Estetrol is a weak estrogen antagonizing estradiol-dependent mammary gland proliferation

in Journal of Endocrinology
Authors:
C Gérard Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by C Gérard in
Current site
Google Scholar
PubMed
Close
,
S Blacher Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by S Blacher in
Current site
Google Scholar
PubMed
Close
,
L Communal Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by L Communal in
Current site
Google Scholar
PubMed
Close
,
A Courtin Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by A Courtin in
Current site
Google Scholar
PubMed
Close
,
E Tskitishvili Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by E Tskitishvili in
Current site
Google Scholar
PubMed
Close
,
M Mestdagt Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by M Mestdagt in
Current site
Google Scholar
PubMed
Close
,
C Munaut Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by C Munaut in
Current site
Google Scholar
PubMed
Close
,
A Noel Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by A Noel in
Current site
Google Scholar
PubMed
Close
,
A Gompel Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium
Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by A Gompel in
Current site
Google Scholar
PubMed
Close
,
C Péqueux Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by C Péqueux in
Current site
Google Scholar
PubMed
Close
, and
J M Foidart Laboratory of Tumor and Development Biology, INSERM-UMRS 938, Gynaecological Endocrinology Unit, GIGA-Cancer, Institute of Pathology, University of Liège, CHU-B23, B-4000 Liège, Belgium

Search for other papers by J M Foidart in
Current site
Google Scholar
PubMed
Close

Free access

Sign up for journal news

Estetrol (E4) is a natural estrogen produced exclusively by the human fetal liver during pregnancy. Its physiological activity remains unknown. In contrast to ethinyl estradiol and estradiol (E2), E4 has a minimal impact on liver cell activity and could provide a better safety profile in contraception or hormone therapy. The aim of this study was to delineate if E4 exhibits an activity profile distinct from that of E2 on mammary gland. Compared with E2, E4 acted as a low-affinity estrogen in both human in vitro and murine in vivo models. E4 was 100 times less potent than E2 to stimulate the proliferation of human breast epithelial (HBE) cells and murine mammary gland in vitro and in vivo respectively. This effect was prevented by fulvestrant and tamoxifen, supporting the notion that ERα (ESR1) is the main mediator of the estrogenic effect of E4 on the breast. Interestingly, when E4 was administered along with E2, it significantly antagonized the strong stimulatory effect of E2 on HBE cell proliferation and on the growth of mammary ducts. This study characterizes for the first time the impact of E4 on mammary gland. Our results highlight that E4 is less potent than E2 and exhibits antagonistic properties toward the proliferative effect of E2 on breast epithelial cells. These data support E4 as a potential new estrogen for clinical use with a reduced impact on breast proliferation.

Abstract

Estetrol (E4) is a natural estrogen produced exclusively by the human fetal liver during pregnancy. Its physiological activity remains unknown. In contrast to ethinyl estradiol and estradiol (E2), E4 has a minimal impact on liver cell activity and could provide a better safety profile in contraception or hormone therapy. The aim of this study was to delineate if E4 exhibits an activity profile distinct from that of E2 on mammary gland. Compared with E2, E4 acted as a low-affinity estrogen in both human in vitro and murine in vivo models. E4 was 100 times less potent than E2 to stimulate the proliferation of human breast epithelial (HBE) cells and murine mammary gland in vitro and in vivo respectively. This effect was prevented by fulvestrant and tamoxifen, supporting the notion that ERα (ESR1) is the main mediator of the estrogenic effect of E4 on the breast. Interestingly, when E4 was administered along with E2, it significantly antagonized the strong stimulatory effect of E2 on HBE cell proliferation and on the growth of mammary ducts. This study characterizes for the first time the impact of E4 on mammary gland. Our results highlight that E4 is less potent than E2 and exhibits antagonistic properties toward the proliferative effect of E2 on breast epithelial cells. These data support E4 as a potential new estrogen for clinical use with a reduced impact on breast proliferation.

Introduction

17β-estradiol (E2) stimulates postnatal mammary gland development by driving and coordinating proliferation and differentiation through paracrine interactions (Anderson et al. 1998, Russo & Russo 1998, Brisken & O'Malley 2010). Prolonged exposure to endogenous estrogens in case of early age at menarche or late menopause increases the risk of breast cancer development, while an early menopause has a protective effect (Fenton 2006, Rudel et al. 2011). Interestingly, early pregnancy, which is associated with extremely high levels of estrogen exposure to women, exhibits a dual effect on the risk of the breast cancer development (Lambe et al. 1994).

A major harmful effect of oral estrogen for menopausal hormone therapy (MHT) or combined oral contraceptive (COC) users is an imbalance in hemostasis leading to a global enhancement of thrombin generation that increases the risk of venous thromboembolism (Canonico 2014, O'Brien 2014, Scarabin 2014). In addition, several studies have linked the use of exogenous estrogen preparations to the risk of initiating breast cancer (Stahlberg et al. 2004, Lai et al. 2011, Turkoz et al. 2013). The combined administration of equine estrogen plus progestin, and, to a lesser extent, estrogen alone to postmenopausal women increases the risk of breast cancer (Rossouw et al. 2002, Anderson et al. 2006, Foidart et al. 2007, Sturdee et al. 2011). A new estrogen with a safer profile is therefore required to improve women's health during and after their fertile lifetime.

Estetrol (E4) is a human-specific natural estrogen produced only during pregnancy by the fetal liver (Coelingh Bennink et al. 2008a, Holinka et al. 2008a). It was initially identified by Hagen et al. (1965), but its physiological role during pregnancy remains to be defined. E4 maternal plasma levels reach 1 ng/ml (3 nM), and 0.5–3.8 mg/day of E4 have been measured in urine at the end of pregnancy, suggesting that exposure to a high level of E4 is not toxic. E4 binds to both estrogen receptors, with a higher affinity for estrogen receptor alpha (ERα – ESR1) (Visser et al. 2008). In experimental animal models and in clinical studies in women, E4 acts as an estrogen to prevent vaginal dryness, osteoporosis, and hot flushes (Coelingh Bennink et al. 2008b, Holinka et al. 2008b, Visser et al. 2008). In contrast to E2, it exhibits a high oral bioavailability with an elimination half-life of 28 h in humans. It does not stimulate the production of nor bind to the sex hormone-binding globulin (Hammond et al. 2008) and it has no or only a minimal impact on liver function. When used at 5–20 mg in a phase 2 clinical trial (Foidart, JM. Congress of Eur. Soc. Gynecol. 2013, personal communication), E4 induces minimal changes compared with ethinyl estradiol (EE) in binding cortisol globulin, angiotensinogen, triglycerides, or estrogen-sensitive coagulation proteins. Due to these unique pharmacological properties, E4 appears to be suitable as a potential drug for contraception or MHT. However, nothing is known about the potential impact of E4 on the normal breast.

The aim of this work was to investigate the proliferative activity of E4 on the mammary cells in an in vitro model of isolated human breast epithelial (HBE) cells and an in vivo model of mouse mammary gland growth, coupled with a robust quantification performed by computer-assisted image analysis. To our knowledge, our study is the first one to describe the impact of E4 on normal breast.

Materials and methods

Chemicals, reagents, and steroids

HAM's F10 medium, FCS, NaHCO3 solution, Hank's balanced salt solution, and sterile trypsin solution were obtained from Life Technologies. EDTA, penicillin–streptomycin, cholera toxin, transferrin, insulin, triiodothyronine, cortisol, estradiol, tamoxifen, ICI 182 780 (fulvestrant), hyaluronidase, and carmin were obtained from Sigma–Aldrich. Epidermal growth factor and collagenase were obtained from Boehringer Mannheim Chemical Corp. Human serum was obtained from the ‘Etablissement Français du Sang’ of the Saint Antoine Hospital (Paris, France). [Methyl-3H]thymidine was obtained from GE Healthcare (Buckinghamshire, UK). E4 was supplied by Uteron Pharma (Liège, Belgium).

