Abstract
Intrauterine (IU) malnutrition could alter pancreatic development. In this study, we describe the effects of high-fat diet (HFD) during pregnancy on fetal growth and pancreatic morphology in an ‘at risk’ animal model of metabolic disease, the glucose transporter 4 (GLUT4) heterozygous mouse (G4+/−). WT female mice mated with G4+/− males were fed HFD or control diet (CD) for 2 weeks before mating and throughout pregnancy. At embryonic day 18.5, fetuses were killed and pancreata isolated for analysis of morphology and expression of genes involved in insulin (INS) cell development, proliferation, apoptosis, glucose transport and function. Compared with WT CD, WT HFD fetal pancreata had a 2.4-fold increase in the number of glucagon (GLU) cells (P=0.023). HFD also increased GLU cell size by 18% in WT pancreata compared with WT CD. Compared with WT CD, G4+/− CD had an increased number of INS cells and decreased INS and GLU cell size. Compared with G4+/− CD, G4+/− HFD fetuses had increased pancreatic gene expression of Igf2, a mitogen and inhibitor of apoptosis. The expression of genes involved in proliferation, apoptosis, glucose transport, and INS secretion was not altered in WT HFD compared with G4+/− HFD pancreata. In contrast to WT HFD pancreata, HFD exposure did not alter pancreatic islet morphology in fetuses with GLUT4 haploinsufficiency; this may be mediated in part by increased Igf2 expression. Thus, interactions between IU diet and fetal genetics may play a critical role in the developmental origins of health and disease.
Introduction
Metabolic syndrome (MetS) is a cluster of risk factors including obesity, dyslipidemia, insulin (INS) resistance, and hypertension. MetS increases the risk for type 2 diabetes mellitus (T2D), which is characterized by peripheral INS resistance and INS cell dysfunction (Grundy et al. 2004).
In Western Societies, fat and carbohydrate-dense foods have become increasingly abundant and easily accessible (Cordain et al. 2005), contributing to the increased prevalence of MetS in adults in the USA (Mozumdar & Liguori 2011). Increased globalization, associated with a nutritional transition toward Western diets, is thought to be a contributing factor to the increasing prevalence of obesity and T2D globally (Popkin 2006). In addition to poor diet and genetics, evidence indicates that an altered intrauterine (IU) environment plays a key role in the development of MetS (Vuguin et al. 2013), and that interactions between the IU environment and lifestyle can increase risk of MetS and T2D in people who are genetically susceptible (Hu 2011).
Poor nutrition during pregnancy affects fetal growth and development, particularly that of the endocrine pancreas (Snoeck et al. 1990, Vuguin et al. 2013). Specifically, alterations in the IU environment caused by a low-calorie, low-protein or a high-fat diet (HFD) affect the function of the endocrine pancreas by altering islet size, islet vascularization, number of INS cells, INS content, function, and parasympathetic innervation (Dahri et al. 1991, Garofano et al. 1997, Cerf et al. 2005, Ford et al. 2009, Ng et al. 2010, Rodriguez-Trejo et al. 2012, Vogt et al. 2014). In addition, it has been suggested that HFD during fetal development induces glucagon (GLU) cell hypertrophy and hyperplasia, resulting in an increase in GLU cell number and volume in the neonatal offspring (Cerf et al. 2005).
These findings could be partially explained by altered expression of growth factors, such as insulin-like growth factors (IGFs) and regulatory proteins involved in endocrine cell differentiation, such as the transcription factor pancreatic and duodenal homeobox 1 (PDX1; Park et al. 2008, Chen et al. 2012). Specifically, HFD exposure during development reduced Pdx1 immunoreactivity in a rodent model, indicating that Pdx1 is susceptible to IU environment (Cerf et al. 2009).
The IGF system, an important metabolic and mitogenic factor, is the major regulator of fetal growth and development. Igf2 mRNA is highly expressed in islet cells and some ductal epithelial cells in late fetal life (Hill et al. 1999) and co-localizes with INS cells and GLU cells in human fetal pancreas (Portela-Gomes & Hoog 2000). Igf2 is mitogenic for INS cells (Hill et al. 1999, Calderari et al. 2007) and inhibits apoptosis of INS cells (Hill et al. 1999, Raile et al. 2003, Cornu et al. 2009). Fetal expression of Igf2 has been shown to be increased by a HFD during gestation (Zhang et al. 2009), indicating that changes in Igf2 expression, in response to the altered IU environment, may play a role in the programming of the endocrine pancreas.
To develop T2D, pancreatic dysfunction has to be accompanied by a state of peripheral INS resistance. Peripheral INS resistance can be defined as a reduction in the ability of target tissues such as skeletal muscle, white adipose tissue, and heart to respond to INS. One response of INS resistance is a reduction in INS-stimulated glucose uptake, mediated via the glucose transporter 4 (GLUT4; Zierath et al. 1996, Bryant et al. 2002). In animal models, GLUT4 haploinsufficiency (G4+/−) results in peripheral INS resistance and T2D (Charron & Kahn 1990, Rossetti et al. 1997, Stenbit et al. 1997, Li et al. 2000). In addition, as G4+/− mice age, they develop islet cell hyperplasia due to an increase in INS cell number (Brissova et al. 2005).
Studies have demonstrated that GLUT4 mRNA and GLUT4 protein are expressed in the GLU cells and INS cells of mouse, rat, and human endocrine pancreas (Kobayashi et al. 2004, Bahr et al. 2012). GLUT4 expression in pancreatic endocrine cells seems to be regulated by glucose and INS (Bahr et al. 2012). Specifically, in GLU cells, high glucose levels decrease and high INS levels increase GLUT4 expression. In contrast, the opposite occurs in INS cells. In addition, pancreatic GLUT4 expression is elevated in T2D patients and decreased in animal models of T1D, indicating that alterations in GLUT4 expression in the endocrine pancreas may play a role in the regulation of pancreatic cell function during disease states (Bahr et al. 2012).
While effects of maternal nutrition on INS cell development and function have been extensively studied, very few studies have examined the effects of HFD during gestation on GLU cell development and function (Cerf et al. 2005). We have previously demonstrated that exposure to a HFD in utero and during lactation lead to the development of MetS in G4+/− and WT offspring (Hartil et al. 2009, Vuguin et al. 2013). Although both animal models developed features of metabolic disease, genotype-dependent differences were observed. Specifically, WT fetuses exposed to a HFD in utero have significantly higher glucose levels compared with similarly exposed G4+/− fetuses. We propose the hypothesis that GLUT4 haploinsufficiency protects the pancreatic endocrine cell function from the effects of HFD, thus protecting the G4+/− fetus from becoming hyperglycemic.
