Abstract
Pituitary adenylate cyclase-activating polypeptide (PACAP) is a widely distributed neuropeptide that acts as a neurotransmitter, neuromodulator, neurotropic factor, neuroprotectant, secretagogue, and neurohormone. Owing to its pleiotropic biological actions, knockout of Pacap (Adcyap1) has been shown to induce several abnormalities in mice such as impaired thermoregulation. However, the underlying physiological and molecular mechanisms remain unclear. A previous report has shown that cold-exposed Pacap null mice cannot supply appropriate levels of norepinephrine (NE) to brown adipocytes. Therefore, we hypothesized that exogenous NE would rescue the impaired thermogenic response of Pacap null mice during cold exposure. We compared the adaptive thermogenic capacity of Pacap−/− to Pacap+/+ mice in response to NE when housed at room temperature (24 °C) and after a 3.5-week cold exposure (4 °C). Biochemical parameters, expression of thermogenic genes, and morphological properties of brown adipose tissue (BAT) and white adipose tissue (WAT) were also characterized. Results showed that there was a significant effect of temperature, but no effect of genotype, on the resting metabolic rate in conscious, unrestrained mice. However, the normal cold-induced increase in the basal metabolic rate and NE-induced increase in thermogenesis were severely blunted in cold-exposed Pacap−/− mice. These changes were associated with altered substrate utilization, reduced β3-adrenergic receptor (β3-Ar (Adrb3)) and hormone-sensitive lipase (Hsl (Lipe)) gene expression, and increased fibroblast growth factor 2 (Fgf2) gene expression in BAT. Interestingly, Pacap−/− mice had depleted WAT depots, associated with upregulated uncoupling protein 1 expression in inguinal WATs. These results suggest that the impairment of adaptive thermogenesis in Pacap null mice cannot be rescued by exogenous NE perhaps in part due to decreased β3-Ar-mediated BAT activation.
Introduction
All mammals, including humans, are homeotherms – they maintain euthermia regardless of environmental temperature by hormonal and neuronal control of heat production and dissipation. This essential task is mainly performed by the adipose tissues (Cannon & Nedergaard 2004, Cypess et al. 2009, Ouellet et al. 2011) although skeletal muscle can also contribute to increasing heat production via shivering thermogenesis in mammals (Dubois-Ferrière and Chinet 1981). The adipose tissue pool in mammals is composed of at least two functionally different types of fat: white adipose tissue (WAT) and brown adipose tissue (BAT). WAT is the primary site of energy storage and releases hormones and cytokines that modulate whole-body metabolism (Richard & Picard 2011). BAT, on the other hand, contributes to overall energy expenditure in small mammals and neonates through the process of non-shivering, adaptive thermogenesis. In the last few years, several studies have reported the existence of a third type of adipose cell, the brown in white (‘brite’) or ‘beige’ adipocyte. As in canonical BAT, the recruitment of brite adipocytes or ‘browning’ of WATs is induced by thermogenic stimuli such as cold as well as by pharmacological treatments such as β-adrenergic agonists or thiazolidinediones (Ohno et al. 2012, Wu et al. 2012, Schulz & Tseng 2013). Brite adipocytes not only present gene expression signatures similar to those of canonical brown adipocytes (i.e. uncoupling protein 1 (Ucp1)) but also express unique genes such as Hoxc9, Tmem26, and Tbx1 (Waldén et al. 2012, Wu et al. 2012).
In rodents, BAT generates heat for two principal reasons: i) to protect against cold exposure and ii) to burn off excess calories in response to excess caloric intake (Lowell et al. 1993, Ghorbani et al. 1997, Guerra et al. 1998, Clapham & Arch 2011). The exceptional thermogenic capacity of BAT relies on its numerous, densely packed mitochondria containing the BAT-specific inner mitochondrial membrane protein UCP1. BAT is highly vascularized and richly innervated by postganglionic nerve terminals of the sympathetic nervous system (SNS; Baron et al. 2012, Vaughan et al. 2014). Thermoregulatory pathways are induced by chemical messengers of the SNS, the catecholamines (Thomas & Palmiter 1997); although circulating thyroid hormones (thyroxine (T4)) as well as bone morphogenetic protein 8B are also known to regulate or enhance obligatory thermogenesis by acting centrally to increase sympathetic output to BAT (Ricquier et al. 2000, López et al. 2010, Whittle et al. 2012). Over the past 7 years, a number of molecules including fibroblast growth factor 21 (FGF21) and brain natriuretic peptides (BNPs) have also been shown to activate thermogenic machinery in BAT, independent of adrenergic receptors (ARs) (Tseng et al. 2008, Hondares et al. 2010).
The hypothalamus responds to afferent signals from cutaneous and core thermoreceptors to detect cold and then activates adaptive thermogenesis contributing to the maintenance of body temperature (Perkins et al. 1981, Cannon & Nedergaard 2004). Cumulative evidence has shown various hypothalamic neuropeptides to be important regulators of BAT thermogenesis through the SNS (Bi & Li 2013, Zengin et al. 2013). The hypothalamic neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP) is known to regulate sympathetic nerve activity, yet its role in adaptive thermogenesis requires further characterization.
PACAP belongs to the secretin/glucagon/vasoactive intestinal (VIP) family (Miyata et al. 1989, Vaudry et al. 2009) and has been implicated in the regulation of energy homeostasis including both appetite and thermogenesis (Gray et al. 2001, Mounien et al. 2009, Inglott et al. 2011). Hypothalamic nuclei such as the arcuate nucleus, paraventricular nucleus, and ventromedial nucleus highly express PACAP (ADCYAP1) and PACAP receptors (Segal et al. 2010, Kohno & Yada 2012, Resch et al. 2013), suggesting that PACAP may be critical for the regulation of energy balance. Consistently, i.c.v. injection of PACAP decreased food intake and increased core body temperature in rodents (Mounien et al. 2009) with a concurrent increase in BAT UCP1 expression (Resch et al. 2013). In parallel, mice lacking PACAP showed decreased BAT thermogenic capacity and reduced sympathetic outflow to this organ (Gray et al. 2001, 2002). These studies are supported by the temperature-sensitive phenotype of Pacap null pups, which display reduced survival at a lower housing temperature (Gray et al. 2002); however, the underlying mechanisms by which Pacap null mice are cold intolerant remain unknown. A previous report (Gray et al. 2002) has shown that during cold exposure, adult Pacap null mice cannot supply appropriate levels of norepinephrine (NE) to BAT. NE released from sympathetic nerves innervating BAT binds β3-ARs increasing cAMP and hormone-sensitive lipase (HSL)-mediated lipolysis. Free fatty acids are oxidized in the mitochondria where UCP1 uncouples ATP production releasing oxidative energy as heat (Enerbäck et al. 1997, Lowell & Spiegelman 2000, Matthias et al. 2000, Cannon & Nedergaard 2004, Inokuma et al. 2006). Interestingly, due to the substantial demand for nutrients and oxygen by BAT during cold exposure (Golozoubova et al. 2004, Waldén et al. 2012), extensive angiogenesis occurs within BAT to provide sufficient blood supply (Xue et al. 2009). As PACAP is known as a non-classical regulator of angiogenesis (Castorina et al. 2010), the highly cold-sensitive phenotype of Pacap-deficient mice may be related to decreased vascularization in adipose tissues.