Ethical approval

Human mammary epithelial cells were obtained from women undergoing reduction mammoplasty for aesthetic purposes. All patients gave their informed consent for the studies according to the French law on clinical experimentation (‘Comité de protection des Personnes’, biomedical project 11826). All of the animal procedures of this study were approved by the animal ethical committee of University of Liège (Belgium).

Human mammary epithelial cell culture

Specimens of normal breast epithelial cells were obtained from women (aged 15–42 years). The patients had no history of breast disease and pathological examination of the tissue showed only normal breast tissue. Briefly, the tissue was digested with collagenase (0.15%) and hyaluronidase (0.05%) in HAM's F10 medium, and then filtered consecutively through 300 and 150 μm sieves to retain undigested tissue. The cells were pelleted, distributed into T25 plastic flasks, and maintained at 37 °C in a humidified atmosphere with 5% CO2. The HBE cells were maintained in HAM's medium containing NaHCO3 (0.24%), penicillin–streptomycin (1%), cortisol (5 ng/ml), T3 (6.5 ng/ml), choleratoxin (10 ng/ml), transferrin (5 mg/ml), insulin (0.016 U/ml), EGF (10 ng/ml) and 5% human serum. Proliferation tests were assessed with these fresh cells.

Proliferation assay

Forty-eight hours after exposure to hormones, cells were incubated with 2 μCi of [methyl-3H]thymidine for 48 h at 37 °C. After incubation, the cells were washed twice with PBS and twice with 5% trichloroacetic acid. The cells were incubated in 5% TCA for 15 min at 4 °C and lysed in NaOH 0.1 M for 15 min at 37 °C. The total cell lysate was added to 25 μl of scintillation liquid and radioactivity was counted with a Beckman (Fullerton, CA, USA) LS-500-CE β counter.

Prepubertal mouse study experimental design

C57BL/6 female prepubertal mice were purchased from Janvier Laboratory (Saint-Berthevin, France). Five mice per cage were housed under a standard 12-h photoperiod. Food and water were provided ad libitum. Mice were ovariectomized (OVX) at 28 days of age under isoflurane anesthesia to remove endogenous hormone production. Oral treatment was initiated at 35 days of age for a period of 6 or 14 days. Mice were fed by gavage with peanut oil containing 5% ethanol (vehicle, negative control) or E4 (0.3, 1, 3, or 10 mg/kg per day) alone or in combination with E2 (1 mg/kg per day). E2 and E4 were dissolved in absolute ethanol and brought to the final concentration with peanut oil (5% EtOH in peanut oil). At the end of treatment, mice were killed; mammary tissues were dissected for whole-mount preparation and epithelial RNA isolation or paraffin-embedded for histological analyses. Plasma was isolated from blood (cardiac puncture) and circulating hormone concentration was determined by mass spectrometry (ATC Pharma, Liège, Belgium). The animals were weighed before and after treatment. The experimentation was performed with five animals in each group.

Mammary gland whole mount

Murine mammary gland growth is a particularly sensitive method largely used to study the impact of various compounds directly on the mammary epithelium (Ayyanan et al. 2011) and to define the molecular mechanisms driving mammary gland development (Mallepell et al. 2006, Beleut et al. 2010). One of the fourth inguinal mammary glands was removed in one piece and spread onto a glass slide. The removed gland was subjected to whole-mount fixation, defatting, and staining. The mammary glands were fixed in Carnoy's fixative (ethanol, chloroform, glacial acetic acid; 6:3:1) for at least 4 h and defatted in acetone overnight. They were then rehydrated through a series of graded alcohols and stained with carmine overnight. The whole-mount glands were then dehydrated sequentially through 70, 90, and 100% ethanol for 20 min each and cleared in xylene for at least 2 h. Digital pictures of mammary glands immersed in xylene were taken using a Leica M80 microscope with a Leica IC80 HD digital camera attached.

Image processing and morphological measurements

To quantify the morphological changes occurring under the various treatments in mouse mammary gland, we developed an original computer-assisted method of quantification. Digital pictures of mammary gland whole mounts allowed an assessment of morphological features by image analysis. Image processing and measurements were implemented with the image analysis toolbox of Matlab7.9, Mathworks (Natick, MA, USA). Mammary gland structure was extracted using the Frangi multiscale filter (Frangi et al. 1998) that allows the identification of elongated objects having a characteristic thickness, in images presenting nonhomogeneous intensities. The resulting images were then binarized, i.e., pixel values belonging to mammalian glands take the value equal to 1 and 0 background pixels. Finally, morphological filters (Soille 1999) were used to eliminate noise remaining in the images. The resulting binary images were then systematically compared with the original ones and corrected manually if required. Total area of the epithelial network, also named ductal tree (mm2), was calculated from binary images that were further skeletonized (Soille 1999) in order to measure the total length (mm). Total area and total length of the ductal tree are two parameters reflecting the growth rate of the mammary gland. Furthermore, to evaluate gland differentiation, proliferating units of the mammary gland named terminal end buds (TEBs) were automatically detected on mammary glands collected after 6 and 14 days. As they appear as the darkest features located at the periphery of the mammary gland, binary images of TEBs were obtained using an appropriate threshold and a size filter. Only buds with diameter >100 μm were considered as TEB (LaRocca et al. 2011). From those images, the total number of TEBs were measured.

Ki67, ERα, and progesterone receptor immunohistochemistry

To carry out histological analysis, samples were fixed in 4% formalin for 2 h and stored in 70% ethanol before paraffin embedding. The sections were cut at 6 μm. For detection of Ki67, ERα, and progesterone receptor (PGR) in the mammary gland, the slides were deparaffinized in xylene and rehydrated through graded alcohols. For antigen retrieval, sections were heated at 126 °C under 1.4 Bar in 10 mM citrate buffer for 10 min. The sections were then treated with 3% H2O2 for 20 min to block endogenous peroxidase activity, washed with PBS, and incubated with 10% BSA for 1 h. After blocking, the sections were incubated with the Ki67 antibody (TEC-3 rat monoclonal IgG) from Dako (Glostrup, Denmark), the ERα antibody (MC-20 rabbit polyclonal IgG) from Santa Cruz Biotechnology, or the PGR antibody (SP2 rabbit monoclonal IgG) from Thermo Scientific (Waltham, MA, USA) at 1:50, 1:25, and 1:400 dilutions respectively. The slides were then incubated with biotinylated secondary antibodies for 30-min, followed by 30 min incubation with streptavidin–peroxidase conjugate. Antigen–antibody complex was visualized by incubation with 3,3′-diaminobenzidine 5. The slides were counterstained with hematoxylin, dehydrated, and mounted using a mounting medium from Labonord (Templemars, France). Positively stained cells appeared brown while negative cells were blue.

Epithelial cell isolation from mouse mammary gland

Mice were killed by cervical dislocation and both fourth mammary glands were dissected. The proximal and distal parts of the mammary glands were collected in DMEM/F12 supplemented with collagenase (0.10%) and hyaluronidase (0.05%), but the central part containing the lymph node was discarded. Tissue was minced and incubated under constant agitation for 1 h at 37 °C. After centrifugation at 450 g for 5 min, organoids were suspended in cold HBSS, and then five pulse centrifugations reaching 450 g were performed. The final pellet should contain mainly epithelial structures. Single cells, fibroblasts, and blood cells were discarded with the supernatant.

Quantitative RT-PCR

RNA was extracted using TRIzol reagent (Invitrogen) from the epithelial cells isolated from mouse mammary gland, following the manufacturer's protocol. RT and real-time quantitative PCR were performed using specific primers and Brilliant SYBR GREEN QPCR master mix on a Roche apparatus. Sequence primers for target genes were (5′ to 3′): glyceraldehyde-3-phosphate dehydrogenase (Gapdh) forward GTTCACCCACTAATAGGG and reverse GGATTCTGACTTAGAGGCGTT; Pgr forward GCCCACAGTATGGCTTTGATTCCT and reverse GCAACACCGTCAAGGGTTCTCATA; Mki67 (Ki67) forward GATAGCTTCTGTGCTGACCCTGAT and reverse CCCTGATGAGTCTTGGCTAACACT; Ccnd1 (cyclin D1) forward GAGCTGCTGCAAATGGAACTGCTT and reverse GTTCTCATCCGCCTCTGGCATTTT. Gene expression values were normalized to housekeeping gene Gapdh.