The animal model used in this study provides a unique opportunity to study the influence of genotype and diet on fetal pancreatic islet development (Vuguin et al. 2013). The results of this study indicate that the interaction between a HFD and a genotype during gestation ‘programs’ the fetus for increased susceptibility to T2D in part by altering pancreatic islet cell composition leading to an impaired ability to optimize glucose homeostasis.
Materials and methods
The animal protocols were approved by the Institute for Animal Care and Use Committee at the Albert Einstein College of Medicine. As previously described (Hartil et al. 2009), age and body weight (BW)-matched female WT mice (CD1 background) were maintained on control PicoLab Mouse Diet #5058 (CD: 9% fat as soybean oil and animal fat, 20% protein, 53% carbohydrate, 3.59 kcal/g) or switched to high-fat Bio-Serv Product #F3282 (HFD: 35.5% fat as lard, 20% protein, 36.3% carbohydrate, 5.29 kcal/g) 2 weeks before mating and throughout pregnancy (IU). The females were bred with non-littermate G4+/− males. Pregnancy was determined by the detection of a copulatory plug and defined as embryonic day (e) 0.5. Pregnant mice were killed on e18.5.
Following dissection from the uterine horn a total of 196 fetuses were killed by immediate decapitation. Fifty-six fetuses were exposed to CD and 140 were exposed to HFD during gestation. This cohort was produced from a total of four WT females exposed to CD and 11 WT females exposed to HFD. The number of fetuses per litter and fetal weights were recorded while the animals were killed. The numbers of abnormal and dead pups were also noted. Genotyping and sex determination of fetuses were carried out as described previously (Hartil et al. 2009, Vuguin et al. 2013).
Tissue processing for immunostaining
These techniques have been previously described (Vuguin et al. 2006, Kedees et al. 2007). The fetuses were placed in ice-cold PBS and decapitated. The dorsal pancreas was removed by dissection and fixed overnight by immersion in a fixative solution of 4% paraformadehyde in 0.1 M phosphate buffer. The fixed tissues were infiltrated with 30% sucrose and mounted in an embedding matrix (Lipshaw Co., Pittsburgh, PA, USA). The cryosections (10–20 micron) were mounted onto the glass slides coated with a solution of 1% gelatin containing 0.05% chromium potassium sulfate.
Immunoflourescence
As previously described (Vuguin et al. 2006, Kedees et al. 2007), the sections were incubated sequentially in empirically derived optimal dilutions of control serum or primary antibody overnight at 4 °C and with a 1:200 dilution of the secondary antibody (in 0.01 M PBS). After completion of the staining procedure, the sections were covered with two to three drops of Vectashield solution (Vector Labs, Inc., Burlingame, CA, USA; Vuguin et al. 2006).
Source of antibodies
Guinea pig anti-bovine INS antibodies were purchased from Linco Research, Inc. (Eureka, MO, USA). Rabbit anti-human GLU antibodies were purchased from Calbiochem, Inc. (San Diego, CA, USA). Anti-rabbit GLUT2 sera was purchased from Chemicon, Inc. (Temecula, CA, USA). Rabbit antiserum to Pdx1 was a generous gift from C.V.E. Wright (Vanderbilt University, Nashville, TN, USA). Antibodies were used at the following dilutions: anti-INS, 1:400; anti-GLU, 1:4000; anti-Pdx1, 1:5000; and anti-GLUT2, 1:1000. Secondary antibodies: Alexafluor 488 anti-mouse, anti-rat, and anti-rabbit IgG; Alexafluor 594 anti-guinea pig, anti-rabbit, and anti-mouse IgG were purchased from Molecular Probes, Inc. (Eugene, OR, USA).
Confocal microscopy
Confocal images were obtained using a Radiance 2000 confocal microscope (Bio-Rad, Inc.) attached to a Zeiss Axioskop microscope (Carl Zeiss, Inc, Thornwood, NY, USA). Images of 540×540 pixels were obtained and processed using Adobe Photoshop 6.0 (Adobe Systems; Vuguin et al. 2006).
Morphometric analysis
The number of islets, size of individual endocrine cells, and cell number ratio for cells expressing INS and GLU were calculated as previously described (Vuguin et al. 2006, Kedees et al. 2007). Consecutive 10–20 μm sections were obtained from each pancreas (n=4–8/fetal genotype per diet from at least four litters per diet). Between 12 and 15 sections at 200–300 mm apart/pancreas per genotype per diet were examined. Cell counting and area measurements were made using the National Institute of Health Image J Software (http://rsb.info.nih.gov/ij/).
Definitions of parameters measured
Total endocrine area (μm2/mm2)
Total endocrine area was defined as the sum of INS- and GLU-expressing areas normalized to the total pancreatic area.
INS- and GLU-expressing areas (μm2)
INS- and GLU-expressing areas were calculated as the product of the cell number and the cell size for either INS- or GLU-expressing cells.
Total pancreatic area (mm2)
Total pancreatic area was determined by manually defining the perimeter of the exocrine and endocrine pancreatic tissues in each section examined.
Islet number (no. of islets/mm2)
Islet number was defined as aggregates of at least five INS- or GLU-expressing cells (Garofano et al. 2000). The islet numbers were normalized to total pancreatic area.
INS and GLU cell numbers (no. of cells/mm2)
The relative number of INS and GLU cells per islet was determined by the point sampling method and normalized to total pancreatic area in each section as previously described (Garofano et al. 2000). At least 5000 points were scored in 30 islets/genotype per diet.
INS:GLU cell ratio
INS:GLU cell ratio was determined by dividing the total number of INS-expressing cells by the total number of GLU-expressing cells.
INS and GLU cell size (μm2)
The area of individual INS- or GLU-expressing cells was determined by manually defining the perimeter of the cells immunostained by either INS or GLU. More than 50 cells/pancreas per genotype per diet from multiple litters were measured and averaged.
RNA isolation and quantitative real-time PCR analysis
Total RNA was prepared from fetal pancreata, liver (GLUT4 expression negative control), gastrocnemius, and adipose tissue (GLUT4 expression positive controls) (n=6–10 diet/genotype, n=4–8 litters) as previously described (Hartil et al. 2009, Vuguin et al. 2013). The RNA was checked for DNA contamination, using PCR with control primers as described previously (Ouhilal et al. 2012).