To determine the mechanism by which PACAP regulates thermogenesis, we hypothesized that administration of exogenous NE would rescue the impaired thermogenic response of Pacap null mice to cold exposure. We also hypothesized that reduced browning of WATs (as a consequence of inappropriate NE release) as well as diminished vascularization in BATs and WATs during chronic cold exposure would contribute to the impaired adaptive thermogenic response of Pacap-deficient mice.
Materials and methods
Animals
Cohorts of young–adult (8-week-old) Pacap−/− and Pacap+/+ male or female littermate mice were generated from the breeding colony at the University of Northern British Columbia. Mice used in this study are derived from the Pacap null line generated by Gray et al. (2001) and have been backcrossed by more than ten times onto a C57/BL6 background. Mice were housed at a density of two per cage with sterile corncob bedding and placed on a normal 12 h light:12 h darkness cycle (lights on 0700–1900 h). Throughout the experiment, animals had free access to water and standard rodent chow diet (LabDiet 5001, LabDiet, Inc., Brentwood, Leduc, AB, Canada; metabolizable energy=3.02 kcal/g). Measures of body weight (g) were taken weekly. Care and treatment of mice was in accordance with the guidelines of the Canadian Council on Animal Care, and protocols for the study were approved by the University of Northern British Columbia's Animal Care and Use Committee.
Experimental procedures
NE-induced thermogenesis in Pacap−/− mice
Pacap−/− and Pacap+/+ mice were paired and housed together according to age and gender. Resting and maximal metabolic rates (MMR) were measured in 8-week-old mice reared at 24 °C. These mice were then acclimated at 18 °C for 1 week before being housed at 4 °C for 3.5 weeks. After 3.5 weeks of housing at 4 °C, resting and MMR were measured again in the same mice.
Metabolic rates of mice were measured via oxygen consumption (ml O2/min) in an open circuit, indirect calorimeter (Oxymax machine, Columbus Instruments, Columbus, OH, USA). Body weights were not different between genotypes. A standard Oxymax housing chamber (2625 ml) was allowed to equilibrate for 20 min before the resting metabolic rate (RMR) was measured in conscious, unrestrained animals for 4–5 h at room temperature (24 °C). The RMR was defined as the mean oxygen consumption during the last 3 h of the experiment.
Basal metabolic rate (BMR) and MMR were measured in anesthetized mice (sodium pentobarbital, 60–65 mg/kg) in 10 s intervals, during the light phase of the cycle, before and after s.c. injection of NE (1 mg/kg) into interscapular BAT (iBAT). NE injection was administered via cannulae to avoid opening and disequilibrium of the chamber during NE administration (protocol adapted from Golozoubova et al. (2006) and Virtue & Vidal-Puig (2013)). During BMR and MMR measurements, a heating pad was placed under the smaller metabolic chamber (260 ml) to maintain the chamber at 30 °C. BMR was defined as the mean oxygen consumption 5 min before the NE injection; while MMR was the mean of the five highest oxygen consumption values after NE administration. Additionally, the relative exchange ratio or RER, which is the ratio of CO2 produced to O2 consumed, was calculated.
Molecular mechanisms of impaired adaptive thermogenesis in Pacap-deficient mice following cold exposure
Molecular experiments were performed only on male mice, as estrous cycle patterns and sexual hormones in female rodents are known to impact thermoregulatory responses (Bu & Lephart 2005, Uchida et al. 2010). This experiment was conducted in two independent batches of male Pacap−/− and Pacap+/+ mice. Within each genotype, 9-week-old mice were randomly assigned to four experimental groups: Pacap−/− and Pacap+/+ mice housed at 24 °C (Pacap−/−, 24 °C and Pacap+/+, 24 °C) and Pacap−/− and Pacap+/+ mice housed at 4 °C for 3.5 weeks after they have been acclimatized for 1 week at 18 °C (Pacap−/−, 4 °C and Pacap+/+, 4 °C) as described above.
Postmortem analysis
Mice (non-fasted) were killed with Euthanyl. Blood was taken by cardiac puncture, from which plasma was isolated and stored at −20 °C until analysis. The following tissues were collected and weighed: brain, liver, heart, spleen, lung, pancreas, iBAT, inguinal WAT (ingWAT), and gonadal WAT (gWAT). For each BAT and WAT depot, half was flash frozen in liquid nitrogen and stored at −80 °C for RNA extractions, and the other half was fixed in 10% formalin for histological analysis.
Extraction of RNA and generation of cDNA
iBAT (∼50 mg) was homogenized in TRIzol (Life Technologies) and RNA was extracted according to the manufacturer's protocol. DNA contamination was removed by treating iBAT RNA with TURBO DNase (Life Technologies) according to the manufacturer's protocol. RNA from ingWAT and gWAT was extracted using an RNeasy Kit (Qiagen), which included DNase treatment. Concentration and purity of RNA were assessed by spectrophotometry (Nanodrop ND-1000; Thermo Scientific, Rockford, IL, USA), while RNA integrity was assessed by visualizing intact 18S and 28S rRNA bands on native 1.5% agarose gel. RNA (500 ng) was reverse transcribed into cDNA (Superscript III; Invitrogen) according to the manufacturer's protocol.
Quantitative real-time PCR
Expression levels of thermogenic genes (Ucp1, Hsl (Lipe), β1-Ar (Adrb1), β2-Ar (Adrb2), β3-Ar (Adrb3), Fgf2, homeobox C9 (Hoxc9), and vascular endothelial growth factor A (Vegfa)) in each fat depot from mice housed at 24 and 4 °C were assessed using quantitative real-time PCR (qPCR) (Table 1). Reference gene stability across treatments and genotypes was assessed via geNorm experiments, and a maximum number of stable reference genes were used for each gene expression analysis. Fold change in thermogenic gene expression from 24 to 4 °C samples was calculated for each genotype.
