Abstract
TWIST proteins are important for development of embryonic skeletal muscle and play a role in the metabolism of tumor and white adipose tissue. The impact of TWIST on metabolism in skeletal muscle is incompletely studied. Our aim was to assess the impact of TWIST1 and TWIST2 overexpression on glucose and lipid metabolism. In intact mouse muscle, overexpression of Twist reduced total glycogen content without altering glucose uptake. Expression of TWIST1 or TWIST2 reduced Pdk4 mRNA, while increasing mRNA levels of Il6, Tnfα, and Il1β. Phosphorylation of AKT was increased and protein abundance of acetyl CoA carboxylase (ACC) was decreased in skeletal muscle overexpressing TWIST1 or TWIST2. Glycogen synthesis and fatty acid oxidation remained stable in C2C12 cells overexpressing TWIST1 or TWIST2. Finally, skeletal muscle mRNA levels remain unaltered in ob/ob mice, type 2 diabetic patients, or in healthy subjects before and after 3 months of exercise training. Collectively, our results indicate that TWIST1 and TWIST2 are expressed in skeletal muscle. Overexpression of these proteins impacts proteins in metabolic pathways and mRNA level of cytokines. However, skeletal muscle levels of TWIST transcripts are unaltered in metabolic diseases.
Introduction
The transcription factors TWIST1 and TWIST2 (also known as DERMO1) are genes belonging to the basic helix–loop–helix (bHLH) transcription factor family, originally described in Drosophila and conserved in humans (Thisse et al. 1987). TWIST1 and TWIST2 form homo- or heterodimers, which together with other bHLH family members bind to the E-box DNA sequence 5′-NCANNTGN-3′ (Castanon et al. 2001). The resulting transcriptional activity depends on post-transcriptional modifications, partner choice, and cellular context, thus complicating the characterization of modes of action of the TWIST proteins (Laursen et al. 2007).
TWIST1 and TWIST2 have overlapping but not identical effects, with TWIST1 being the more thoroughly investigated gene. TWIST proteins play important roles in tissue differentiation. In skeletal muscle, TWIST1 blocks myogenesis via inhibition of MYOD transactivation (Hamamori et al. 1997), which may lead to myotube dedifferentiation (Hjiantoniou et al. 2008). TWIST proteins have also been implicated in cancer as they block p53 and Myc-dependent apoptosis (Maestro et al. 1999). Moreover TWIST1 facilitates the appearance of metastasis by promoting cell migration (Yang et al. 2004), and its expression level correlates with metastasis and poor prognosis in cancer (Hosono et al. 2007, Ou et al. 2008). Mutations in TWIST1 are responsible for Saethre–Chotzen syndrome (OMIM 101400) characterized by craniosynostosis and limb abnormalities. In mice, homozygous deletion of the Twist1 gene results in embryonic lethality, while mice with a deletion of the Twist2 gene die 3 days after birth due to cachexia with high levels of pro-inflammatory cytokines and a complete absence of glycogen stores (Sosic et al. 2003).
A role for TWIST proteins in metabolism has been proposed in adipose tissue, where TWIST1 is reported to regulate cytokine expression (Pettersson et al. 2010). In adipose cells, TWIST1 silencing reduces fatty acid oxidation and modulates pro-inflammatory cytokine expression, in particular IL6 (Dobrian 2012). Furthermore, reduced TWIST1 expression in human white adipose tissue has been correlated with insulin-resistance and obesity (Pettersson et al. 2011). TWIST1 is also a negative feed-back regulator of PGC1α/PPARδ-mediated signaling in brown fat (Pan et al. 2009). The role of TWIST proteins in mature skeletal muscle is less well explored. Based on reported effects of TWIST1 in adipose cells, we hypothesized that TWIST proteins may be involved in skeletal muscle glucose and lipid metabolism, as well as in the regulation of expression of skeletal muscle-derived cytokines.