Statistical analyses

All quantitative experimental data are expressed as mean±s.d. or mean±s.e.m. Statistical analyses were conducted with GraphPad Prism Software (La Jolla, CA, USA) using one-way ANOVA followed by Student–Newman–Keuls's test or using Kruskal–Wallis followed by Dunn's test, with regard to heteroscedasticity. A P value of ≤0.05 was considered as statistically significant.

Results

E4 is an estrogen with low affinity, which stimulates HBE cell proliferation at high doses

Exposure of HBE cells for 96 h to 10 nM E2 elicited a maximal cell proliferation increase by 60% (Fig. 1A). A tenfold higher E2 concentration failed to further stimulate proliferation. 10 nM E4 did not increase HBE cell proliferation (Fig. 1B). A 100-fold higher concentration was necessary to stimulate the proliferation rate to the same extent, indicating that E4 is a low affinity estrogen in HBE cells.

Figure 1
Figure 1

Effect of E4 and E2 on HBE cell proliferation. Histograms of HBE cell proliferation determined by [3H]thymidine incorporation after 96 h of treatment. (A) Treatment with E2 (10 and 100 nM). (B) Treatment with E4 (10 nM, 100 nM, and 1 μM). Data are expressed as % of control normalized at 100%, mean±s.e.m., n=3. *P<0.05 vs vehicle. HBE, human breast epithelial, ND, not determined.

Citation: Journal of Endocrinology 224, 1; 10.1530/JOE-14-0549

E4 promotes mammary gland growth and proliferation in OVX mice

The in vivo impact of a daily oral treatment with E4 was analyzed on mammary gland of OVX mice after 6 or 14 days and quantified using an original computer-assisted image analysis method (Fig. 2). E4 (3 mg/kg per day) induced the growth of the prepubertal epithelial ducts and the appearance of TEBs (Fig. 3A). The mammary gland growth rate was quantified by measuring the total length and total area of the epithelial ductal tree (Fig. 3B and C). After 6 days of treatment, the average total length and area of the epithelial network were increased by 2.18- and 2.13-fold in E4-treated mice respectively. TEBs were completely absent in the vehicle-treated group (OVX), although an average of 29.4±2.2 TEBs/gland (n=10 glands from five mice) was identified in the E4-treated group (Fig. 3D). After 14 days of treatment, the mean total length and the area of the epithelial network were increased by 4.9- and 3.5-fold in E4-treated mice respectively. As classically observed in this model (Sternlicht et al. 2006), the number of TEBs remained higher in the estrogen-treated mice compared with the untreated ones, but to a lower extent than after 6 days. Indeed, after 14 days of treatment, most of TEBs had regressed and became histologically simpler. The proliferative status of the E4-treated mammary glands was confirmed by Ki67 immunolabeling (Fig. 3E). In contrast to what was observed for mammary gland from OVX mice that did not express Ki67, the labeling revealed the presence of proliferating cells in TEBs and in ducts of E4-treated mice.

Figure 2
Figure 2

Computer-assisted method of mammary gland quantification. Morphological parameters of the mammary glands were quantified with a computer-assisted method. Whole-mount mammary glands after 14 days (A) and 6 days (B) of estrogenic treatment. (C) Binary image of the matched whole-mount mammary gland used to measure the total area occupied by the ductal tree. (D) Binary image where green dots indicate detected TEBs that were counted. (E) Skeletonized binary image used to measure ductal tree length. Scale bars=2 mm. TEB, terminal end bud. A full colour version of this figure is available via http://dx.doi.org/10.1530/JOE-14-0549.

Citation: Journal of Endocrinology 224, 1; 10.1530/JOE-14-0549

Figure 3
Figure 3

Effect of E4 on mouse mammary gland growth and proliferation. (A) Whole-mount mammary gland from ovariectomized mice orally treated with vehicle (OVX) or from ovariectomized mice orally treated with E4 at 3 mg/kg per day (E4) for a period of 6 (d6) or 14 (d14) days. TEBs are pointed by arrows. Scale bars=2 mm. (B, C, and D) Computer-assisted quantification of the morphological parameters of whole-mount mammary glands from ovariectomized mice orally treated with vehicle (OVX) or from ovariectomized mice orally treated with E4 3 mg/kg per day (E4) for a period of 6 (d6) or 14 (d14) days. Mammary gland morphology was assessed with three parameters: total length (B) and area (C) of the ductal tree, and number of TEBs (D). Note the total lack of TEBs in control groups (OVX). Data are presented as mean±s.e.m., n=5. **P<0.01, ***P<0.001 vs OVX. (E) Histological sections of mammary gland, stained with an anti-Ki67 antibody, from OVX or E4 (3 mg/kg per day)-treated mice after 6 days. Lower left panel, TEB section; right panel, epithelial duct section. Scale bars=100 μm. TEB, terminal end bud. A full colour version of this figure is available via http://dx.doi.org/10.1530/JOE-14-0549.

Citation: Journal of Endocrinology 224, 1; 10.1530/JOE-14-0549

E4 has a weaker stimulatory effect on mammary gland than E2

We then compared the effect of E4 to a physiological concentration of E2. OVX mice were orally treated with E4 (0.3, 1, 3, or 10 mg/kg per day) or with E2 (1 mg/kg per day) during 14 days (Fig. 4A). The serum levels of E2 and E4 measured 3 h after oral administration are given in Table 1. The concentration range used for E4 was established to start within the physiological and therapeutic ranges and to exceed them (Coelingh Bennink et al. 2008a). Despite doses of E4 resulting in a plasma concentration up to 300-fold over that of E2, E4 promoted epithelial growth only by 55–75% of the total length of the gland area achieved with E2 (Fig. 4B). The expression of cyclin D1 mRNA, which is induced by E2 and correlates with proliferation (Liu et al. 2002), was significantly lower in mammary epithelial cells of mice treated with E4 than that with E2, and is even comparable with untreated mice (Fig. 4C). Ki67 mRNA that is overexpressed during cell proliferation was also significantly lower (Fig. 4D).

Figure 4
Figure 4

Comparison between the effect of E4 and E2 on mammary gland growth. Mice were ovariectomized and orally treated with vehicle (OVX), with E2 1 mg/kg per day (E2) or with E4 ranging from 0.3 to 10 mg/kg per day (E4) for a period of 14 days. (A) Whole-mount mammary gland, scale bars=2 mm. (B) Computer-assisted quantification of morphological parameters of whole mount mammary glands. Ductal tree length and area data are expressed as mean±s.e.m., n=5. ***P<0.001 vs OVX; #P<0.05, ##P<0.01, ###P<0.001 vs E2. (C) Ccnd1 (cyclin D1) mRNA and (D) Mki67 (Ki67) mRNA expression level of epithelial cells isolated from mammary gland. Results are expressed in arbitrary units (U.A.), mean±s.e.m., n=5, *P<0.05, ***P<0.001 vs E2. A full colour version of this figure is available via http://dx.doi.org/10.1530/JOE-14-0549.

Citation: Journal of Endocrinology 224, 1; 10.1530/JOE-14-0549

Table 1

Circulating levels of E2 and E4 measured 3 h after oral administration

Oral administration (mg/kg)Serum concentration (mean±s.d., pg/ml)Serum concentration (mean±s.d., nM)nE4/E2 ratio
E21171±150.63±0.063
E40.32253±7757.5±2.5812
E416533±240922.5±7.9836
E4318 484±531861±17897
E41071 832±23 944236±794374

ERα drives E4-mediated stimulation of mammary gland growth

While ERβ is dispensable for mammary gland elongation (Forster et al. 2002), E2 contributes to mammary epithelium proliferation and morphogenesis by paracrine signaling through ERα (Mallepell et al. 2006). When activated by E2, ERα promotes the expression of PGR in the mammary epithelium (Beleut et al. 2010). In order to define whether E4 activates mammary epithelium ERα, the expression of PGR was evaluated in vivo. PGR proteins were expressed in the mammary epithelium of E4-treated mice, but not of OVX untreated mice (Fig. 5A). Pgr mRNA was overexpressed under E4 treatment (Fig. 5B). In addition, the pure ERα antagonist ICI 182 780 completely blocked the elongation of the ductal tree induced by E4 (Fig. 5C). Quantification of total ductal tree and length and TEB number confirmed these observations (Fig. 5D). In vitro both ICI 182 780 and tamoxifen (an ERα antagonist in the breast) also abolished the stimulating effect of E4 on HBE cell proliferation (Fig. 5E and F). Altogether, these in vitro and in vivo results support that E4 exerts genomic effects through ERα and that this receptor is involved in the proliferative effect of E4 on human mammary epithelial cells and mouse mammary gland.