Quantitative real-time PCR was the method of choice to determine the expression of genes of interest (Ouhilal et al. 2012). Four commonly used housekeeping genes, ubiquitin, β-actin, hypoxanthine guanine ribotransferase, and cyclophilin B were used for normalization, as described previously (Ouhilal et al. 2012). For quantitative analysis, all samples were normalized to the genes described above using the ΔΔCT value method. Each sample was measured in triplicate to assess technical variability (Ouhilal et al. 2012).
Statistical analysis
Data are expressed as the mean±s.e.m. Statistical analyses were performed using JMP IN 5.1 Software (SAS Institute, Cary, NC, USA). ANOVA was used to test the difference between the means of two (t-test) or more groups. Significance was defined as P<0.05.
Results
Our previous studies revealed that maternal exposure to HFD decreased fetal BW at e18.5 and increased blood glucose levels without altering plasma INS levels (Hartil et al. 2009, Vuguin et al. 2013). Consistent with those results HFD IU decreased fetal growth by 10% independent of fetal genotype (Table 1). To determine whether HFD exposure affected pancreatic morphology or islet cell composition, we examined e18.5 WT and G4+/− pancreata. No significant differences were seen between the groups when analyzed based on fetal sex with regards to pancreatic morphology or gene expression.
Metabolic parameters and pancreatic morphology seen in WT and G4+/− fetuses exposed to either CD or HFD during development. Data is expressed as mean±s.e.m., n=5–19/genotype
| WT fetus | G4+/− fetus | |||
|---|---|---|---|---|
| CD | HFD | CD | HFD | |
| Body weight (g) | 1.32±0.019* | 1.18±0.015† | 1.34±0.017* | 1.17±0.019† |
| Total endocrine area (μm2/mm2) | 0.0104±0.001* | 0.0204±0.009† | 0.0124±0.001* | 0.0106±0.003* |
| Islet number (no. of islets/mm2) | 6.2±0.4* | 6.2±0.6* | 5.8±0.7* | 7.5±0.9* |
| GLU cell number (no. of cells/mm2) | 38±7* | 91±20† | 64±13*,† | 54±17*,† |
| INS cell number (no. of cells/mm2) | 88±10* | 110±20*,† | 153±15† | 123±37*,† |
| INS:GLU cell number | 2.6±0.3* | 1.3±0.2† | 2.5±0.2* | 2.3±0.2* |
| INS cell size (μm2) | 79±7* | 91±11* | 58±1† | 65±4*,† |
| GLU cell size (μm2) | 81±1* | 96±7† | 61±2‡ | 72±6*,†,‡ |
Values that do not share the same symbol are significantly different from each other, P<0.05.
Pancreatic morphology
Total endocrine area (the sum of INS- and GLU-expressing areas normalized to the total pancreatic area) was increased almost twofold in WT HFD fetal pancreata (Table 1) compared with those of WT CD (P=0.0015). In contrast, there was no significant difference in total endocrine area in G4+/− HFD compared with G4+/− CD fetal pancreata. Despite a twofold increase in total endocrine area in WT HFD fetal pancreata, HFD did not increase the number of islets (defined as aggregates of at least five INS- or GLU-expressing cells) in either genotype (Table 1). Islets, independent of the genotype and diet, comprised a mantle of GLU cells surrounded by a core of INS cells (Fig. 1A, B, C and D).
Photomicrographs of confocal images of representative islets from embryos at e18.5 immunostained for insulin (green; A, B, C and D) and glucagon (red; A, B, C and D), or insulin (red; E, F, G and H) and Pdx1 (green; E, F, G and H) cells in WT C (A and E), WT HFD (B and F), G4+/− CD (C and G), and G4+/− HFD fetusus (D and H). Pancreata from WT HFD (B) fetuses exhibit an increased number of GLU cells (red) as compared with WT CD (A), G4+/− CD (C), and G4+/− HFD (D) fetuses. HFD did not alter the expression or the localization of Pdx1 (green) in WT (E and F) or G4+/− (G and H) fetal pancreata compared with those of CD pancreata. Scale bar=40 μm.
Citation: Journal of Endocrinology 222, 2; 10.1530/JOE-14-0114
To determine whether the increase in total endocrine area in WT HFD pancreata was associated with an increase in the relative abundance or size of endocrine cells within the islets, the number and area of GLU- and INS-immunoreactive cells were quantified.
Morphometric analysis revealed that the mean number of GLU cells per pancreata was 2.4-fold higher in WT HFD than that in WT CD (P=0.023; Fig. 1A and B). In contrast, no change was observed in the mean number of GLU cells per pancreata between G4+/− CD and G4+/− HFD (Fig. 1C and D). Similarly, no change in the relative number of INS cells was observed when each genotype was compared with the same genotype on the alternative diet. However, the mean number of INS cells per pancreata was 1.7-fold higher in G4+/− CD than that in WT CD (P=0.007; Table 1 and Fig. 1C).
G4+/− HFD and G4+/− CD fetal pancreata had a significantly higher INS:GLU cell ratio when compared with WT HFD; however, this was not significantly different when compared with WT CD fetal pancreata (Table 1 and Fig. 1A, B, C and D).
Exposure to HFD did not affect INS cell size in WT or G4+/− fetal pancreas when compared with the fetuses exposed to CD. However, G4+/− CD pancreata had smaller INS cells compared with WT independent of the IU diet (P=0.03 vs WT HFD and P<0.002 vs WT CD) but were not significantly different when compared with G4+/− HFD (Table 1).
Exposure to HFD increased GLU cell size by 18% in both WT and G4+/− fetal pancreata, although this only reached statistical significance in WT HFD vs WT CD (P=0.03; Table 1). Interestingly, similar to reduced INS cell size, G4+/− CD had smaller GLU cells compared with WT independent of diet (P=0.0033 vs WT HFD and P<0.0001 vs WT CD; Table 1).
GLUT2 and Pdx1 localization
To determine whether IU HFD regulates factors involved in the regulation of INS cell development, differentiation, and function, we determined Pdx1 and GLUT2 localization in the islets of fetuses exposed to both diets. IU HFD did not alter the localization of Pdx1 in WT or G4+/− fetal pancreata compared with a CD (Fig. 1 E, F, G and H). Similarly, HFD did not alter the GLUT2 localization in WT or G4+/− fetuses (data not shown).
Gene expression
To determine whether IU HFD regulates factors involved in INS cell differentiation, proliferation, survival, apoptosis, and function, we determined mRNA expression of Pdx1, sex determining region Y-box 9 (Sox9), baculoviral IAP repeat containing 5 (Birc5–survivin), B-cell CLL/lymphoma 2 (Bcl2), and apoptosis-related cysteine peptidase (Casp3) (Table 2). HFD IU did not alter mRNA expression of Pdx1, Sox9, Birc5, Bcl2, and CasP3 in WT or G4+/− fetal pancreata compared with a CD.