List of the endogenous control (*) and target genes analyzed by qPCR in adipose depots. Primer and primer/probe sets for each gene were optimized using SYBR Green chemistry or TaqMan respectively
| Genes | Gene abbreviation | Primer sequences (5′–3′) |
|---|---|---|
| 18S rRNA | 18S* | F-CGGCTACCACATCCAAGGAA |
| R-GCTGGAATTACCGCGGCT | ||
| Glyceraldehyde 3-phosphate dehydrogenase | Gapdh* | F-TGCACCACCAACTGCTTAG |
| R-GGATGCAGGGATGATGTTC | ||
| β-actin | β-actin* | F-GCTCTGGCTCCTAGCACCAT |
| R-GCCACCGATCCACACAGAGT | ||
| TATA-binding protein | Tbp* | F-CACCAATGACTCCTATGA |
| R-CCAAGATTCACGGTAGATA | ||
| P-/5FAM/CCTATCACTCCTGCCACACCA/31ABkFQ/ | ||
| Ribosomal protein L19 | Rpl19* | F-GAAGCTGATCAAGGATGG |
| R-CTTCCCTATGCCCATATG | ||
| P-/56FAM/CATCCGCAAGCCTGTGACTG/31ABkFQ/ | ||
| β1-adrenergic receptor | β1-Ar | F-GTCGTCTCCTTCTACGTG |
| R-GCTGTCGATCTTCTTTACC | ||
| β2-adrenergic receptor | β2-Ar | F-GTTCGAGCGACTACAAAC |
| R-TAGGCCCATGACTAGATC | ||
| β3-adrenergic receptor | β3-Ar | F-CAACCCGGTCATCTACTG |
| R-ACCGTAGCTACACAGAAG | ||
| Hormone-sensitive lipase | Hsl | F-GGAGCACTACAAACGCAACGA |
| R-TCGGCCACCGGTAAAGAG | ||
| Uncoupling protein 1 | Ucp1 | F-CCTGGCAGATATCATCAC |
| R-TCACCTTGGATCTGAAGG | ||
| Fibroblast growth factor 2 | Fgf2 | F-AACCGGTACCTTGCTATGAAG |
| R-GTTCGTTTCAGTGCCACATAC | ||
| Vascular endothelial growth factor A | Vegfa | F-AGACAGAACAAAGCCAGAAATCAC |
| R-CACGTCTGCGGATCTTGGAC | ||
| Homeobox C9 | Hoxc9 | F-GCAGCAAGCACAAAGAGGA |
| R-CGTCTGGTACTTGGTGTAGGG |
Primers and probes (IDT, Coralville, IA, USA) were either designed using the Beacon Designer Software (Premier Biosoft, Palo Alto, CA, USA) or taken from the literature (sequences available upon request). An iQ5 thermocycler (Bio-Rad Laboratories) was used to conduct 25 μl reactions, which contained forward and reverse primers (300 nM; Sigma), nuclease-free H2O, and 1/10 cDNA (3 μl). For genes utilizing SYBR Green chemistry, iQ SYBR Green Supermix (1×) was included, while those using the TaqMan method included iQ Supermix (1×) and probe (150 nM). Primers and probes were optimized before qPCR experiments, which conformed to the Minimum Information for Publication of Quantitative Real-time PCR Experiments (MIQEs) guidelines (Bustin et al. 2009).
Morphometric analysis
Formalin-fixed iBAT, ingWAT, and gWAT from Pacap−/− (n=5) and Pacap+/+ (n=6) mice were sent to Wax-it Histology Services (Vancouver, BC, Canada) for paraffin embedding, slide fixation (5 μm thick), and hematoxylin and eosin staining.
Ten representative micrographs at 60× magnification were taken (Olympus BX61) per hematoxylin and eosin-stained iBAT slide. Using the CellSens Software (Olympus), bright-field images were converted into gray scale. An intensity threshold (gray channel: min=145 and max=256) was set that best represented lipid droplets (white area) in iBAT sections, and these areas were quantified. Theses areas were normalized to their respective image areas.
Immunohistochemistry
Sections of iBAT and ingWAT (paraffin, 5 μm thick; n=5/group, Wax-it Histological Services) were deparaffinized and rehydrated as described previously (Riedel 2010). Antigen retrieval was completed in Tris–EDTA buffer (pH 9) for 20 min at 95 °C. Sections were blocked with serum-free solution (DAKO, Burlington, ON, Canada) before being incubated at 4 °C overnight with a rabbit anti-CD31 primary antibody (1:100; ab28364; Abcam, Toronto, ON, Canada). Sections were then incubated for an hour with the Alexa Fluor 594 donkey anti-rabbit antibody (1:1000; A21207; Invitrogen) and fixed using VECTRASHIELD Hardset Mounting Medium with DAPI (Vector Labs, Burlington, ON, Canada). Samples were visualized using a fluorescent light microscope (Olympus BX61) and images for iBAT were analyzed using the CellSens Software (Olympus).
Vasculature was quantified in CD31-stained iBAT by taking nine representative micrographs at 20× magnification for each sample. An average proportion of CD31-positive area was quantified using the automatic threshold option in CellSens (Olympus).
Plasma biochemical analysis
Total plasma free fatty acid concentrations were measured using direct colorimetric enzymatic reactions (Cell Biolabs, Inc., San Diego, CA, USA). Plasma BNPs and T4 were measured using specific ELISA (Elabscience Biotechnology Co. Ltd, Beijing, China) kits for mice.
Statistical analysis
Results are expressed as mean±s.e.m. Two-way ANOVA to test interaction effects and one-way ANOVA for comparison of groups with post-hoc Tukey's test for pairwise comparison of means were performed. Differences in CD31 immunoreactivity, lipid droplet area, and gene expression data were deduced by t-tests. All tests and comparisons with P<0.05 were considered statistically significant using the GraphPad Prism Software (version 5.0a) or IBM SPSS Statistics Software, version 21.
Results
RMR was not altered in conscious Pacap−/− mice
To test the hypothesis that hypothalamic neuropeptides are implicated in energy homeostasis (Zengin et al. 2013), we evaluated the role of PACAP in cold-stimulated RMR. In both sexes, there was a significant effect of temperature on RMR, but no genotype effect (Fig. 1). ANOVA showed that both Pacap−/− and Pacap+/+ mice housed at 4 °C displayed higher O2 consumption compared with animals housed at 24 °C (P<0.001). At both 24 and 4 °C, O2 consumption did not differ significantly between Pacap−/− and Pacap+/+ mice, indicating no effect of genotype on RMR in conscious, unrestrained mice (Fig. 1).
Resting metabolic rate (RMR) in conscious, unrestrained Pacap+/+ (females, n=10 and males, n=8) and Pacap−/− (females, n=8 and males, n=6) mice housed at 24 and 4 °C. Data are expressed as mean±s.e.m. *P<0.05 indicates a temperature effect (24 vs 4 °C).
Citation: Journal of Endocrinology 222, 3; 10.1530/JOE-14-0316
Impaired NE-induced thermogenesis in mice lacking PACAP
Thermogenic activity of BAT in response to cold is regulated by the SNS; thus, differences in NE release or β-adrenergic signaling could contribute to impaired adaptive thermogenesis. To determine whether the impaired thermogenesis of Pacap−/− mice was due to inadequate NE supply to iBAT, we assessed metabolic rates before (BMR) and after (MMR) administration of exogenous NE to iBAT of Pacap−/− and Pacap+/+ mice housed at 24 °C and after cold acclimation (3.5 weeks housing at 4 °C). As shown in Fig. 2, in both sexes, the normal, expected cold-induced increase in BMR is impaired in Pacap−/− mice, as we observed no significant difference in BMR of Pacap−/− mice housed at 24 and 4 °C. However, in Pacap+/+ mice, BMR was significantly increased in mice housed at 4 °C compared with those housed at 24 °C for both sexes (Fig. 2; upper and lower panels).
Basal metabolic rate (BMR) and norepinephrine-induced maximal metabolic rate (MMR) under anesthesia in Pacap+/+ (females, n=8 and males, n=7) and Pacap−/− (females, n=5 and males, n=3) mice housed at 24 and 4 °C. Data are expressed as mean±s.e.m. *P<0.05 and **P<0.01 indicate a temperature effect (24 vs 4 °C within the same genotype).