Figure 5
Figure 5

ERα drives E4 activity on mammary gland growth and HBE cell proliferation. (A) Histological sections of mammary gland, stained with an anti-PGR antibody, from OVX or E4 (3 mg/kg per day)-treated mice after 6 days, magnification 20×. Scale bars=100 μm. (B) Pgr mRNA expression level of epithelial cells isolated from mammary gland from OVX or E4 (3 mg/kg per day)-treated mice after 6 days. Data are expressed as mean±s.e.m., n=5. **P<0.01 vs OVX. (C) Whole-mount mammary gland from ovariectomized mice orally treated with vehicle (OVX) or with E4 3 mg/kg per day alone (E4) or associated with s.c. injection of ICI 182 780 used at 30 mg/kg (E4+ICI) for a period of 6 days. Scale bars=2 mm. (D) Computer-assisted quantification of morphological parameters of whole-mount mammary glands obtained as in (C). Ductal tree length and area data and TEB number are expressed as mean±s.e.m., n=5. **P<0.01, ***P<0.001 vs OVX; ##P<0.01, ###P<0.001 vs E4. (E and F) Proliferation of HBE cells treated with vehicle, E4 (1 μM), and/or with ICI 182 780 (ICI, 1 μM) or tamoxifen (TAM, 1 μM) measured by [3H]thymidine incorporation. Results are expressed as % of vehicle normalized at 100%, mean±s.e.m., n=3. ***P<0.001 vs vehicle, ###P<0.001 vs E4. TEB, terminal end bud. A full colour version of this figure is available via http://dx.doi.org/10.1530/JOE-14-0549.

Citation: Journal of Endocrinology 224, 1; 10.1530/JOE-14-0549

E4 partially antagonizes the stimulatory effect of E2 on HBE cell proliferation and mammary gland growth

We then evaluated the impact of a combined administration of E4 and E2 on HBE cell proliferation and on mammary gland growth. HBE cells were exposed in vitro to a maximal stimulatory concentration of E2 (10 nM) combined with increasing concentrations of E4 (10–1000 nM). E4 antagonized the effect of E2 in a dose-dependent pattern (Fig. 6A). In vivo mice received a daily oral physiological dose of E2 (1 mg/kg per day) either alone or in combination with E4 at a concentration of 0.3, 1, 3, or 10 mg/kg per day. After 14 days of treatment, exposure to the combination of E2+E4 decreased the total length and the area of the epithelial network induced by treatment with E2 alone by 17–38% (Fig. 6B). In addition, the combination of E2+E4 decreased cyclin D1 and Ki67 mRNA expression by 23–100% in mammary epithelium (Fig. 6C and D) on E2 treatment. Altogether, these results support that E4 is able to partially antagonize the effect of E2 on breast epithelium proliferation in vitro and in vivo.

Figure 6
Figure 6

Effect of combination of E2 and E4 on HBE cell proliferation and mammary gland growth. (A) Effect of E2, E4, and their combination (E2+E4) on HBE cell proliferation measured by [3H]thymidine incorporation and expressed as % of vehicle normalized at 100%, mean±s.e.m. (n=3). *P<0.05, NS, not significant vs vehicle. (B) Computer-assisted quantification of morphological parameters of whole-mount mammary glands from ovariectomized mice orally treated with vehicle (OVX), E2 1 mg/kg per day alone (E2), or associated with E4 used at 0.3, 1, 3, or 10 mg/kg per day (E2+E4) for a period of 6 or 14 days. Ductal tree length and area data are expressed as mean±s.e.m., n=10 glands from five mice. *P<0.05, **P<0.01, ***P<0.001 vs E2 of the corresponding period of 6 or 14 days. (C) Ccnd1 (cyclin D1) mRNA and (D) Mki67 (Ki67) mRNA expression level of epithelial cells isolated from mammary gland of ovariectomized mice orally treated for 14 days with vehicle or with E2 1 mg/kg per day alone or associated with E4 doses ranging from 0.3 to 10 mg/kg per day. Data are expressed as mean±s.e.m., n=5. ***P<0.001 vs E2.

Citation: Journal of Endocrinology 224, 1; 10.1530/JOE-14-0549

Discussion

Despite benefits in contraception and MHT, debates over harmful effects of estrogen have been intensified. Even if they are required for breast physiology, particularly during pregnancy in preparation for lactation, their mammary impact is usually considered to be deleterious because of their mitogenic activity. Thus, there is considerable interest in developing COC or MHT with new estrogen having minimal venous thromboembolism impact and lower breast proliferative capacity. In this study, we report that E4 acts on breast proliferation through ERα less efficiently than E2, in vitro and in vivo. More interestingly, when coadministered, E4 is able to partially antagonize the E2-induced proliferation of HBE cells and the mouse mammary gland growth.

Similar to E2, E4 stimulated the proliferation of human mammary epithelial cells in vitro and murine breast growth in vivo through ERα, because ICI 182 780 and tamoxifen blocked this effect. This ERα-dependent activation induced PGR expression, a well-described process regulated by E2 (Horwitz et al. 1978, Vienonen et al. 2002). However, E4 stimulated breast proliferation with a 100-fold weaker efficacy than E2 in vitro as well as in vivo. This is consistent with competitive binding studies showing that E4 exhibits considerably lower affinity than E2 toward ERα (Martucci & Fishman 1976, Tseng & Gurpide 1976, 1978, Visser et al. 2008), and with the observation that E4 was less potent than E2 to increase breast cancer cell line proliferation and migration (Jozan et al. 1981, Giretti et al. 2014, Liu et al. 2014).

The dose range of E4 administered orally in this study was defined to cover and exceed the physiological levels of E4 detected in the plasma of pregnant women (3 nM), in fetal blood (45 nM) (Coelingh Bennink et al. 2008a), as well as in serum from a clinical trial where 5–20 mg/day E4 was administered to women of reproductive age (Foidart, JM. Congress of Eur. Soc. Gynecol. 2013, personal communication). This range of E4 doses induced circulating levels of approximately ten- to 400-fold higher than those of E2 tested in this study. Despite these large differences, the stimulation of mammary gland growth by E4 remained at most 55% of that by E2. E4 was unable to increase cyclin D1 expression, an ERα-inducible gene that governs E2-dependent epithelial cell growth in mammary gland (Liu et al. 2002, Casimiro et al. 2013). At these concentrations, E4 has been reported to significantly prevent osteoporosis and hot flushes in preclinical rat models (Visser & Coelingh Bennink 2009). Altogether, these results highlight that E4 could be suitable to control reproduction, osteoporosis, and vasomotor symptoms with limited impact on breast proliferation.

The concomitant exposure to E2 and E4 in vitro and in vivo revealed that E4 partially antagonized the proliferation induced by E2 on HBE cell proliferation and on mammary gland growth. This antagonistic effect was also evidenced for cyclin D1 and Ki67 mRNA expression. It was maximal in vitro and in vivo when the dose of E4 was 100 times higher than that of E2. Giretti et al. (2014) recently showed that E4 administration to malignant human breast adenocarcinoma T47-D cells weakly stimulated their cytoskeleton remodeling and migration. However, when E2 was present, E4 counteracted the stimulatory actions of E2. Estriol (E3), another estrogen associated with pregnancy, has also been described as a weak estrogen with mixed agonist/antagonist activity (Clark & Markaverich 1984, Melamed et al. 1997).