Effect of IU HFD exposure on fetal pancreatic gene expression. Gene expression was determined for genes involved in cell differentiation, cell survival and apoptosis, glucose transport, cortisol receptor and cell function, and growth factors. The increase in mRNA (fold change) measured by quantitative real-time PCR for IU HFD compared with IU CD in WT and G4+/− fetal pancreata (n=6–10/genotype diet at e18.5) is given
| Gene name | Gene symbol | Gene sequence (forward and reverse) | WT IU HFD vs WT IU CD | G4+/− HFD vs G4+/− CD |
|---|---|---|---|---|
| Cell differentiation | ||||
| Pancreatic and duodenal homeobox 1 | Pdx1 | CGCGTCCAGCTCCCTTT | NS | NS |
| CCTGCCCACTGGCCTTT | ||||
| Sex determining region Y (SRY)-box 9 | Sox9 | GTACCCGCATCTGCACAAC | NS | NS |
| CTCCTCCACGAAGGGTCTCT | ||||
| Cell survival and apoptosis | ||||
| Baculoviral IAP repeat containing 5 | Birc5–survivin | CCCGATGACAACCCGATA | NS | NS |
| CATCTGCTTCTTGACAGTGAGG | ||||
| B-cell CLL/lymphoma 2 | Bcl2 | AGTACCTGAACCGGCATCTG | NS | NS |
| GGGGCCATATAGTTCCACAAA | ||||
| Apoptosis-related cysteine peptidase | Casp3 | GAGGCTGACTTCCTGTATGCTT | NS | NS |
| AACCACGACCCGTCCTTT | ||||
| Cortisol receptor and cell function | ||||
| Nuclear receptor subfamily 3, group C, member 1 | Nr3c1 | TGGAGCTACAGTCAAGGTTTCT | NS | NS |
| GCTTGGAATCTGCCTGAGA | ||||
| ATP-binding cassette, sub-family C, member 8–sulfonylurea receptor subunit | Sur1 | GACGGCTGGGCAGATCTG | NS | NS |
| GAGGTTTGGGCATAAGAAGAAAAA | ||||
| Potassium inwardly rectifying channel, subfamily J, member 86.1 | KcnJ8; Kir6.1 | AGCCGCCATGCTGTGATT | NS | NS |
| CCCACCCGGAACATGAAG | ||||
| Glucose transport | ||||
| Solute carrier family 2 (facilitated glucose transporter), member 4 | Glut4 | CTGCAAAGCGTAGGTACCAA | ND | ND |
| CCTCCCGCCCTTAGTTG | ||||
| Solute carrier family 2 (facilitated glucose transporter), member 2 | Glut2 | TTGACTGGAGCCCTCTTGATG | NS | NS |
| CACTTCGTCCAGCAATGATGA | ||||
| Growth factors | ||||
| Insulin-like growth factor 1 | Igf1 | AACAAGCCCACAGGCTATGG | NS | NS |
| AAGCAACACTCATCCACAATGC | ||||
| Insulin-like growth factor 2 | Igf2 | CATCGTCCCCTGATCGTGTT | NS | 5* |
| CACTGATGGTTGCTGGACATCT |
*P<0.001 for IU HFD versus IU CD. NS, non significant; ND, no detected.
To determine whether IU HFD regulates the expression of genes involved in INS secretion, pancreatic growth, and development we determined mRNA expression of the potassium inwardly rectifying channel (Kir6.1), sulfonylurea receptor (Sur1), glucocorticoid receptor (Nr3c1), and the IGFs, Igf1 and Igf2. HFD IU did not alter mRNA expression of Kir6.1, Sur1, Nr3c1, or Igf1 in the pancreas of WT and G4+/− fetuses.
HFD significantly increased the expression of Igf2 mRNA, a potent INS cell growth and anti-apoptotic factor, in G4+/− HFD pancreas compared with G4+/− CD. In contrast, no significant difference in Igf2 expression was observed in WT HFD fetal pancreata compared with WT CD. To determine whether IU HFD regulates the expression of genes involved in facilitated glucose transport in pancreatic islets, mRNA expression of the main facilitated GLUT expressed in pancreatic islets, GLUT2, was measured. In addition, GLUT4 mRNA expression was determined. HFD did not alter mRNA expression of GLUT2 in WT or G4+/− fetuses. GLUT4 mRNA expression was not detected in fetal pancreata at e18.5.
Discussion
Diabetes mellitus is a complex disease resulting from the interplay between genetics and the environment. It results from dysfunctional pancreatic INS cells that cannot compensate for the metabolic demands imposed by peripheral tissues such as skeletal muscle and adipose tissue. Owing to the role of both genetics and the IU environment, and the importance of the pancreas in the development of diabetes, we sought to determine the effect of a maternal HFD on pancreatic development in a mouse model genetically predisposed to develop the features of diabetes, the G4+/− mouse (Charron & Kahn 1990, Rossetti et al. 1997, Stenbit et al. 1997, Li et al. 2000).
Consistent with results from our previous studies, HFD exposure decreased fetal BW (Vuguin et al. 2013). Similar to a rat model of IU HFD that resulted in poor fetal growth, exposure to HFD during development was accompanied by an increase in GLU cell volume and number in WT, but not G4+/−, pancreata (Cerf et al. 2009).
HFD did not alter the islet morphology in G4+/− fetuses despite an increase in RNA expression of the mitogenic growth factor Igf2 when compared with CD. These data indicate that increased Igf2 could be a compensatory response to maintain normal islet morphology.
There were no discernible structural differences in the islets of fetuses exposed to HFD. INS cells were present at the core and GLU cells were present at the mantle, indicating normal regulation of islet formation. In contrast to other models of IU programing, IU HFD did not alter gene expression and or localization of the transcription factor, Pdx1, thought to be relevant for INS cell adaptation to an altered IU environment (Gesina et al. 2006, Chen et al. 2012, Rodriguez-Trejo et al. 2012). In addition, the expression of genes implicated in pancreatic growth (Igf1) or INS secretory capacity (Kir6.1 and Sur1) was not altered by maternal HFD.
In animal models, the most profound changes in islet cell morphology seen in response to IU HFD were the number and the volume of INS cells, which were significantly reduced in neonatal rats (Cerf et al. 2009). In contrast, no detectable change in INS cell number was observed. These findings may represent differences in the species or differences in the INS cell adaptation to a different metabolic environment.