Materials and methods
Human subjects
Male and female volunteers with type 2 diabetes mellitus (T2D) or normal glucose tolerance (NGT) were matched for weight and BMI. Detailed clinical characteristics of the patients are given in Table 1. As expected, fasting and 2 h glucose levels post oral glucose tolerance test were increased in T2D patients. Patients on insulin treatment and with symptomatic coronary heart disease were excluded. A muscle biopsy of the vastus lateralis and anthropomorphic measurements were taken at enrolment in the study (Barres et al. 2012, Kulkarni et al. 2012). In a separate cohort, 13 sedentary volunteers participated in an exercise training program consisting of 60 min a day, 5 days/week for 3 weeks. Biopsies of the vastus lateralis muscle were obtained before the first and 48 h after the last training bout. This exercise training program increased VO2 max by 13% (P<0.05; Czepluch et al. 2011). The clinical parameters and detailed of the exercise protocol are reported elsewhere (Czepluch et al. 2011). All studies were performed according to the declaration of Helsinki, with informed consent and approved by the ethics committee at Karolinska Institute.
Anthropometric measurements and metabolic parameters of human volunteers. Data are presented as means±s.e.m.
NGT | T2D | |
---|---|---|
n | 10 | 10 |
Sex (F/M) | 5/5 | 4/6 |
Age (y) | 58±2 | 63±1* |
Height (cm) | 171±3 | 170±4 |
Weight (kg) | 84.8±3.6 | 90.8±5.8 |
Waist circumference (cm) | 93.2±2 | 106.0±4* |
BMI (kg/m2) | 29.1±0.6 | 31.3±1.2 |
SBP (mmHg) | 133±5 | 140±3 |
DBP (mmHg) | 79±3 | 78±2 |
FBG (mmol/l) | 5.5±0.0 | 7.9±0.2** |
2-h BG (mmol/l) | 6.6±0.4 | 14.5±1.4* |
HbA1c (%) | 4.6±0.1 | 5.3±0.2* |
Insulin (pmol/l) | 51.4±12.5 | 92.5±16.6* |
HDL (mmol/l) | 1.45±0.33 | 1.24±0.05* |
LDL (mmol/l) | 3.24±0.18 | 2.74±0.28 |
TG (mmol/l) | 51.4±12.8 | 92.5±16.9 |
IL6 (pg/ml) | 1.54±0.37 | 2.23±0.51 |
HOMA-IR | 1.97±0.10 | 3.48±0.30** |
NGT, normal-glucose tolerant; T2D, type 2 diabetes; SBP, systolic blood pressure; DBP, diastolic blood pressure; FBG, fasting blood glucose; HbA1c, glycated hemoglobin; TG, triglycerides; HOMA, homeostatic model assessment of insulin resistance. **P<0.01; *P<0.05.
Mice
C57BL/6J mice (12–14 weeks old) were purchased from Charles River (Sulzfeld, Germany) and acclimatized for at least 1 week before use. Mice were housed in a humidity and temperature-controlled environment with 12 h light:12 h darkness cycle and provided ad libitum access to water and standard rodent chow (4% fat, 16.5% protein, 58% carbohydrates, 3.0 kcal/g purchased from Lantmännen, Stockholm, Sweden). Tissue collection from C57BL/6J-ob/ob and lean +/+ female mice at 14–16 weeks of age was performed after anesthesia using 0.02 ml/g body weight of Avertin (2.5% solution of 99% 2,2,2-tribromo ethanol and tertiary amyl alcohol purchased from Sigma–Aldrich). The muscles were immediately frozen in liquid nitrogen and stored at −80 °C until RNA extraction. The study protocols were approved by the animal ethics committee of Stockholm north.
Plasmid construct
pZsGreen1-C1 construct was purchased from Clontech. The pZsGreen1 (GFP) sequence was removed and replaced with Twist1 or Twist2 sequences. The inserted sequences were species-optimized for mice by Geneart (Regensburg, Germany). The Twist1 and Twist2 DNA sequences were created by GeneArt using the mice protein sequence for TWIST1 (Swiss-Prot: P26687.1) and TWIST2 (Swiss-Prot: Q9D030.1) respectively. The optimization process consisted of DNA sequence adaptation to remove internal TATA-boxes, χ-sites and ribosomal entry sites, AT-rich or GC-rich sequence stretches, RNA instability motifs, repeat sequences and RNA secondary structures, cryptic splice donor, and acceptor sites in higher eukaryotes.