The precise molecular mechanism by which E4 antagonizes E2 on epithelial breast cell proliferation has not been evaluated in this study. The molecular and kinetic basis for the mixed agonist/antagonist activity of E3 has been suggested to be the consequence of a complex equilibrium among several ERα species: unliganded hERα monomers and dimers; E2-hERα monomers and dimers; E3-hERα monomers and dimers; and E3-E2-hER heterodimers. It is plausible that similar plurality of ERα complexes occurs in the presence of E4+E2 and causes variable interactions with estrogen-responsive elements (ERE) comparable to those described with E2+E3 (Melamed et al. 1997). A differential activation by E2 and E4 of nuclear (genomic) and extra-nuclear (nongenomic) effects of ERα could also be involved as reported in uterus, vasculature, and breast cancer cells in the study reported by Abot et al. (2014).

Whatever the complex mechanisms of ERα activation by E4+E2 may be, our quantitative analyses demonstrate that E4 acts on ERα in the breast as a weak estrogen agonist and as an E2 antagonist. Our data contribute to the emerging hypothesis that E4 may be a naturally occurring ER modulator in the breast that may be considered as a potential new estrogen for clinical use with a reduced impact on breast proliferation.

Declaration of interest

J M F is Professor at the University of Liege and Scientific Consultant for Uteron Pharma. M M is Scientific Consultant for Uteron Pharma.

Funding

This work was supported by grants from the Fonds de la Recherche Scientifique – FNRS (F.R.S.-FNRS, Belgium): FRSM 3.4557.12, FRSM 3.4567.11, Télévie 7.4524.11, Télévie 7.4604.13; the Fondation contre le Cancer (foundation of public interest, Belgium), the Fonds spéciaux de la Recherche (University of Liège): FSRC-12/64, FSRC-12/92, FSRC-14/89, FSRC-14/65, FSRC-14/109, FSRC-14/62; the Centre Anticancéreux près l’ Université de Liège, the Fonds Léon Fredericq (University of Liège), the Direction Générale Opérationnelle de l'Economie, de l'Emploi et de la Recherche from the Service Public de Wallonie (DGO6, SPW, Belgium): P.P.P. 917008; the Interuniversity Attraction Poles Programme – Belgian Science Policy (Brussels, Belgium): IAP Phase VII – P7/03; the Plan National Cancer (Service Public Fédéral) and the Actions de Recherche Concertées (University of Liege, Belgium): A.R.C. 11/16-02.

Author contribution statement

C G designed and performed experiments, analyzed data, and prepared the figures and wrote the manuscript. S B developed and performed all computer assisted quantification analysis. L C and A C contributed to in vitro experiments. A G supervised in vitro experiments and reviewed the manuscript. E T, M M, C M, and A N gave scientific advices along the study. C P supervised experiment design, analyzed data, and wrote the manuscript. J M F initiated and supervised the project and critically reviewed the manuscript.

Acknowledgements

The authors thank Erika Konradowski for her excellent technical assistance. The authors also thank the animal care facility of the GIGA of the University of Liège.

References

  • Abot A, Fontaine C, Buscato M, Solinhac R, Flouriot G, Fabre A, Drougard A, Rajan S, Laine M & Milon A et al. 2014 The uterine and vascular actions of estetrol delineate a distinctive profile of estrogen receptor α modulation, uncoupling nuclear and membrane activation. EMBO Molecular Medicine 10 13281346. (doi:10.15252/emmm.201404112)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Anderson E, Clarke RB & Howell A 1998 Estrogen responsiveness and control of normal human breast proliferation. Journal of Mammary Gland Biology and Neoplasia 3 2335. (doi:10.1023/A:1018718117113)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Anderson GL, Chlebowski RT, Rossouw JE, Rodabough RJ, McTiernan A, Margolis KL, Aggerwal A, David Curb J, Hendrix SL & Allan Hubbell F et al. 2006 Prior hormone therapy and breast cancer risk in the Women's Health Initiative randomized trial of estrogen plus progestin. Maturitas 55 103115. (doi:10.1016/j.maturitas.2006.05.004)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ayyanan A, Laribi O, Schuepbach-Mallepell S, Schrick C, Gutierrez M, Tanos T, Lefebvre G, Rougemont J, Yalcin-Ozuysal O & Brisken C 2011 Perinatal exposure to bisphenol a increases adult mammary gland progesterone response and cell number. Molecular Endocrinology 25 19151923. (doi:10.1210/me.2011-1129)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Beleut M, Rajaram RD, Caikovski M, Ayyanan A, Germano D, Choi Y, Schneider P & Brisken C 2010 Two distinct mechanisms underlie progesterone-induced proliferation in the mammary gland. PNAS 107 29892994. (doi:10.1073/pnas.0915148107)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brisken C & O'Malley B 2010 Hormone action in the mammary gland. Cold Spring Harbor Perspectives in Biology 2 a003178. (doi:10.1101/cshperspect.a003178)

  • Canonico M 2014 Hormone therapy and hemostasis among postmenopausal women: a review. Menopause 21 753762. (doi:10.1097/GME.0000000000000296)

  • Casimiro MC, Wang C, Li Z, Di Sante G, Willmart NE, Addya S, Chen L, Liu Y, Lisanti MP & Pestell RG 2013 Cyclin D1 determines estrogen signaling in the mammary gland in vivo. Molecular Endocrinology 27 14151428. (doi:10.1210/me.2013-1065)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Clark JH & Markaverich BM 1984 The agonistic and antagonistic actions of estriol. Journal of Steroid Biochemistry 20 10051013. (doi:10.1016/0022-4731(84)90011-6)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Coelingh Bennink F, Holinka CF, Visser M & Coelingh Bennink HJ 2008a Maternal and fetal estetrol levels during pregnancy. Climacteric 11 (Suppl 1) 6972. (doi:10.1080/13697130802056321)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Coelingh Bennink HJ, Heegaard AM, Visser M, Holinka CF & Christiansen C 2008b Oral bioavailability and bone-sparing effects of estetrol in an osteoporosis model. Climacteric 11 (Suppl 1) 214. (doi:10.1080/13697130701798692)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Fenton SE 2006 Endocrine-disrupting compounds and mammary gland development: early exposure and later life consequences. Endocrinology 147 S18S24. (doi:10.1210/en.2005-1131)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Foidart JM, Desreux J, Pintiaux A & Gompel A 2007 Hormone therapy and breast cancer risk. Climacteric 10 (Suppl 2) 5461. (doi:10.1080/13697130701598324)

  • Forster C, Makela S, Warri A, Kietz S, Becker D, Hultenby K, Warner M & Gustafsson JA 2002 Involvement of estrogen receptor β in terminal differentiation of mammary gland epithelium. PNAS 99 1557815583. (doi:10.1073/pnas.192561299)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Frangi I, Keppenne V, Coppens L, Bonnet P, Andrianne R & de Leval J 1998 Antegrade scrotal embolization of varicocele: results. Acta Urologica Belgica 66 58.

  • Giretti MS, Montt Guevara MM, Cecchi E, Mannella P, Palla G, Spina S, Bernacchi G, Di Bello S, Genazzani AR & Genazzani AD et al. 2014 Effects of estetrol on migration and invasion in T47-D breast cancer cells through the actin cytoskeleton. Frontiers in Endocrinology 5 80. (doi:10.3389/fendo.2014.00080)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hagen AA, Barr M & Diczfalusy E 1965 Metabolism of 17-β-oestradiol-4-14-C in early infancy. Acta Endocrinologica 49 207220.