Citation: Journal of Endocrinology 222, 3; 10.1530/JOE-14-0316
NE-induced thermogenesis was severely blunted in Pacap−/− mice after a 3.5-week cold challenge at 4 °C. In both male and female Pacap+/+ cold-exposed mice, NE injection induced a significant increase in O2 consumption, while in Pacap−/− mice NE administration had no significant effect on O2 consumption (Fig. 3). These findings suggest that exogenous NE cannot rescue the impaired thermogenesis observed in Pacap−/− mice. Additionally, measurement of the RER, an index of what macronutrient is preferentially metabolized to produce energy, revealed that, in both sexes of Pacap−/− mice housed at 4 °C, NE injection induced a significant increase in RER values (from 0.7 to 0.9), indicating preferential oxidation of carbohydrates over lipids as fuels after NE injection (Fig. 4). The Pacap+/+ mice (housed at both 24 and 4 °C) and Pacap−/− mice housed at 24 °C maintained constant RER values after NE injection (Fig. 4).
Norepinephrine-induced thermogenesis in Pacap+/+ (females, n=8 and males, n=4) and Pacap−/− (females, n=5 and males, n=2) mice housed at 24 and 4 °C. Data are expressed as mean±s.e.m. *P<0.05 and **P<0.01 indicate a temperature effect (24 vs 4 °C within the same genotype).
Citation: Journal of Endocrinology 222, 3; 10.1530/JOE-14-0316
Relative exchange ratio (RER) at 24 °C and after 3.5 weeks of cold exposure (4 °C) in Pacap+/+ (females, n=8 and males, n=4) and Pacap−/− (females, n=5 and males, n=2) mice. Data are expressed as mean±s.e.m. *P<0.05 indicates a temperature effect (24 vs 4 °C within the same genotype).
Citation: Journal of Endocrinology 222, 3; 10.1530/JOE-14-0316
Cold exposure did not induce changes in body weight or fat histology but significantly reduced s.c. and intra-abdominal WAT depots in mice lacking PACAP
Body composition was assessed in Pacap−/− and Pacap+/+ male mice after 3.5 weeks of cold exposure. There were no significant differences in body weight, and iBAT, pancreas, and liver weights between the two genotypes. However, ingWAT and gWAT depots were significantly lower in cold-exposed Pacap−/− mice compared with Pacap+/+ mice (P<0.05; Table 2).
Body composition and plasma circulating factors of male Pacap+/+ (n=9) and Pacap−/− (n=8) mice after 3.5-week cold challenge. Data are expressed as mean±s.e.m.
| Pacap+/+ | Pacap−/− | |
|---|---|---|
| Body weight (g) | 26.86±0.68 | 26.93±0.59 |
| iBAT (g) | 0.10±0.01 | 0.09±0.001 |
| ingWAT (g) | 0.21±0.02 | 0.16±0.01* |
| gWAT (g) | 0.21±0.02 | 0.12±0.02* |
| Liver (g) | 1.66±0.08 | 1.60±0.05 |
| Pancreas (g) | 0.38±0.04 | 0.35±0.03 |
| Glucose (mmol/l) | 10.11±0.71 | 7.92±1.29 |
| Free fatty acids (μM/ml) | 154.34±32.12 | 222.15±55.73 |
| BNP (ng/ml) | 31.99±1.24 | 34.60±1.46 |
| T4 (ng/ml) | 1.91±0.33 | 1.83±0.28 |
*P<0.05 indicates a genotype effect (Pacap+/+ vs Pacap−/−).
Lipid content is unaltered in iBAT of cold-exposed Pacap−/− mice
To determine if impaired BAT thermogenesis was due to, or caused, alterations in lipid stores, intracellular lipid was quantified in BAT as described above. Lipid droplets appeared smaller and less prevalent in Pacap−/− BAT, but quantification yielded no statistical difference in lipid content between the genotypes (Fig. 5A). Such analyses could not be performed on ingWAT or gWAT due to heterogeneity of sections, although the morphology looked similar for both genotypes (Fig. 6).
Morphometric analysis of iBAT from Pacap+/+ (n=6) and Pacap−/− (n=5) mice following 3.5 weeks of cold exposure. (A) Hematoxylin and eosin-stained iBAT sections visualized at 60× magnification, along with their areal lipid proportions. (B) Visualization of vasculature in iBAT by fluorescence microscopy, along with vasculature quantification for both genotypes. *P<0.05 indicates a genotype effect (Pacap+/+ vs Pacap−/−).
Citation: Journal of Endocrinology 222, 3; 10.1530/JOE-14-0316
Representative images of hematoxylin and eosin-stained (A) gonadal (gWAT), 20× magnification and (B) inguinal ingWAT, 60× magnification, from Pacap+/+ (n=6) and Pacap−/− (n=5) mice following 3.5 weeks of cold exposure.
Citation: Journal of Endocrinology 222, 3; 10.1530/JOE-14-0316
Increased angiogenesis in iBAT of cold-exposed Pacap−/− mice
iBAT from cold-exposed Pacap−/− mice showed significantly increased immunoreactivity for the angiogenic marker, CD31, compared with iBAT from Pacap+/+ control mice (P<0.05; Fig. 5B). Visually, we did not detect a difference in CD31 immunoreactivity in Pacap−/− ingWAT sections compared with Pacap+/+ ingWAT sections (data not shown).
No change in circulating factors associated with thermoregulation in Pacap−/− mice
Assessment of a number of circulating factors in the plasma known to affect thermogenesis, such as free fatty acids, T4, and BNPs, showed no difference between the two genotypes after 3.5 weeks of cold exposure (Table 2).
Altered expression of thermogenic genes in cold-exposed Pacap−/− mice
To evaluate the contribution of PACAP to energy metabolism, we compared the mRNA levels of thermogenic genes in BATs and WATs of male Pacap−/− and Pacap+/+ mice. In iBAT (Fig. 7), Hsl and β3-Ar mRNA levels were significantly decreased in Pacap−/− mice compared with their Pacap+/+ littermates (P<0.05). Ucp1 mRNA expression did not differ between Pacap−/− mice and Pacap+/+ controls (P=0.11). VEGFA expression, a known angiogenic factor involved in blood vessel formation, did not differ between the two genotypes, but FGF2 expression in the iBAT, another potent angiogenic factor, was significantly higher in cold-exposed Pacap−/− mice compared with Pacap+/+ controls (P<0.05). In gWAT (Fig. 8, upper panel), UCP1 was significantly downregulated in Pacap−/− mice compared with Pacap+/+ mice (P<0.05), while β3-AR level was decreased by ∼42% although it did not reach statistical significance (P=0.056). Unlike what was found in gWAT and iBAT, cold exposure significantly increased UCP1 expression in the ingWAT depot (Fig. 8, lower panel) of the Pacap−/− mice compared with the Pacap+/+ mice (P<0.05). However, Pacap deletion had no significant effect on β3-Ar and Hsl expression in the ingWAT, as the two genotypes had similar expression levels after 3.5-week cold exposure. The Hoxc9 expression, one of the specific gene signatures of the ‘brite’ adipocytes, also did not differ between the two genotypes in the gWAT and ingWAT depots (Fig. 8, upper and lower panels).