Gene transfer by electroporation in intact skeletal muscle and metabolic analysis
Male C57BL/6 mice (12–14 weeks old) were purchased from Charles River and acclimatized for at least 1 week before use. Mice were housed in a humidity- and temperature-controlled environment with 12 h light:12 h darkness cycle and provided ad libitum access to water and standard rodent chow. Tibialis anterior muscles of adult C57BL/6J mice were transfected with either an empty vector or the vector encoding for TWIST1 or TWIST2 (Clontech) by electroporation as described previously (Kulkarni et al. 2011).
One week after electroporation, mice were fasted for 4 h and subjected to a modified oral glucose tolerance test to assess glucose uptake into skeletal muscle, as described (Witczak et al. 2007, Kulkarni et al. 2011). Electroporated muscle was pulverized on dry ice and separated in three fractions. One fraction was assayed for glycogen content using a glycogen assay kit (Abcam), following the manufacturer instructions. The second fraction was used for RNA extraction. The third fraction was homogenized in ice-cold homogenization buffer (NaCl 137 mmol/l, KCl 2.7 mmol/l, MgCl2 1 mmol/l, Na4O7P2 5 mmol/l, NaF 10 mmol/l, Triton X-100 1%, glycerol 10%, Tris pH 7.8, 20 mmol/l, EDTA 1 mmol/l, phenylmethylsulfonyl fluoride 0.2 mmol/l, Na3VO4 0.5 mmol/l, and protease inhibitor cocktail ×1) (Calbiochem, San Diego, CA, USA; Merck Millipore, Billerica, MA, USA) for protein extraction. Protein content in the supernatant was determined using the Pierce BCA Protein Assay Kit (Thermo Scientific, Waltham, MA, USA). An aliquot of protein lysate was counted in a liquid scintillation counter to assess the accumulation of nonmetabolized 3H-deoxyglucose (WinSpectral 1414, Wallac, Perkin Elmer, Waltham, MA, USA), and radioactivity in counts per minute was normalized by protein concentration.
C2C12 mouse cell line and plasmid transfection
C2C12 cells were obtained from ATCC (Manassas, VA, USA). The cells were grown in high-glucose DMEM (Gibco) with 10% fetal bovine serum (FBS) (Sigma–Aldrich), 1% penicillin–streptomycin (Gibco), and 1% fungizone (Gibco). The medium was changed every second day. C2C12 myoblasts (between passages 9 and 12) were seeded at 2×104 cells/cm2 in a six-well plate (Corning, New York, NY, USA) for 24 h and then transfected with 2 μg Twist1 or Twist2 DNA construct (1 μg/μl) and 6 μl/ml of FuGENE HD (Promega) or FuGENE HD only (as control) in DMEM containing 10% FBS but without antibiotic or antimycotic additions for 24 h. Each condition was performed in triplicate.
mRNA extraction and analysis
mRNA was extracted from 10 mg of skeletal muscle tissue homogenized in 1 ml of TRIzol reagent (Invitrogen) and was purified according to the manufacturer's recommendations. For mRNA extraction from cultured cells, myoblasts were washed three times with PBS and RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and purified with DNAse (Qiagen) according to recommendations of the manufacturer.
RNA concentration was measured with Nanodrop 1000 (Thermo Scientific) and reverse transcribed using the High-capacity cDNA RT Kit (Applied Biosystems). Real-time PCRs were performed in duplicate using TaqMan-based probes in a Step One Plus detector (Applied Biosystems). GAPDH (Hs99999905_m1 for human samples and Mm99999905_m1 for mouse samples) was used as an endogenous control. For mRNA measurement after electroporation, results were compared against the geometrical mean of three different housekeeping genes: GAPDH, HPRT1 (Mm00446968_m1), and TBP (Mm00446971_m1). The following TaqMan primer and probe sets from Applied Biosystems were used: for mouse origin: Il1β: Mm00434228_m1, Tnfα: Mm00443260_g1, Il6: Mm00446190_m1, myogenin: Mm00446195_g1, MyoD: Mm01203489_g1, Pax7: Mm01354484_m1, Twist1: Mm00442036_m1, Twist2: Mm00492147_m1 and for human origin: TWIST1: Hs01675818_s1, TWIST2: Hs02379973_s1. For measurement of plasmid product, custom-made TaqMan primers were designed (Sigma–Aldrich) with the following sequence: Twist1: forward: GAACTGCAGACCCAGCGCGT, probe: CCTGAACGAGGCCTTCGCCG, and reverse: CCTGAACGAGGCCTTCGCCG; Twist2: forward: AGCGCCCAGAGCTTCGAGGA, probe: GCCAACGTGCGCGAGAGACA, and reverse: CGGCGAAGGCCTCGTTCAGG.