  • Hammond GL, Hogeveen KN, Visser M & Coelingh Bennink HJ 2008 Estetrol does not bind sex hormone binding globulin or increase its production by human HepG2 cells. Climacteric 11 (Suppl 1) 4146. (doi:10.1080/13697130701851814)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Holinka CF, Diczfalusy E & Coelingh Bennink HJ 2008a Estetrol: a unique steroid in human pregnancy. Climacteric 11 (Suppl 1) 1. (doi:10.1080/13697130802040077)

  • Holinka CF, Brincat M & Coelingh Bennink HJ 2008b Preventive effect of oral estetrol in a menopausal hot flush model. Climacteric 11 (Suppl 1) 1521. (doi:10.1080/13697130701822807)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Horwitz KB, Koseki Y & McGuire WL 1978 Estrogen control of progesterone receptor in human breast cancer: role of estradiol and antiestrogen. Endocrinology 103 17421751. (doi:10.1210/endo-103-5-1742)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jozan S, Kreitmann B & Bayard F 1981 Different effects of oestradiol, oestriol, oestetrol and of oestrone on human breast cancer cells (MCF-7) in long term tissue culture. Acta Endocrinologica 98 7380.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lai JN, Wu CT, Chen PC, Huang CS, Chow SN & Wang JD 2011 Increased risk for invasive breast cancer associated with hormonal therapy: a nation-wide random sample of 65,723 women followed from 1997 to 2008. PLoS ONE 6 e25183. (doi:10.1371/journal.pone.0025183)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lambe M, Hsieh C, Trichopoulos D, Ekbom A, Pavia M & Adami HO 1994 Transient increase in the risk of breast cancer after giving birth. New England Journal of Medicine 331 59. (doi:10.1056/NEJM199407073310102)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • LaRocca J, Pietruska J & Hixon M 2011 Akt1 is essential for postnatal mammary gland development, function, and the expression of Btn1a1. PLoS ONE 6 e24432. (doi:10.1371/journal.pone.0024432)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu MM, Albanese C, Anderson CM, Hilty K, Webb P, Uht RM, Price RH Jr, Pestell RG & Kushner PJ 2002 Opposing action of estrogen receptors α and β on cyclin D1 gene expression. Journal of Biological Chemistry 277 2435324360. (doi:10.1074/jbc.M201829200)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu S, Ruan X, Schultz S, Neubauer H, Fehm T, Seeger H & Mueck AO 2014 Oestetrol stimulates proliferation and oestrogen receptor expression in breast cancer cell lines: comparison of four oestrogens. European Journal of Contraception & Reproductive Health Care 12 17. (doi:10.3109/13625187.2014.951997)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mallepell S, Krust A, Chambon P & Brisken C 2006 Paracrine signaling through the epithelial estrogen receptor α is required for proliferation and morphogenesis in the mammary gland. PNAS 103 21962201. (doi:10.1073/pnas.0510974103)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Martucci C & Fishman J 1976 Uterine estrogen receptor binding of catecholestrogens and of estetrol (1,3,5(10)-estratriene-3,15α,16α, 17β-tetrol). Steroids 27 325333. (doi:10.1016/0039-128X(76)90054-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Melamed M, Castano E, Notides AC & Sasson S 1997 Molecular and kinetic basis for the mixed agonist/antagonist activity of estriol. Molecular Endocrinology 11 18681878. (doi:10.1210/mend.11.12.0025)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • O'Brien SH 2014 Contraception-related venous thromboembolism in adolescents. Seminars in Thrombosis and Hemostasis 40 6671. (doi:10.1055/s-0033-1363469)

  • Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV & Johnson KC et al. 2002 Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results From the Women's Health Initiative randomized controlled trial. Journal of the American Medical Association 288 321333. (doi:10.1001/jama.288.3.321)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rudel RA, Fenton SE, Ackerman JM, Euling SY & Makris SL 2011 Environmental exposures and mammary gland development: state of the science, public health implications, and research recommendations. Environmental Health Perspectives 119 10531061. (doi:10.1289/ehp.1002864)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Russo IH & Russo J 1998 Role of hormones in mammary cancer initiation and progression. Journal of Mammary Gland Biology and Neoplasia 3 4961. (doi:10.1023/A:1018770218022)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Scarabin PY 2014 Hormone therapy and venous thromboembolism among postmenopausal women. Frontiers in Hormone Research 43 2132.

  • Soille P 1999 Morphological Image Analysis: Principles and Applications. Berlin Heidelberg: Springer-Verlag.

    • PubMed
    • Export Citation
  • Stahlberg C, Pedersen AT, Lynge E, Andersen ZJ, Keiding N, Hundrup YA, Obel EB & Ottesen B 2004 Increased risk of breast cancer following different regimens of hormone replacement therapy frequently used in Europe. International Journal of Cancer 109 721727. (doi:10.1002/ijc.20016)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sternlicht MD, Kouros-Mehr H, Lu P & Werb Z 2006 Hormonal and local control of mammary branching morphogenesis. Differentiation 74 365381. (doi:10.1111/j.1432-0436.2006.00105.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sturdee DW, Pines A, International Menopause Society Writing Group, Archer DF, Baber RJ, Barlow D, Birkhauser MH, Brincat M, Cardozo L & de Villiers TJ et al. 2011 Updated IMS recommendations on postmenopausal hormone therapy and preventive strategies for midlife health. Climacteric 14 302320. (doi:10.3109/13697137.2011.570590)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tseng L & Gurpide E 1976 Competition of estetrol and ethynylestradiol with estradiol for nuclear binding in human endometrium. Journal of Steroid Biochemistry 7 817822. (doi:10.1016/0022-4731(76)90184-9)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tseng L & Gurpide E 1978 Heterogeneity of saturable estradiol binding sites in nuclei of human endometrium. Estetrol studies. Journal of Steroid Biochemistry 9 11451148. (doi:10.1016/0022-4731(78)90003-1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Turkoz FP, Solak M, Petekkaya I, Keskin O, Kertmen N, Sarici F, Arik Z, Babacan T, Ozisik Y & Altundag K 2013 Association between common risk factors and molecular subtypes in breast cancer patients. Breast 22 344350. (doi:10.1016/j.breast.2012.08.005)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vienonen A, Syvala H, Miettinen S, Tuohimaa P & Ylikomi T 2002 Expression of progesterone receptor isoforms A and B is differentially regulated by estrogen in different breast cancer cell lines. Journal of Steroid Biochemistry and Molecular Biology 80 307313. (doi:10.1016/S0960-0760(02)00027-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Visser M & Coelingh Bennink HJ 2009 Clinical applications for estetrol. Journal of Steroid Biochemistry and Molecular Biology 114 8589. (doi:10.1016/j.jsbmb.2008.12.013)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Visser M, Foidart JM & Coelingh Bennink HJ 2008 In vitro effects of estetrol on receptor binding, drug targets and human liver cell metabolism. Climacteric 11 (Suppl 1) 6468. (doi:10.1080/13697130802050340)

    • PubMed
    • Search Google Scholar
    • Export Citation
*

(C Péqueux and J M Foidart contributed equally to this work)

 

  • Collapse
  • Expand
  • Effect of E4 and E2 on HBE cell proliferation. Histograms of HBE cell proliferation determined by [3H]thymidine incorporation after 96 h of treatment. (A) Treatment with E2 (10 and 100 nM). (B) Treatment with E4 (10 nM, 100 nM, and 1 μM). Data are expressed as % of control normalized at 100%, mean±s.e.m., n=3. *P<0.05 vs vehicle. HBE, human breast epithelial, ND, not determined.

  • Computer-assisted method of mammary gland quantification. Morphological parameters of the mammary glands were quantified with a computer-assisted method. Whole-mount mammary glands after 14 days (A) and 6 days (B) of estrogenic treatment. (C) Binary image of the matched whole-mount mammary gland used to measure the total area occupied by the ductal tree. (D) Binary image where green dots indicate detected TEBs that were counted. (E) Skeletonized binary image used to measure ductal tree length. Scale bars=2 mm. TEB, terminal end bud. A full colour version of this figure is available via http://dx.doi.org/10.1530/JOE-14-0549.