Gene expression in iBAT of male Pacap+/+ (n=9) and Pacap−/− (n=8) mice after 3.5-week cold challenge. Target gene expression was normalized to three reference genes (18S (Rn18s), β-actin (Actb), and Gapdh). Data are expressed as mean±s.e.m. *P<0.05 indicates a genotype effect (Pacap+/+ vs Pacap−/−).
Citation: Journal of Endocrinology 222, 3; 10.1530/JOE-14-0316
Gene expression in gonadal white adipose tissue (gWAT) and inguinal white adipose tissue (ingWAT) of male Pacap+/+ (n=9) and Pacap−/− (n=8) mice after 3.5-week cold challenge. Target gene expression was normalized to three reference genes (18S (Rn18s), β-actin (Actb), and Gapdh). Data are expressed as mean±s.e.m. *P<0.05 indicates a genotype effect (Pacap+/+ vs Pacap−/−).
Citation: Journal of Endocrinology 222, 3; 10.1530/JOE-14-0316
Altered induction of thermogenic genes in Pacap−/− mice housed at 24 vs 4 °C
The fold change of thermogenic gene expression was assessed in iBAT, ingWAT, and gWAT isolated from mice housed at 24 °C and those housed at 4 °C for both genotypes. Upon cold stress, we observed significant upregulation of β3-AR in iBAT of Pacap+/+ mice housed at 4 °C compared with those housed at 24 °C, an induction that was not observed in Pacap−/− mice (Table 3). Additionally, there was a significant increase in UCP1 expression in all fat depots except gWAT, which had nearly undetectable levels of Ucp1 gene expression (Table 3). The fold increase in ingWAT UCP1 was much greater in Pacap−/− mice, corresponding to its higher expression at 4 °C in Pacap−/− mice compared with WT controls (Fig. 8 and Table 3). Hoxc9, a marker of ‘browning’, was also significantly upregulated in both WAT depots (Table 3).
Fold change in iBAT, ingWAT, and gWAT gene expression from 24 °C housed to 4 °C housed Pacap+/+ and Pacap−/− mice (Pacap+/+, 24 °C (n=5); Pacap−/−, 24 °C (n=5); Pacap+/+, 4 °C (n=9); and Pacap−/−, 4 °C (n=8)). mRNA expression data were normalized to reference genes that remained stable across treatments and genotypes for BAT (β-actin (Actb)), ingWAT (18S (Rn18s), β-actin, and Gapdh), and gWAT (Tbp and β-actin)
| Genes | iBAT | ingWAT | gWAT | |||
|---|---|---|---|---|---|---|
| Pacap+/+ | Pacap−/− | Pacap+/+ | Pacap−/− | Pacap+/+ | Pacap−/− | |
| β1-Ar | 0.95 | 1.02 | NA | NA | NA | NA |
| β2-Ar | 0.60 | 0.87 | NA | NA | NA | NA |
| β3-Ar | 3.34** | 1.43 | 1.53 | 0.70 | 0.22*** | 0.25* |
| Hsl | 1.57 | 1.38 | 1.07 | 0.68 | 0.19*** | 0.22* |
| Ucp1 | 2.83** | 2.37** | 169.65** | 755.54*** | 1.99 | 2.29 |
| Fgf2 | 6.48** | 6.31** | 0.54* | 0.29*** | 0.14*** | 0.15** |
| Vegfa | 1.63** | 1.45 | 0.88 | 0.66* | 0.35*** | 0.43* |
| Hoxc9 | NA | NA | 3.35*** | 2.16** | 3.68** | 5.04** |
Significant differences between mRNA expression in 24 and 4 °C samples for each genotype are denoted by *P<0.05, **P<0.0, or ***P<0.001. NA, gene not measured.
Discussion
Thermogenesis, an essential component of the homeostatic repertoire to maintain body temperature during cold exposure, is controlled by both endocrine and neural inputs (Cannon & Nedergaard 2004). Defects in any one of these neuroendocrine factors have been shown to have a negative impact on thermogenesis (Morrison et al. 2012). Centrally, hypothalamic orexigenic and anorexigenic neuropeptides have been demonstrated to exhibit a critical role in BAT thermogenesis and energy expenditure (Bi & Li 2013, Zengin et al. 2013) by controlling the sympathetic outflow to BAT. Our results show that the neuropeptide PACAP (Mounien et al. 2009) is an important regulator of adaptive thermogenesis during cold exposure. These results first demonstrated that deletion of Pacap had no significant effect on RMR of conscious, unstrained Pacap−/− mice housed at either 24 or 4 °C when compared with Pacap+/+ mice as evidenced by similar O2 consumption. This finding is at odds with previous reports demonstrating that administration of pharmacological PACAP (6–38), a PAC1 receptor antagonist, reduced energy expenditure (Tachibana et al. 2007, Inglott et al. 2011). Failure to detect a RMR difference between Pacap−/− and Pacap+/+ mice may relate to our experimental approach, which measured oxygen consumption in conscious, unrestrained mice that were housed below thermoneutrality (28–30 °C). While the low BAT thermogenic capacity of Pacap−/− mice would have predicted reduced RMR at 4 °C, a hyperactive phenotype has previously been reported in another line of Pacap−/− mice (Kawaguchi et al. 2010), and thus a subtle increase in physical activity may maintain a normal RMR in Pacap−/− mice. During cold exposure, BAT contributes ∼65% of the total heat production in rodents (Foster & Frydman 1978) and, therefore, in mammals with normal BAT, skeletal muscle is generally not considered to be the principal tissue involved in adaptive thermogenesis (Colquhoun et al. 1990). However, when BAT is absent or functionally deficient, whole-animal responses to a cold challenge draw primarily on muscle oxidative capacity (Schaeffer et al. 2003).
To circumvent the influence of physical activity or muscle oxidative capacity on RMR, we then performed BMR measures in anesthetized (restrained) animals. Unlike the expected cold-induced increase in BMR observed in Pacap+/+ mice housed at 4 vs 24 °C, this response was blunted in Pacap−/− mice. This result suggests a potential defect in the activation of adaptive thermogenesis in the Pacap null animals and supports our idea that physical activity-induced energy production is compensating for defective BAT thermogenic activity in RMR measurements made in conscious, unrestrained Pacap−/− mice.
Impaired cold-induced thermogenesis in Pacap−/− mice has been previously shown to be associated with decreased NE in BAT (Gray et al. 2001). In the current study, we evaluated the adaptive thermogenic response of Pacap−/− mice to a bolus of exogenous NE before and after 3.5 weeks of cold exposure. Our results showed that the BAT of both Pacap−/− male and female mice was thermogenically inactive as NE-induced metabolic rate was not greater after cold exposure. Despite the dramatic impairment in NE-induced metabolic rate in Pacap−/− mice, the mass and histological appearance of BAT were normal when compared with BAT from Pacap+/+ mice. The lower thermogenic response in the Pacap−/− mice after NE injection could be related to the reduced WAT found in these mice after cold exposure as a similar thermogenic pattern has been previously reported in A-ZIP/F-1 lipodystrophic mice (Gavrilova et al. 2000).