INS cell mass adapts to changes in metabolic homeostasis. These adaptations can occur through increases or decreases in INS cell number, through changes in proliferation, neogenesis, apoptosis, or cell size. INS cell number was not significantly altered by diet, but was increased 1.7-fold in G4+/− CD compared with WT CD fetuses. Based on gene expression at e18.5 data, we did not find evidence of increased proliferation and/ or apoptosis. Future studies done at earlier developmental stages may be necessary to confirm these findings.
INS cell size was significantly reduced in G4+/− CD fetuses compared with WT CD. Adaptations in INS cell size have been observed during pregnancy (Dhawan et al. 2007) and in response to persistent hyperinsulinemia (Anlauf et al. 2005). Larger INS cells containing more protein per cell are known to be highly glucose-responsive (Martens et al. 2010). Our finding that G4+/− CD fetuses exhibit smaller but more INS cells indicates an adaptation to the metabolic environment associated with GLUT4 haploinsufficiency.
HFD decreased the INS:GLU cell ratio in WT HFD fetuses. Further analysis revealed a significant increase in GLU cell number and size in WT HFD pancreata. When the cell number was multiplied by the individual cell surface area, to approximate the endocrine cell mass, an increase in the total endocrine area was observed.
The mechanism that leads to GLU cell hyperplasia in WT HFD fetal pancreas is not clear. GLU cell hyperplasia has been seen in models with impaired GLU synthesis/signaling (Vuguin et al. 2006), GLU receptor expression (Chen et al. 2011), and GLU action (Chen et al. 2005); inactivation of Pax4 (Sosa-Pineda et al. 1997); circulating low levels of INS (Rahier et al. 1983, Sosa-Pineda et al. 1997, Thyssen et al. 2006); mild hypoglycemia; and chronic HFD (Fiori et al. 2013). As circulating INS levels were normal and glucose levels were elevated in our HFD IU model, other factors must be responsible for the increase in GLU cell number (Jiang & Zhang 2003).
In addition to the GLU cell hyperplasia, WT fetuses exposed to a HFD displayed an increased GLU cell size that could lead to increased GLU levels (Huang et al. 2013). Increased GLU levels could explain the increase in expression of genes involved in gluconeogenesis and the increased glucose levels in the livers of WT HFD fetuses, which we previously reported (Vuguin et al. 2013). Unfortunately, we were not able to determine serum GLU levels. Accurate determination of fetal GLU serum levels usually requires pooling serum from several fetuses to collect at least 50–100 μl of serum per sample (www.biotrend.com/download/gl-32k.pdf). Because of the technical difficulties associated with the adequate determination of serum GLU levels, alterations in pancreatic morphology were assessed instead. Thus, further studies are needed to confirm the role of GLU in the GLU cell phenotype observed in WT fetal pancreata exposed to HFD.
Increased GLU cell number and cell size could also occur in response to lower glucose levels during fetal development with an IU HFD. Decreased glucose levels would signal the CNS to increase GLU cell number and secretion leading to GLU cell hyperplasia that may result in hyperglycemia (Brunicardi et al. 1995, Furuta et al. 1997). Alternatively, high-glucose levels and GLU cell hyperplasia could be the result of cell transformation of GLU-expressing cells into INS cells (Thorel et al. 2010). GLU cells are the earliest identifiable cells of the pancreatic endocrine lineage, capable of becoming INS-expressing cells (Gromada et al. 2007). It is possible that the GLU cells in our model are incapable of being transformed into INS cells. This seems unlikely, because a decrease in INS cell number or size, as seen in other models of GLU cell hyperplasia, is not a feature found in this model (Cerf et al. 2009).
Increased INS:GLU endocrine cell ratio was seen only in WT HFD fetal pancreas while increased Igf2 gene expression was seen in HFD G4+/− fetal pancreas which had normal islet architecture. It is possible that different signals regulate GLU cell number in islets of WT HFD and G4+/− mice.
GLUT4 has previously been found to be expressed at low levels in pancreatic GLU and INS cells of adult mouse, rat, and human endocrine pancreas (Kobayashi et al. 2004, Bahr et al. 2012) and its expression is regulated by glucose and INS levels (Bahr et al. 2012). Unfortunately, Glut4 mRNA expression was not detected in fetal pancreata at e18.5. Glut4 expression is turned on in brown adipose tissue, heart, and skeletal muscle toward the end of pregnancy (Santalucia et al. 1992). Its expression increases progressively after birth, and it has been found to be sensitive to alterations in maternal nutrient intake (Gardner et al. 2005, Thamotharan et al. 2005). Thus, the developmental timing of its expression in the pancreas could explain why we were not able to detect the presence of Glut4 mRNA.
The exact role of Igf2 expression in the fetal pancreas is unclear. In genetic models, decreased Igf2 expression in fetal pancreata led to lower INS cell proliferation rates and increased INS cell apoptosis (Kulkarni 2005). Overexpression of Igf2 in INS cells is associated with an increase in INS cell mass (Devedjian et al. 2000), while global overexpression of Igf2 causes islet GLU cell hyperplasia with an abnormal INS:GLU ratio (Petrik et al. 1999).
In one model, maternal under-nutrition decreased pancreatic Igf2 expression and was associated with increased INS cell mass (Martin et al. 2005). In contrast, another study demonstrated that maternal under-nutrition increased pancreatic Igf2 expression with no alteration in INS cell mass (de Miguel-Santos et al. 2010).
In rats, a high-carbohydrate diet during the neonatal period decreased Igf2 mRNA expression and GLU cell number (Petrik et al. 2001). Thus, the lack of consistency between studies makes it difficult to determine the precise role of Igf2 in the pancreatic phenotype and INS:GLU cell ratio. Some differences may be related to compensatory increases in Igf1 expression that could lead to increased INS cell mass (Martin et al. 2005). Igf1 expression was not different in our study. In addition, gene expression was determined in whole fetal pancreatic tissue and it may be that expression levels are regulated differently in response to genotype and/or HFD IU in different (pancreatic) islet cell types.