  • Effect of E4 on mouse mammary gland growth and proliferation. (A) Whole-mount mammary gland from ovariectomized mice orally treated with vehicle (OVX) or from ovariectomized mice orally treated with E4 at 3 mg/kg per day (E4) for a period of 6 (d6) or 14 (d14) days. TEBs are pointed by arrows. Scale bars=2 mm. (B, C, and D) Computer-assisted quantification of the morphological parameters of whole-mount mammary glands from ovariectomized mice orally treated with vehicle (OVX) or from ovariectomized mice orally treated with E4 3 mg/kg per day (E4) for a period of 6 (d6) or 14 (d14) days. Mammary gland morphology was assessed with three parameters: total length (B) and area (C) of the ductal tree, and number of TEBs (D). Note the total lack of TEBs in control groups (OVX). Data are presented as mean±s.e.m., n=5. **P<0.01, ***P<0.001 vs OVX. (E) Histological sections of mammary gland, stained with an anti-Ki67 antibody, from OVX or E4 (3 mg/kg per day)-treated mice after 6 days. Lower left panel, TEB section; right panel, epithelial duct section. Scale bars=100 μm. TEB, terminal end bud. A full colour version of this figure is available via http://dx.doi.org/10.1530/JOE-14-0549.

  • Comparison between the effect of E4 and E2 on mammary gland growth. Mice were ovariectomized and orally treated with vehicle (OVX), with E2 1 mg/kg per day (E2) or with E4 ranging from 0.3 to 10 mg/kg per day (E4) for a period of 14 days. (A) Whole-mount mammary gland, scale bars=2 mm. (B) Computer-assisted quantification of morphological parameters of whole mount mammary glands. Ductal tree length and area data are expressed as mean±s.e.m., n=5. ***P<0.001 vs OVX; #P<0.05, ##P<0.01, ###P<0.001 vs E2. (C) Ccnd1 (cyclin D1) mRNA and (D) Mki67 (Ki67) mRNA expression level of epithelial cells isolated from mammary gland. Results are expressed in arbitrary units (U.A.), mean±s.e.m., n=5, *P<0.05, ***P<0.001 vs E2. A full colour version of this figure is available via http://dx.doi.org/10.1530/JOE-14-0549.

  • ERα drives E4 activity on mammary gland growth and HBE cell proliferation. (A) Histological sections of mammary gland, stained with an anti-PGR antibody, from OVX or E4 (3 mg/kg per day)-treated mice after 6 days, magnification 20×. Scale bars=100 μm. (B) Pgr mRNA expression level of epithelial cells isolated from mammary gland from OVX or E4 (3 mg/kg per day)-treated mice after 6 days. Data are expressed as mean±s.e.m., n=5. **P<0.01 vs OVX. (C) Whole-mount mammary gland from ovariectomized mice orally treated with vehicle (OVX) or with E4 3 mg/kg per day alone (E4) or associated with s.c. injection of ICI 182 780 used at 30 mg/kg (E4+ICI) for a period of 6 days. Scale bars=2 mm. (D) Computer-assisted quantification of morphological parameters of whole-mount mammary glands obtained as in (C). Ductal tree length and area data and TEB number are expressed as mean±s.e.m., n=5. **P<0.01, ***P<0.001 vs OVX; ##P<0.01, ###P<0.001 vs E4. (E and F) Proliferation of HBE cells treated with vehicle, E4 (1 μM), and/or with ICI 182 780 (ICI, 1 μM) or tamoxifen (TAM, 1 μM) measured by [3H]thymidine incorporation. Results are expressed as % of vehicle normalized at 100%, mean±s.e.m., n=3. ***P<0.001 vs vehicle, ###P<0.001 vs E4. TEB, terminal end bud. A full colour version of this figure is available via http://dx.doi.org/10.1530/JOE-14-0549.

  • Effect of combination of E2 and E4 on HBE cell proliferation and mammary gland growth. (A) Effect of E2, E4, and their combination (E2+E4) on HBE cell proliferation measured by [3H]thymidine incorporation and expressed as % of vehicle normalized at 100%, mean±s.e.m. (n=3). *P<0.05, NS, not significant vs vehicle. (B) Computer-assisted quantification of morphological parameters of whole-mount mammary glands from ovariectomized mice orally treated with vehicle (OVX), E2 1 mg/kg per day alone (E2), or associated with E4 used at 0.3, 1, 3, or 10 mg/kg per day (E2+E4) for a period of 6 or 14 days. Ductal tree length and area data are expressed as mean±s.e.m., n=10 glands from five mice. *P<0.05, **P<0.01, ***P<0.001 vs E2 of the corresponding period of 6 or 14 days. (C) Ccnd1 (cyclin D1) mRNA and (D) Mki67 (Ki67) mRNA expression level of epithelial cells isolated from mammary gland of ovariectomized mice orally treated for 14 days with vehicle or with E2 1 mg/kg per day alone or associated with E4 doses ranging from 0.3 to 10 mg/kg per day. Data are expressed as mean±s.e.m., n=5. ***P<0.001 vs E2.

  • Abot A, Fontaine C, Buscato M, Solinhac R, Flouriot G, Fabre A, Drougard A, Rajan S, Laine M & Milon A et al. 2014 The uterine and vascular actions of estetrol delineate a distinctive profile of estrogen receptor α modulation, uncoupling nuclear and membrane activation. EMBO Molecular Medicine 10 13281346. (doi:10.15252/emmm.201404112)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Anderson E, Clarke RB & Howell A 1998 Estrogen responsiveness and control of normal human breast proliferation. Journal of Mammary Gland Biology and Neoplasia 3 2335. (doi:10.1023/A:1018718117113)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Anderson GL, Chlebowski RT, Rossouw JE, Rodabough RJ, McTiernan A, Margolis KL, Aggerwal A, David Curb J, Hendrix SL & Allan Hubbell F et al. 2006 Prior hormone therapy and breast cancer risk in the Women's Health Initiative randomized trial of estrogen plus progestin. Maturitas 55 103115. (doi:10.1016/j.maturitas.2006.05.004)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ayyanan A, Laribi O, Schuepbach-Mallepell S, Schrick C, Gutierrez M, Tanos T, Lefebvre G, Rougemont J, Yalcin-Ozuysal O & Brisken C 2011 Perinatal exposure to bisphenol a increases adult mammary gland progesterone response and cell number. Molecular Endocrinology 25 19151923. (doi:10.1210/me.2011-1129)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Beleut M, Rajaram RD, Caikovski M, Ayyanan A, Germano D, Choi Y, Schneider P & Brisken C 2010 Two distinct mechanisms underlie progesterone-induced proliferation in the mammary gland. PNAS 107 29892994. (doi:10.1073/pnas.0915148107)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brisken C & O'Malley B 2010 Hormone action in the mammary gland. Cold Spring Harbor Perspectives in Biology 2 a003178. (doi:10.1101/cshperspect.a003178)

  • Canonico M 2014 Hormone therapy and hemostasis among postmenopausal women: a review. Menopause 21 753762. (doi:10.1097/GME.0000000000000296)

  • Casimiro MC, Wang C, Li Z, Di Sante G, Willmart NE, Addya S, Chen L, Liu Y, Lisanti MP & Pestell RG 2013 Cyclin D1 determines estrogen signaling in the mammary gland in vivo. Molecular Endocrinology 27 14151428. (doi:10.1210/me.2013-1065)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Clark JH & Markaverich BM 1984 The agonistic and antagonistic actions of estriol. Journal of Steroid Biochemistry 20 10051013. (doi:10.1016/0022-4731(84)90011-6)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Coelingh Bennink F, Holinka CF, Visser M & Coelingh Bennink HJ 2008a Maternal and fetal estetrol levels during pregnancy. Climacteric 11 (Suppl 1) 6972. (doi:10.1080/13697130802056321)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Coelingh Bennink HJ, Heegaard AM, Visser M, Holinka CF & Christiansen C 2008b Oral bioavailability and bone-sparing effects of estetrol in an osteoporosis model. Climacteric 11 (Suppl 1) 214. (doi:10.1080/13697130701798692)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Fenton SE 2006 Endocrine-disrupting compounds and mammary gland development: early exposure and later life consequences. Endocrinology 147 S18S24. (doi:10.1210/en.2005-1131)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Foidart JM, Desreux J, Pintiaux A & Gompel A 2007 Hormone therapy and breast cancer risk. Climacteric 10 (Suppl 2) 5461. (doi:10.1080/13697130701598324)

  • Forster C, Makela S, Warri A, Kietz S, Becker D, Hultenby K, Warner M & Gustafsson JA 2002 Involvement of estrogen receptor β in terminal differentiation of mammary gland epithelium. PNAS 99 1557815583. (doi:10.1073/pnas.192561299)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Frangi I, Keppenne V, Coppens L, Bonnet P, Andrianne R & de Leval J 1998 Antegrade scrotal embolization of varicocele: results. Acta Urologica Belgica 66 58.