Differential use of physiological fuels (carbohydrates, fat, and protein) is another strategy to adapt and survive during challenge of low environmental temperature (Doubt 1991, Schaeffer et al. 2003). Following 3.5 weeks of cold exposure (4 °C), RER increased from 0.7 to 0.9 in Pacap−/− mice, but not Pacap+/+ mice, after NE injection, indicating a preferential use of carbohydrates to produce energy by the Pacap null mice. This switch from fat to carbohydrate utilization in cold-exposed Pacap−/− mice could indicate the impairment of mechanisms of lipid mobilization from adipose tissue during cold exposure (Doubt 1991) or a physiological adaptation to withstand the high energy demands associated with NE infusion, as oxidation of carbohydrates produces more energy per mole of oxygen than fat oxidation (Virtue & Vidal-Puig 2013).
The capacity for NE-induced thermogenesis in BAT will be influenced by the level of β3-AR available for NE binding on brown adipocytes to regulate the expression and activity of HSL and UCP1 (Cannon & Nedergaard 2004). Gene expression data revealed a significant reduction in β3-Ar mRNA in Pacap−/− BAT compared with Pacap+/+ BAT isolated from cold-exposed mice. Comparison of expression levels of β3-Ar mRNA in mice housed at 24 vs 4 °C revealed that β3-Ar mRNA is not induced in the BAT of Pacap−/− mice in response to cold, unlike WT mice where it is induced significantly. The failure to observe increased O2 consumption after NE injection may be associated with an inability to upregulate β3-Ar mRNA in Pacap−/− BAT. The fundamental role of β3-AR in BAT thermogenic machinery is well substantiated (Tachibana et al. 2003, Ueta et al. 2012) and these results demonstrate for the first time that PACAP plays an important role in regulating the expression of β3-AR during cold exposure. PACAP deficiency has been previously shown to reduce endogenous levels of NE in BAT. The tonic suppression of NE in Pacap−/− BAT may suppress β3-AR expression in BAT, contributing to the impaired NE-induced metabolic rate in cold-exposed Pacap null mice. Subsequent studies either measuring the β3-AR protein levels from the BAT of the two genotypes after cold exposure or using β3-AR agonists to stimulate metabolic rate should be performed to support this finding.
Despite the lower β3-AR expression within the canonical BAT, the adult male Pacap−/− mice survived a 3.5-week period of cold exposure and were able to induce Ucp1 gene expression in BAT. This suggests that other mechanisms to activate the thermogenic machinery, independent of ARs, also exist. In addition to increased physical activity, this may include the recruitment of ‘brite’ adipocytes into WAT depots as evidenced by the higher induction of Ucp1 gene expression in ingWAT of Pacap−/− mice compared with Pacap+/+ animals. The disparate expression of thermogenic genes in iBAT and ingWAT depots of Pacap+/+ and Pacap−/− mice suggests that PACAP may differentially regulate the central innervation of these depots. Future studies using retrograde viral transneuronal tract tracers to label neuronal circuits that originate in the hypothalamus and terminate in brown and WAT depots will help to clarify as to how PACAP mediates these effects in different adipose tissue depots.
In addition to sympathetic innervation of brown fat, thermoregulation of BAT is made possible by extensive vascularization enabling rapid access of circulating metabolites to the brown adipocytes (Asano et al. 1999). As basic FGF (or FGF2) is shown to induce mitogenic activity in endothelial cells in vitro and angiogenesis in vivo (Montesano et al. 1986, Gualandris et al. 1996), it is quite likely that FGF2 is involved in the blood vessel formation associated with the cold-induced BAT growth. Our results showed that mRNA expression of Fgf2, as well as CD31 immunoreactivity, was higher in BAT of cold-exposed Pacap−/− mice compared with Pacap+/+ mice. This heightened angiogenic induction in BAT of Pacap−/− mice, despite their low thermogenic capacity, may indicate a physiological adaptive response that attempts to increase the supply of nutrients and oxygen to boost thermogenesis. This adaptation, along with the above-mentioned mechanisms might be an attempt to activate thermogenic machinery independent of ARs as a compensatory approach for survival during chronic cold exposure.
In conclusion, our data show for the first time that exogenous NE administration cannot rescue the impaired adaptive thermogenesis in Pacap−/− mice and the reduced induction of β3-AR expression in BAT in response to cold may contribute to the impaired sympathetic-induced adaptive thermogenesis in these mice. These results contribute to our understanding of the basic mechanisms regulating energy metabolism, demonstrating PACAP as an important neuroendocrine mediator of the sympathetic regulation of adaptive thermogenesis. The Pacap−/− mouse is thus a suitable model for further studies investigating the molecular and neuroendocrine mechanisms involved in thermoregulation.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was funded by a grant from the Natural Sciences and Engineering Research Council of Canada (NSERC) to Dr S L G.
Acknowledgements
The authors thank Lydia Troc, Dee Jones, and K-Lynn Hogh for their exceptional technical assistance and dedication to the care and maintenance of our PACAP null mouse colony.
References
Asano A, Kimura K & Saito M 1999 Cold-induced mRNA expression of angiogenic factors in rat brown adipose tissue. Journal of Veterinary Medical Science 61 403–409. (doi:10.1292/jvms.61.403)
Baron DM, Clerte M, Brouckaert P, Raher MJ, Flynn AW, Zhang H, Carter EA, Picard MH, Bloch KD & Buys ES et al. 2012 In vivo noninvasive characterization of brown adipose tissue blood flow by contrast ultrasound in mice. Circulation. Cardiovascular Imaging 5 652–659. (doi:10.1161/CIRCIMAGING.112.975607)
Bi S & Li L 2013 Browning of white adipose tissue: role of hypothalamic signaling. Annals of the New York Academy of Sciences 1302 30–34. (doi:10.1111/nyas.12258)
Bu LH & Lephart ED 2005 Effects of dietary phytoestrogens on core body temperature during the estrous cycle and pregnancy. Brain Research Bulletin 65 219–223. (doi:10.1016/j.brainresbull.2005.01.008)
Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW & Shipley GL et al. 2009 The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 55 611–622. (doi:10.1373/clinchem.2008.112797)
Cannon B & Nedergaard J 2004 Brown adipose tissue: function and physiological significance. Physiological Reviews 84 277–359. (doi:10.1152/physrev.00015.2003)
Castorina A, Giunta S, Mazzone V, Cardile V & D'Agata V 2010 Effects of PACAP and VIP on hyperglycemia-induced proliferation in murine microvascular endothelial cells. Peptides 31 2276–2283. (doi:10.1016/j.peptides.2010.08.013)
Clapham JC & Arch JR 2011 Targeting thermogenesis and related pathways in anti-obesity drug discovery. Pharmacology & Therapeutics 131 295–308. (doi:10.1016/j.pharmthera.2011.04.004)
Colquhoun EQ, Hettiarachchi M, Ye JM, Rattigan S & Clark MG 1990 Inhibition by vasodilators of noradrenaline and vasoconstrictor-mediated, but not skeletal muscle contraction-induced oxygen uptake in the perfused rat hindlimb; implications for non-shivering thermogenesis in muscle tissue. General Pharmacology 21 141–148.