In conclusion, nature (genotype) modifies the effects of nurture (HFD) on fetal pancreatic development. We propose that changes in endocrine cell ratio in islets induced by IU nutritional and genetic manipulation may affect islet cell responsiveness to physiological or pathological stimuli. Further investigation is needed to confirm whether the IU adaptations that occur in WT HFD islets are maladaptive in later life and whether developing in a IU HFD milieu affects the capacity of GLU cells to respond to INS resistance with increasing age and/or progressive metabolic deterioration. In addition, it is not known whether the lack of GLU cell hyperplasia in G4+/− pancreata in response to HFD might be detrimental to development during times when glucose delivery is interrupted, such as during time of delivery. Understanding the molecular basis of an altered INS:GLU-expressing cell ratio is an attractive objective, particularly in light of new treatments that may directly act on these pathogenic mechanisms of T2D.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was supported by grants from the National Institute of Health DK47435 (M J C) and K08-HD042172 (P M V), R21 DK081194 (to M J C and P M V), and F31 DK093332 to (L W) and an American Diabetes Association (ADA) Mentor based postdoctoral fellowship (M J C). Additional support was generously provided by the Diabetes and Liver Research and Training and Cancer Centers of Albert Einstein College of Medicine.
Acknowledgements
The authors are grateful to Mr Carlos Vargas, Ms Amy Sorvino, and Ms Goutami Sayal for their technical expertise.
References
Anlauf M, Wieben D, Perren A, Sipos B, Komminoth P, Raffel A, Kruse ML, Fottner C, Knoefel WT & Monig H et al. 2005 Persistent hyperinsulinemic hypoglycemia in 15 adults with diffuse nesidioblastosis: diagnostic criteria, incidence, and characterization of β-cell changes. American Journal of Surgical Pathology 29 524–533. (doi:10.1097/01.pas.0000151617.14598.ae)
Bahr I, Bazwinsky-Wutschke I, Wolgast S, Hofmann K, Streck S, Muhlbauer E, Wedekind D & Peschke E 2012 GLUT4 in the endocrine pancreas – indicating an impact in pancreatic islet cell physiology? Hormone and Metabolic Research 44 442–450. (doi:10.1055/s-0032-1306335)
Brissova M, Blaha M, Spear C, Nicholson W, Radhika A, Shiota M, Charron MJ, Wright CV & Powers AC 2005 Reduced PDX-1 expression impairs islet response to insulin resistance and worsens glucose homeostasis. American Journal of Physiology. Endocrinology and Metabolism 288 E707–E714. (doi:10.1152/ajpendo.00252.2004)
Brunicardi FC, Shavelle DM & Andersen DK 1995 Neural regulation of the endocrine pancreas. International Journal of Pancreatology 18 177–195.
Bryant NJ, Govers R & James DE 2002 Regulated transport of the glucose transporter GLUT4. Nature Reviews. Molecular Cell Biology 3 267–277. (doi:10.1038/nrm782)
Calderari S, Gangnerau MN, Thibault M, Meile MJ, Kassis N, Alvarez C, Portha B & Serradas P 2007 Defective IGF2 and IGF1R protein production in embryonic pancreas precedes β cell mass anomaly in the Goto–Kakizaki rat model of type 2 diabetes. Diabetologia 50 1463–1471. (doi:10.1007/s00125-007-0676-2)
Cerf ME, Williams K, Nkomo XI, Muller CJ, Du Toit DF, Louw J & Wolfe-Coote SA 2005 Islet cell response in the neonatal rat after exposure to a high-fat diet during pregnancy. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 288 R1122–R1128. (doi:10.1152/ajpregu.00335.2004)
Cerf ME, Chapman CS, Muller CJ & Louw J 2009 Gestational high-fat programming impairs insulin release and reduces Pdx-1 and glucokinase immunoreactivity in neonatal Wistar rats. Metabolism 58 1787–1792. (doi:10.1016/j.metabol.2009.06.007)
Charron MJ & Kahn BB 1990 Divergent molecular mechanisms for insulin-resistant glucose transport in muscle and adipose cells in vivo. Journal of Biological Chemistry 265 7994–8000.
Chen M, Gavrilova O, Zhao WQ, Nguyen A, Lorenzo J, Shen L, Nackers L, Pack S, Jou W & Weinstein LS 2005 Increased glucose tolerance and reduced adiposity in the absence of fasting hypoglycemia in mice with liver-specific Gsα deficiency. Journal of Clinical Investigation 115 3217–3227. (doi:10.1172/JCI24196)
Chen M, Mema E, Kelleher J, Nemechek N, Berger A, Wang J, Xie T, Gavrilova O, Drucker DJ & Weinstein LS 2011 Absence of the glucagon-like peptide-1 receptor does not affect the metabolic phenotype of mice with liver-specific Gsα deficiency. Endocrinology 152 3343–3350. (doi:10.1210/en.2011-0012)
Chen X, Rozance PJ, Hay WW Jr & Limesand SW 2012 Insulin-like growth factor and fibroblast growth factor expression profiles in growth-restricted fetal sheep pancreas. Experimental Biology and Medicine 237 524–529. (doi:10.1258/ebm.2012.011375)
Cordain L, Eaton SB, Sebastian A, Mann N, Lindeberg S, Watkins BA, O'Keefe JH & Brand-Miller J 2005 Origins and evolution of the Western diet: health implications for the 21st century. American Journal of Clinical Nutrition 81 341–354.