  • Giretti MS, Montt Guevara MM, Cecchi E, Mannella P, Palla G, Spina S, Bernacchi G, Di Bello S, Genazzani AR & Genazzani AD et al. 2014 Effects of estetrol on migration and invasion in T47-D breast cancer cells through the actin cytoskeleton. Frontiers in Endocrinology 5 80. (doi:10.3389/fendo.2014.00080)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hagen AA, Barr M & Diczfalusy E 1965 Metabolism of 17-β-oestradiol-4-14-C in early infancy. Acta Endocrinologica 49 207220.

  • Hammond GL, Hogeveen KN, Visser M & Coelingh Bennink HJ 2008 Estetrol does not bind sex hormone binding globulin or increase its production by human HepG2 cells. Climacteric 11 (Suppl 1) 4146. (doi:10.1080/13697130701851814)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Holinka CF, Diczfalusy E & Coelingh Bennink HJ 2008a Estetrol: a unique steroid in human pregnancy. Climacteric 11 (Suppl 1) 1. (doi:10.1080/13697130802040077)

  • Holinka CF, Brincat M & Coelingh Bennink HJ 2008b Preventive effect of oral estetrol in a menopausal hot flush model. Climacteric 11 (Suppl 1) 1521. (doi:10.1080/13697130701822807)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Horwitz KB, Koseki Y & McGuire WL 1978 Estrogen control of progesterone receptor in human breast cancer: role of estradiol and antiestrogen. Endocrinology 103 17421751. (doi:10.1210/endo-103-5-1742)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jozan S, Kreitmann B & Bayard F 1981 Different effects of oestradiol, oestriol, oestetrol and of oestrone on human breast cancer cells (MCF-7) in long term tissue culture. Acta Endocrinologica 98 7380.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lai JN, Wu CT, Chen PC, Huang CS, Chow SN & Wang JD 2011 Increased risk for invasive breast cancer associated with hormonal therapy: a nation-wide random sample of 65,723 women followed from 1997 to 2008. PLoS ONE 6 e25183. (doi:10.1371/journal.pone.0025183)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lambe M, Hsieh C, Trichopoulos D, Ekbom A, Pavia M & Adami HO 1994 Transient increase in the risk of breast cancer after giving birth. New England Journal of Medicine 331 59. (doi:10.1056/NEJM199407073310102)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • LaRocca J, Pietruska J & Hixon M 2011 Akt1 is essential for postnatal mammary gland development, function, and the expression of Btn1a1. PLoS ONE 6 e24432. (doi:10.1371/journal.pone.0024432)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu MM, Albanese C, Anderson CM, Hilty K, Webb P, Uht RM, Price RH Jr, Pestell RG & Kushner PJ 2002 Opposing action of estrogen receptors α and β on cyclin D1 gene expression. Journal of Biological Chemistry 277 2435324360. (doi:10.1074/jbc.M201829200)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu S, Ruan X, Schultz S, Neubauer H, Fehm T, Seeger H & Mueck AO 2014 Oestetrol stimulates proliferation and oestrogen receptor expression in breast cancer cell lines: comparison of four oestrogens. European Journal of Contraception & Reproductive Health Care 12 17. (doi:10.3109/13625187.2014.951997)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mallepell S, Krust A, Chambon P & Brisken C 2006 Paracrine signaling through the epithelial estrogen receptor α is required for proliferation and morphogenesis in the mammary gland. PNAS 103 21962201. (doi:10.1073/pnas.0510974103)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Martucci C & Fishman J 1976 Uterine estrogen receptor binding of catecholestrogens and of estetrol (1,3,5(10)-estratriene-3,15α,16α, 17β-tetrol). Steroids 27 325333. (doi:10.1016/0039-128X(76)90054-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Melamed M, Castano E, Notides AC & Sasson S 1997 Molecular and kinetic basis for the mixed agonist/antagonist activity of estriol. Molecular Endocrinology 11 18681878. (doi:10.1210/mend.11.12.0025)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • O'Brien SH 2014 Contraception-related venous thromboembolism in adolescents. Seminars in Thrombosis and Hemostasis 40 6671. (doi:10.1055/s-0033-1363469)

  • Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV & Johnson KC et al. 2002 Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results From the Women's Health Initiative randomized controlled trial. Journal of the American Medical Association 288 321333. (doi:10.1001/jama.288.3.321)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rudel RA, Fenton SE, Ackerman JM, Euling SY & Makris SL 2011 Environmental exposures and mammary gland development: state of the science, public health implications, and research recommendations. Environmental Health Perspectives 119 10531061. (doi:10.1289/ehp.1002864)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Russo IH & Russo J 1998 Role of hormones in mammary cancer initiation and progression. Journal of Mammary Gland Biology and Neoplasia 3 4961. (doi:10.1023/A:1018770218022)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Scarabin PY 2014 Hormone therapy and venous thromboembolism among postmenopausal women. Frontiers in Hormone Research 43 2132.

  • Soille P 1999 Morphological Image Analysis: Principles and Applications. Berlin Heidelberg: Springer-Verlag.

    • PubMed
    • Export Citation
  • Stahlberg C, Pedersen AT, Lynge E, Andersen ZJ, Keiding N, Hundrup YA, Obel EB & Ottesen B 2004 Increased risk of breast cancer following different regimens of hormone replacement therapy frequently used in Europe. International Journal of Cancer 109 721727. (doi:10.1002/ijc.20016)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sternlicht MD, Kouros-Mehr H, Lu P & Werb Z 2006 Hormonal and local control of mammary branching morphogenesis. Differentiation 74 365381. (doi:10.1111/j.1432-0436.2006.00105.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sturdee DW, Pines A, International Menopause Society Writing Group, Archer DF, Baber RJ, Barlow D, Birkhauser MH, Brincat M, Cardozo L & de Villiers TJ et al. 2011 Updated IMS recommendations on postmenopausal hormone therapy and preventive strategies for midlife health. Climacteric 14 302320. (doi:10.3109/13697137.2011.570590)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tseng L & Gurpide E 1976 Competition of estetrol and ethynylestradiol with estradiol for nuclear binding in human endometrium. Journal of Steroid Biochemistry 7 817822. (doi:10.1016/0022-4731(76)90184-9)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tseng L & Gurpide E 1978 Heterogeneity of saturable estradiol binding sites in nuclei of human endometrium. Estetrol studies. Journal of Steroid Biochemistry 9 11451148. (doi:10.1016/0022-4731(78)90003-1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Turkoz FP, Solak M, Petekkaya I, Keskin O, Kertmen N, Sarici F, Arik Z, Babacan T, Ozisik Y & Altundag K 2013 Association between common risk factors and molecular subtypes in breast cancer patients. Breast 22 344350. (doi:10.1016/j.breast.2012.08.005)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vienonen A, Syvala H, Miettinen S, Tuohimaa P & Ylikomi T 2002 Expression of progesterone receptor isoforms A and B is differentially regulated by estrogen in different breast cancer cell lines. Journal of Steroid Biochemistry and Molecular Biology 80 307313. (doi:10.1016/S0960-0760(02)00027-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Visser M & Coelingh Bennink HJ 2009 Clinical applications for estetrol. Journal of Steroid Biochemistry and Molecular Biology 114 8589. (doi:10.1016/j.jsbmb.2008.12.013)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Visser M, Foidart JM & Coelingh Bennink HJ 2008 In vitro effects of estetrol on receptor binding, drug targets and human liver cell metabolism. Climacteric 11 (Suppl 1) 6468. (doi:10.1080/13697130802050340)

    • PubMed
    • Search Google Scholar
    • Export Citation