Cypess AM, Lehman S, Williams G, Tal I, Rodman D, Goldfine AB, Kuo FC, Palmer EL, Tseng YH & Doria A et al. 2009 Identification and importance of brown adipose tissue in adult humans. New England Journal of Medicine 360 1509–1517. (doi:10.1056/NEJMoa0810780)
Doubt TJ 1991 Physiology of exercise in the cold. Sports Medicine 1 367–381. (doi:10.2165/00007256-199111060-00003)
Dubois-Ferrière R & Chinet AE 1981 Contribution of skeletal muscle to the regulatory non-shivering thermogenesis in small mammals. Pflügers Archiv: European Journal of Physiology 390 224–229. (doi:10.1007/BF00658266)
Enerbäck S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME & Kozak LP 1997 Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387 90–94. (doi:10.1038/387090a0)
Foster DO & Frydman ML 1978 Brown adipose tissue: the dominant site of nonshivering thermogenesis in the rat. Experientia. Supplementum 32 147–151.
Gavrilova O, Marcus-Samuels B & Reitman ML 2000 Lack of responses to a β3-adrenergic agonist in lipoatrophic A-ZIP/F-1 mice. Diabetes 49 1910–1916. (doi:10.2337/diabetes.49.11.1910)
Ghorbani M, Claus TH & Himms-Hagen J 1997 Hypertrophy of brown adipocytes in brown and white adipose tissues and reversal of diet-induced obesity in rats treated with a β3-adrenoceptor agonist. Biochemical Pharmacology 54 121–131. (doi:10.1016/S0006-2952(97)00162-7)
Golozoubova V, Gullberg H, Matthias A, Cannon B, Vennström B & Nedergaard J 2004 Depressed thermogenesis but competent brown adipose tissue recruitment in mice devoid of all hormone-binding thyroid hormone receptors. Molecular Endocrinology 18 384–401. (doi:10.1210/me.2003-0267)
Golozoubova V, Cannon B & Nedergaard J 2006 UCP1 is essential for adaptive adrenergic nonshivering thermogenesis. American Journal of Physiology. Endocrinology and Metabolism 291 E350–E357. (doi:10.1152/ajpendo.00387.2005)
Gray SL, Cummings KJ, Jirik FR & Sherwood NM 2001 Targeted disruption of the pituitary adenylate cyclase-activating polypeptide gene results in early postnatal death associated with dysfunction of lipid and carbohydrate metabolism. Molecular Endocrinology 15 1739–1747. (doi:10.1210/mend.15.10.0705)
Gray SL, Yamaguchi N, Vencová P & Sherwood NM 2002 Temperature-sensitive phenotype in mice lacking pituitary adenylate cyclase-activating polypeptide. Endocrinology 143 3946–3954. (doi:10.1210/en.2002-220401)
Gualandris A, Rusnati M, Belleri M, Nelli EE, Bastaki M, Molinari-Tosatti MP, Bonardi F, Parolini S, Albini A & Morbidelli L et al. 1996 Basic fibroblast growth factor overexpression in endothelial cells: an autocrine mechanism for angiogenesis and angioproliferative diseases. Cell Growth & Differentiation 7 147–160.
Guerra C, Koza RA, Yamashita H, Walsh K & Kozak LP 1998 Emergence of brown adipocytes in white fat in mice is under genetic control. Effects on body weight and adiposity. Journal of Clinical Investigation 102 412–420. (doi:10.1172/JCI3155)
Hondares E, Rosell M, Gonzalez FJ, Giralt M, Iglesias R & Villarroya F 2010 Hepatic FGF21 expression is induced at birth via PPARα in response to milk intake and contributes to thermogenic activation of neonatal brown fat. Cell Metabolism 11 206–212. (doi:10.1016/j.cmet.2010.02.001)
Inglott MA, Farnham MM & Pilowsky PM 2011 Intrathecal PACAP-38 causes prolonged widespread sympathoexcitation via a spinally mediated mechanism and increases in basal metabolic rate in anesthetized rat. American Journal of Physiology. Heart and Circulatory Physiology 300 H2300–H2307.
Inokuma K, Okamatsu-Ogura Y, Omachi A, Matsushita Y, Kimura K, Yamashita H & Saito M 2006 Indispensable role of mitochondrial UCP1 for antiobesity effect of β3-adrenergic stimulation. American Journal of Physiology. Endocrinology and Metabolism 290 E1014–E1021. (doi:10.1152/ajpendo.00105.2005)
Kawaguchi C, Isojima Y, Shintani N, Hatanaka M, Guo X, Okumura N, Nagai K, Hashimoto H & Baba A 2010 PACAP-deficient mice exhibit light parameter-dependent abnormalities on nonvisual photoreception and early activity onset. PLoS ONE 5 e9286. (doi:10.1371/journal.pone.0009286)
Kohno D & Yada T 2012 Arcuate NPY neurons sense and integrate peripheral metabolic signals to control feeding. Neuropeptides 46 315–319. (doi:10.1016/j.npep.2012.09.004)
López M, Varela L, Vázquez MJ, Rodríguez-Cuenca S, González CR, Velagapudi VR, Morgan DA, Schoenmakers E, Agassandian K & Lage R et al. 2010 Hypothalamic AMPK and fatty acid metabolism mediate thyroid regulation of energy balance. Nature Medicine 16 1001–1008. (doi:10.1038/nm.2207)
Lowell BB & Spiegelman BM 2000 Towards a molecular understanding of adaptive thermogenesis. Nature 404 652–660.