Cornu M, Yang JY, Jaccard E, Poussin C, Widmann C & Thorens B 2009 Glucagon-like peptide-1 protects β-cells against apoptosis by increasing the activity of an IGF-2/IGF-1 receptor autocrine loop. Diabetes 58 1816–1825. (doi:10.2337/db09-0063)
Dahri S, Snoeck A, Reusens-Billen B, Remacle C & Hoet JJ 1991 Islet function in offspring of mothers on low-protein diet during gestation. Diabetes 40 (Suppl 2) 115–120. (doi:10.2337/diab.40.2.S115)
Devedjian JC, George M, Casellas A, Pujol A, Visa J, Pelegrin M, Gros L & Bosch F 2000 Transgenic mice overexpressing insulin-like growth factor-II in β cells develop type 2 diabetes. Journal of Clinical Investigation 105 731–740. (doi:10.1172/JCI5656)
Dhawan S, Georgia S & Bhushan A 2007 Formation and regeneration of the endocrine pancreas. Current Opinion in Cell Biology 19 634–645. (doi:10.1016/j.ceb.2007.09.015)
Fiori JL, Shin YK, Kim W, Krzysik-Walker SM, Gonzalez-Mariscal I, Carlson OD, Sanghvi M, Moaddel R, Farhang K & Gadkaree SK et al. 2013 Resveratrol prevents β-cell dedifferentiation in nonhuman primates given a high-fat/high-sugar diet. Diabetes 62 3500–3513. (doi:10.2337/db13-0266)
Ford SP, Zhang L, Zhu M, Miller MM, Smith DT, Hess BW, Moss GE, Nathanielsz PW & Nijland MJ 2009 Maternal obesity accelerates fetal pancreatic β-cell but not α-cell development in sheep: prenatal consequences. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 297 R835–R843. (doi:10.1152/ajpregu.00072.2009)
Furuta M, Yano H, Zhou A, Rouille Y, Holst JJ, Carroll R, Ravazzola M, Orci L, Furuta H & Steiner DF 1997 Defective prohormone processing and altered pancreatic islet morphology in mice lacking active SPC2. PNAS 94 6646–6651. (doi:10.1073/pnas.94.13.6646)
Gardner DS, Tingey K, Van Bon BW, Ozanne SE, Wilson V, Dandrea J, Keisler DH, Stephenson T & Symonds ME 2005 Programming of glucose–insulin metabolism in adult sheep after maternal undernutrition. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 289 R947–R954. (doi:10.1152/ajpregu.00120.2005)
Garofano A, Czernichow P & Breant B 1997 In utero undernutrition impairs rat β-cell development. Diabetologia 40 1231–1234. (doi:10.1007/s001250050812)
Garofano A, Czernichow P & Breant B 2000 Impaired β-cell regeneration in perinatally malnourished rats: a study with STZ. FASEB Journal 14 2611–2617. (doi:10.1096/fj.00-0015com)
Gesina E, Blondeau B, Milet A, Le Nin I, Duchene B, Czernichow P, Scharfmann R, Tronche F & Breant B 2006 Glucocorticoid signalling affects pancreatic development through both direct and indirect effects. Diabetologia 49 2939–2947. (doi:10.1007/s00125-006-0449-3)
Gromada J, Franklin I & Wollheim CB 2007 α-Cells of the endocrine pancreas: 35 years of research but the enigma remains. Endocrine Reviews 28 84–116. (doi:10.1210/er.2006-0007)
Grundy SM, Brewer HB Jr, Cleeman JI, Smith SC Jr & Lenfant C 2004 Definition of metabolic syndrome: Report of the National Heart, Lung, and Blood Institute/American Heart Association conference on scientific issues related to definition. Circulation 109 433–438. (doi:10.1161/01.CIR.0000111245.75752.C6)
Hartil K, Vuguin PM, Kruse M, Schmuel E, Fiallo A, Vargas C, Warner MJ, Durand JL, Jelicks LA & Charron MJ 2009 Maternal substrate utilization programs the development of the metabolic syndrome in male mice exposed to high fat in utero. Pediatric Research 66 368–373. (doi:10.1203/PDR.0b013e3181b33375)
Hill DJ, Hogg J, Petrik J, Arany E & Han VK 1999 Cellular distribution and ontogeny of insulin-like growth factors (IGFs) and IGF binding protein messenger RNAs and peptides in developing rat pancreas. Journal of Endocrinology 160 305–317. (doi:10.1677/joe.0.1600305)
Hu FB 2011 Globalization of diabetes: the role of diet, lifestyle, and genes. Diabetes Care 34 1249–1257. (doi:10.2337/dc11-0442)
Huang YC, Rupnik MS, Karimian N, Herrera PL, Gilon P, Feng ZP & Gaisano HY 2013 In situ electrophysiological examination of pancreatic α cells in the streptozotocin-induced diabetes model, revealing the cellular basis of glucagon hypersecretion. Diabetes 62 519–530. (doi:10.2337/db11-0786)
Jiang G & Zhang BB 2003 Glucagon and regulation of glucose metabolism. American Journal of Physiology. Endocrinology and Metabolism 284 E671–E678. (doi:10.1152/ajpendo.00492.2002)
Kedees MH, Guz Y, Vuguin PM, Vargas C, Cui L, Steiner DF, Charron MJ & Teitelman G 2007 Nestin expression in pancreatic endocrine and exocrine cells of mice lacking glucagon signaling. Developmental Dynamics 236 1126–1133. (doi:10.1002/dvdy.21112)
Kobayashi H, Mitsui T, Nomura S, Ohno Y, Kadomatsu K, Muramatsu T, Nagasaka T & Mizutani S 2004 Expression of glucose transporter 4 in the human pancreatic islet of Langerhans. Biochemical and Biophysical Research Communications 314 1121–1125. (doi:10.1016/j.bbrc.2004.01.010)
Kulkarni RN 2005 New insights into the roles of insulin/IGF-I in the development and maintenance of β-cell mass. Reviews in Endocrine & Metabolic Disorders 6 199–210. (doi:10.1007/s11154-005-3051-y)
Li J, Houseknecht KL, Stenbit AE, Katz EB & Charron MJ 2000 Reduced glucose uptake precedes insulin signaling defects in adipocytes from heterozygous GLUT4 knockout mice. FASEB Journal 14 1117–1125.
Martens GA, Jiang L, Verhaeghen K, Connolly JB, Geromanos SG, Stange G, Van Oudenhove L, Devreese B, Hellemans KH & Ling Z et al. 2010 Protein markers for insulin-producing β cells with higher glucose sensitivity. PLoS ONE 5 e14214. (doi:10.1371/journal.pone.0014214)
Martin MA, Serradas P, Ramos S, Fernandez E, Goya L, Gangnerau MN, Lacorne M, Pascual-Leone AM, Escriva F & Portha B et al. 2005 Protein-caloric food restriction affects insulin-like growth factor system in fetal Wistar rat. Endocrinology 146 1364–1371. (doi:10.1210/en.2004-0665)
de Miguel-Santos L, Fernandez-Millan E, Angeles Martin M, Escriva F & Alvarez C 2010 Maternal undernutrition increases pancreatic IGF-2 and partially suppresses the physiological wave of β-cell apoptosis during the neonatal period. Journal of Molecular Endocrinology 44 25–36. (doi:10.1677/JME-09-0045)
Mozumdar A & Liguori G 2011 Persistent increase of prevalence of metabolic syndrome among U.S. adults: NHANES III to NHANES 1999–2006. Diabetes Care 34 216–219. (doi:10.2337/dc10-0879)
Ng SF, Lin RC, Laybutt DR, Barres R, Owens JA & Morris MJ 2010 Chronic high-fat diet in fathers programs β-cell dysfunction in female rat offspring. Nature 467 963–966. (doi:10.1038/nature09491)
Ouhilal S, Vuguin P, Cui L, Du XQ, Gelling RW, Reznik SE, Russell R, Parlow AF, Karpovsky C & Santoro N et al. 2012 Hypoglycemia, hyperglucagonemia, and fetoplacental defects in glucagon receptor knockout mice: a role for glucagon action in pregnancy maintenance. American Journal of Physiology. Endocrinology and Metabolism 302 E522–E531. (doi:10.1152/ajpendo.00420.2011)
Park JH, Stoffers DA, Nicholls RD & Simmons RA 2008 Development of type 2 diabetes following intrauterine growth retardation in rats is associated with progressive epigenetic silencing of Pdx1. Journal of Clinical Investigation 118 2316–2324. (doi:10.1172/JCI33655)
Petrik J, Pell JM, Arany E, McDonald TJ, Dean WL, Reik W & Hill DJ 1999 Overexpression of insulin-like growth factor-II in transgenic mice is associated with pancreatic islet cell hyperplasia. Endocrinology 140 2353–2363. (doi:10.1210/endo.140.5.6732)
Petrik J, Srinivasan M, Aalinkeel R, Coukell S, Arany E, Patel MS & Hill DJ 2001 A long-term high-carbohydrate diet causes an altered ontogeny of pancreatic islets of Langerhans in the neonatal rat. Pediatric Research 49 84–92. (doi:10.1203/00006450-200101000-00019)
Popkin BM 2006 Global nutrition dynamics: the world is shifting rapidly toward a diet linked with noncommunicable diseases. American Journal of Clinical Nutrition 84 289–298.
