V & Cortright R et al. 2000 Energy metabolism in uncoupling protein 3 gene knockout mice. Journal of Biological Chemistry 275 1625816266. (doi:10.1074/jbc.M910179199)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Viña J, Gambini J, Lopez-Grueso R, Abdelaziz KM, Jove M & Borras C 2011 Females live longer than males: role of oxidative stress. Current Pharmaceutical Design 17 39593965. (doi:10.2174/138161211798764942)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang CH, Wang CC, Huang HC & Wei YH 2013 Mitochondrial dysfunction leads to impairment of insulin sensitivity and adiponectin secretion in adipocytes. FEBS Journal 280 10391050. (doi:10.1111/febs.12096)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wildman RP, Wang D, Fernandez I, Mancuso P, Santoro N, Scherer PE & Sowers MR 2013 Associations of testosterone and sex hormone binding globulin with adipose tissue hormones in midlife women. Obesity 21 629636. (doi:10.1002/oby.20256)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B & Scarpulla RC et al. 1999 Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98 115124. (doi:10.1016/S0092-8674(00)80611-X)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yaffe D 1968 Retention of differentiation potentialities during prolonged cultivation of myogenic cells. PNAS 61 477483. (doi:10.1073/pnas.61.2.477)

  • Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K & Tsunoda M et al. 2003 Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423 762769. (doi:10.1038/nature01705)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhao H, Tian Z, Hao J & Chen B 2005 Extragonadal aromatization increases with time after ovariectomy in rats. Reproductive Biology and Endocrinology 3 6. (doi:10.1186/1477-7827-3-6)

    • PubMed
    • Search Google Scholar
    • Export Citation