Lowell BB, S-Susulic V, Hamann A, Lawitts JA, Himms-Hagen J, Boyer BB, Kozak LP & Flier JS 1993 Development of obesity in transgenic mice after genetic ablation of brown adipose tissue. Nature 366 740–742. (doi:10.1038/366740a0)
Matthias A, Ohlson KB, Fredriksson JM, Jacobsson A, Nedergaard J & Cannon B 2000 Thermogenic responses in brown fat cells are fully UCP1-dependent. UCP2 or UCP3 do not substitute for UCP1 in adrenergically or fatty acid-induced thermogenesis. Journal of Biological Chemistry 275 25073–25081. (doi:10.1074/jbc.M000547200)
Miyata A, Arimura A, Dahl RR, Minamino N, Uehara A, Jiang L, Culler MD & Coy DH 1989 Isolation of a novel 38 residue-hypothalamic polypeptide which stimulates adenylate cyclase in pituitary cells. Biochemical and Biophysical Research Communications 164 567–574. (doi:10.1016/0006-291X(89)91757-9)
Montesano R, Vassalli JD, Baird A, Guillemin R & Orci L 1986 Basic fibroblast growth factor induces angiogenesis in vitro. PNAS 83 7297–7301. (doi:10.1073/pnas.83.19.7297)
Morrison SF, Madden CJ & Tupone D 2012 Central control of brown adipose tissue thermogenesis. Frontiers in Endocrinology 3 pii: 00005. (doi:10.3389/fendo.2012.00005)
Mounien L, Do Rego JC, Bizet P, Boutelet I, Gourcerol G, Fournier A, Brabet P, Costentin J, Vaudry H & Jégou S 2009 Pituitary adenylate cyclase-activating polypeptide inhibits food intake in mice through activation of the hypothalamic melanocortin system. Neuropsychopharmacology 34 424–435. (doi:10.1038/npp.2008.73)
Ohno H, Shinoda K, Spiegelman BM & Kajimura S 2012 PPARγ agonists induce a white-to-brown fat conversion through stabilization of PRDM16 protein. Cell Metabolism 15 395–404. (doi:10.1016/j.cmet.2012.01.019)
Ouellet V, Routhier-Labadie A, Bellemare W, Lakhal-Chaieb L, Turcotte E, Carpentier AC & Richard D 2011 Outdoor temperature, age, sex, body mass index, and diabetic status determine the prevalence, mass, and glucose-uptake activity of 18F-FDG-detected BAT in humans. Journal of Clinical Endocrinology and Metabolism 96 192–199. (doi:10.1210/jc.2010-0989)
Perkins MN, Rothwell NJ, Stock MJ & Stone TW 1981 Activation of brown adipose tissue thermogenesis by the ventromedial hypothalamus. Nature 289 401–402. (doi:10.1038/289401a0)
Resch JM, Maunze B, Gerhardt AK, Magnuson SK, Phillips KA & Choi S 2013 Intrahypothalamic pituitary adenylate cyclase-activating polypeptide regulates energy balance via site-specific actions on feeding and metabolism. American Journal of Physiology. Endocrinology and Metabolism 305 E1452–E1463. (doi:10.1152/ajpendo.00293.2013)
Richard D & Picard F 2011 Brown fat biology and thermogenesis. Frontiers in Bioscience 16 1233–1260. (doi:10.2741/3786)
Ricquier D, Miroux B, Larose M, Cassard-Doulcier AM & Bouillaud F 2000 Endocrine regulation of uncoupling proteins and energy expenditure. International Journal of Obesity and Related Metabolic Disorders 24 S86–S88. (doi:10.1038/sj.ijo.0801286)
Riedel D 2010 Single molecule manipulation at low temperature and laser scanning tunnelling photo-induced processes analysis through time-resolved studies. Journal of Physics. Condensed Matter 22 264009. (doi:10.1088/0953-8984/22/26/264009)
Schaeffer PJ, Villarin JJ & Lindstedt SL 2003 Chronic cold exposure increases skeletal muscle oxidative structure and function in Monodelphis domestica, a marsupial lacking brown adipose tissue. Physiological and Biochemical Zoology 76 877–887. (doi:10.1086/378916)
Schulz TJ & Tseng YH 2013 Systemic control of brown fat thermogenesis: integration of peripheral and central signals. Annals of the New York Academy of Sciences 1302 35–41. (doi:10.1111/nyas.12277)
Segal JP, Stallings NR, Lee CE, Liping Z, Socci N, Viale A, Harris TM, Soares MB, Childs G & Elmquist JK et al. 2010 Use of laser-capture microdissection for the identification of marker genes for the ventromedial hypothalamic nucleus. Journal of Neuroscience 25 4181–4188. (doi:10.1523/JNEUROSCI.0158-05.2005)
Tachibana T, Takagi T, Saito ES, Tomonaga S, Zhang R, Koga Y, Kido Y, Michael Denbow D & Furuse M 2003 β3-Adrenergic receptor is involved in feeding regulation in chicks. Comparative Biochemistry and Physiology. Part A, Molecular & Integrative Physiology 135 403–409.
Tachibana T, Oikawa D, Adachi N, Boswell T & Furuse M 2007 Central administration of vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide differentially regulates energy metabolism in chicks. Comparative Biochemistry and Physiology. Part A, Molecular & Integrative Physiology 147 156–164.
Thomas SA & Palmiter RD 1997 Thermoregulatory and metabolic phenotypes of mice lacking noradrenaline and adrenaline. Nature 387 94–97. (doi:10.1038/387094a0)
Tseng YH, Kokkotou E, Schulz TJ, Huang TL, Winnay JN, Taniguchi CM, Tran TT, Suzuki R, Espinoza DO & Yamamoto Y et al. 2008 New role of bone morphogenetic protein 7 in brown adipogenesis and energy expenditure. Nature 454 1000–1004. (doi:10.1038/nature07221)
Uchida Y, Kano M, Yasuhara S, Kobayashi A, Tokizawa K & Nagashima K 2010 Estrogen modulates central and peripheral responses to cold in female rats. Journal of Physiological Sciences 60 151–160. (doi:10.1007/s12576-009-0079-x)
Ueta CB, Fernandes GW, Capelo LP, Fonseca TL, Maculan FD, Gouveia CH, Brum PC, Christoffolete MA, Aoki MS & Lancellotti CL et al. 2012 β(1) Adrenergic receptor is key to cold- and diet-induced thermogenesis in mice. Journal of Endocrinology 214 359–365. (doi:10.1530/JOE-12-0155)
Vaudry D, Falluel-Morel A, Bourgault S, Basille M, Burel D, Wurtz O, Fournier A, Chow BK, Hashimoto H & Galas L et al. 2009 Pituitary adenylate cyclase-activating polypeptide and its receptors: 20 years after the discovery. Pharmacological Reviews 61 283–357. (doi:10.1124/pr.109.001370)
Vaughan CH, Zarebidaki E, Ehlen JC & Bartness TJ 2014 Analysis and measurement of the sympathetic and sensory innervation of white and brown adipose tissue. Methods in Enzymology 537 199–225.
Virtue S & Vidal-Puig A 2013 Assessment of brown adipose tissue function. Frontiers in Physiology 4 128–156. (doi:10.3389/fphys.2013.00128)
Waldén TB, Hansen IR, Timmons JA, Cannon B & Nedergaard J 2012 Recruited vs. nonrecruited molecular signatures of brown, “brite”, and white adipose tissues. American Journal of Physiology. Endocrinology and Metabolism 302 E19–E31. (doi:10.1152/ajpendo.00249.2011)
Whittle AJ, Carobbio S, Martins L, Slawik M, Hondares E, Vázquez MJ, Morgan D, Csikasz RI, Gallego R & Rodriguez-Cuenca S et al. 2012 BMP8B increases brown adipose tissue thermogenesis through both central and peripheral actions. Cell 149 871–885. (doi:10.1016/j.cell.2012.02.066)
Wu J, Bostrom P, Sparks LM, Ye L, Choi JH, Giang AH, Khandekar M, Virtanen KA, Nuutila P & Schaart G et al. 2012 Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 150 366–376. (doi:10.1016/j.cell.2012.05.016)
Xue Y, Petrovic N, Cao R, Larsson O, Lim S, Chen S, Feldmann HM, Liang Z, Zhu Z & Nedergaard J et al. 2009 Hypoxia-independent angiogenesis in adipose tissues during cold acclimation. Cell Metabolism 9 99–109. (doi:10.1016/j.cmet.2008.11.009)
Zengin A, Nguyen AD, Wong IP, Zhang L, Enriquez RF, Eisman JA, Herzog H, Baldock PA & Sainsbury A 2013 Neuropeptide Y mediates the short-term hypometabolic effect of estrogen deficiency in mice. International Journal of Obesity 37 390–398. (doi:10.1038/ijo.2012.71)
(N Nikolic and A P Rudecki contributed equally to this work)