Portela-Gomes GM & Hoog A 2000 Insulin-like growth factor II in human fetal pancreas and its co-localization with the major islet hormones: comparison with adult pancreas. Journal of Endocrinology 165 245–251. (doi:10.1677/joe.0.1650245)
Rahier J, Goebbels RM & Henquin JC 1983 Cellular composition of the human diabetic pancreas. Diabetologia 24 366–371. (doi:10.1007/BF00251826)
Raile K, Berthold A, Banning U, Horn F, Pfeiffer G & Kiess W 2003 IGFs, basic FGF, and glucose modulate proliferation and apoptosis induced by IFNγ but not by IL-1β in rat INS-1Eβ-cells. Hormone and Metabolic Research 35 407–414. (doi:10.1055/s-2003-41621)
Rodriguez-Trejo A, Ortiz-Lopez MG, Zambrano E, Granados-Silvestre Mde L, Mendez C, Blondeau B, Breant B, Nathanielsz PW & Menjivar M 2012 Developmental programming of neonatal pancreatic β-cells by a maternal low-protein diet in rats involves a switch from proliferation to differentiation. American Journal of Physiology. Endocrinology and Metabolism 302 E1431–E1439. (doi:10.1152/ajpendo.00619.2011)
Rossetti L, Stenbit AE, Chen W, Hu M, Barzilai N, Katz EB & Charron MJ 1997 Peripheral but not hepatic insulin resistance in mice with one disrupted allele of the glucose transporter type 4 (GLUT4) gene. Journal of Clinical Investigation 100 1831–1839. (doi:10.1172/JCI119711)
Santalucia T, Camps M, Castello A, Munoz P, Nuel A, Testar X, Palacin M & Zorzano A 1992 Developmental regulation of GLUT-1 (erythroid/Hep G2) and GLUT-4 (muscle/fat) glucose transporter expression in rat heart, skeletal muscle, and brown adipose tissue. Endocrinology 130 837–846. (doi:10.1210/endo.130.2.1370797)
Snoeck A, Remacle C, Reusens B & Hoet JJ 1990 Effect of a low protein diet during pregnancy on the fetal rat endocrine pancreas. Biology of the Neonate 57 107–118. (doi:10.1159/000243170)
Sosa-Pineda B, Chowdhury K, Torres M, Oliver G & Gruss P 1997 The Pax4 gene is essential for differentiation of insulin-producing β cells in the mammalian pancreas. Nature 386 399–402. (doi:10.1038/386399a0)
Stenbit AE, Tsao TS, Li J, Burcelin R, Geenen DL, Factor SM, Houseknecht K, Katz EB & Charron MJ 1997 GLUT4 heterozygous knockout mice develop muscle insulin resistance and diabetes. Nature Medicine 3 1096–1101. (doi:10.1038/nm1097-1096)
Thamotharan M, Shin BC, Suddirikku DT, Thamotharan S, Garg M & Devaskar SU 2005 GLUT4 expression and subcellular localization in the intrauterine growth-restricted adult rat female offspring. American Journal of Physiology. Endocrinology and Metabolism 288 E935–E947. (doi:10.1152/ajpendo.00342.2004)
Thorel F, Nepote V, Avril I, Kohno K, Desgraz R, Chera S & Herrera PL 2010 Conversion of adult pancreatic α-cells to β-cells after extreme β-cell loss. Nature 464 1149–1154. (doi:10.1038/nature08894)
Thyssen S, Arany E & Hill DJ 2006 Ontogeny of regeneration of β-cells in the neonatal rat after treatment with streptozotocin. Endocrinology 147 2346–2356. (doi:10.1210/en.2005-0396)
Vogt MC, Paeger L, Hess S, Steculorum SM, Awazawa M, Hampel B, Neupert S, Nicholls HT, Mauer J & Hausen AC et al. 2014 Neonatal insulin action impairs hypothalamic neurocircuit formation in response to maternal high-fat feeding. Cell 156 495–509. (doi:10.1016/j.cell.2014.01.008)
Vuguin PM, Kedees MH, Cui L, Guz Y, Gelling RW, Nejathaim M, Charron MJ & Teitelman G 2006 Ablation of the glucagon receptor gene increases fetal lethality and produces alterations in islet development and maturation. Endocrinology 147 3995–4006. (doi:10.1210/en.2005-1410)
Vuguin PM, Hartil K, Kruse M, Kaur H, Lin CL, Fiallo A, Glenn AS, Patel A, Williams L & Seki Y et al. 2013 Shared effects of genetic and intrauterine and perinatal environment on the development of metabolic syndrome. PLoS ONE 8 e63021. (doi:10.1371/journal.pone.0063021)
Zhang J, Zhang F, Didelot X, Bruce KD, Cagampang FR, Vatish M, Hanson M, Lehnert H, Ceriello A & Byrne CD 2009 Maternal high fat diet during pregnancy and lactation alters hepatic expression of insulin like growth factor-2 and key microRNAs in the adult offspring. BMC Genomics 10 478. (doi:10.1186/1471-2164-10-478)
Zierath JR, He L, Guma A, Odegoard Wahlstrom E, Klip A & Wallberg-Henriksson H 1996 Insulin action on glucose transport and plasma membrane GLUT4 content in skeletal muscle from patients with NIDDM. Diabetologia 39 1180–1189. (doi:10.1007/BF02658504)