Cytokine measurement in C2C12 myoblasts-conditioned media
Following 24 h in transfection medium, C2C12 myoblasts were incubated in a serum-free medium. After 2 h, the medium was changed to a fresh serum-free medium and cells were incubated for 16 h. The medium was then collected and IL6, IL1β, and the TNFα contents in the conditioned culture media were assessed by ELISA following the manufacturer's instructions (Life Technologies; catalogue items: KMC0061, KMC0011, and KMC3011).
Immunoblot analysis
Skeletal muscle lysate was diluted in Laemmli buffer solution and separated by SDS–PAGE. After transfer to nitrocellulose membranes (Bio-Rad), proteins were blocked in 7.5% nonfat milk, washed with TBST (10 mmol/l Tris–HCl, 100 mmol/l NaCl, and 0.02% Tween 20), and incubated with primary antibody overnight at 4 °C. The membranes were washed with TBST and incubated with appropriate HRP-conjugated secondary antibodies (Bio-Rad, diluted 1:25 000). Proteins were visualized by ECL (GE Healthcare, Little Chalfont, UK) and quantified using Quantity One Software (Bio-Rad). Primary antibody for glycogen synthase (GS) (catalogue item: #3893), GS phosphorylated on serine 641 (p-GS) (#3891), ACC (#3676), ACC phosphorylated on serine 79 (p-ACC) (#3661), AKT (or protein kinase B (PKB)) (#9272), and its phosphorylated form on serine 473 (p-AKT) (#9271) were purchased from Cell Signaling (Danvers, MA, USA), GAPDH (#sc-25778) was purchased from Santa-Cruz Biotechnology and TWIST2 (#ab66031) from Abcam (Cambridge, UK). Additional TWIST1 antibodies from Santa-Cruz Biotechnology (#sc-15393 and #sc-6269) and Sigma–Aldrich (#T6451) were also used.
Glycogen synthesis in C2C12 myoblasts
Glucose incorporation to glycogen was determined in C2C12 myoblasts as previously described (Al-Khalili et al. 2003). In brief, after 24 h in transfection medium, cells were serum starved for 2 h. The myoblasts were treated with 120 nM insulin for 30 min before adding 1 μl d-[U-14C] glucose (1 mCi/ml and 289 mCi/mmol; Perkin Elmer, Waltham, MA, USA) for the last 90 min. Following incubation, monolayers were washed with ice-cold PBS and lysed in 0.5 ml 0.03% SDS. The suspension (0.4 ml) was transferred to 2-ml tubes and 0.1 ml (2 mg/sample) carrier glycogen was added. The remaining cell suspension was used for protein concentration determination by the Pierce BCA Protein Assay Kit (Thermo Scientific). The samples were heated to 99 °C for 1 h. Glycogen was precipitated by addition of 95% ethanol and incubated overnight at −20 °C. Glycogen pellets were collected by centrifugation for 15 min at 11 000 g, washed once with 70% ethanol, and resuspended in 0.3 ml distilled water. [14C]labeled glycogen was counted in a liquid scintillation counter (WinSpectral 1414, Wallac). Each experiment was performed in triplicate. Data are average of four independent experiments.
Palmitate oxidation in C2C12 myoblasts
Palmitate oxidation was determined in triplicate samples as previously described (Rune et al. 2009), including nonradioactive palmitate. In brief, 24 h after transfection, C2C12 myoblasts were serum starved for 2 h in DMEM. The medium was changed to 1 ml DMEM containing 25 μM of palmitate including 0.078 μM 3H[9,10-3H(N)] palmitate (5 mCi/ml and 32.0 Ci/mmol) (Perkin Elmer) and 0.04% BSA. The medium was collected 6 h later and cells were harvested for protein determination. In brief, 0.2 ml of collected medium was incubated for 30 min in 0.8 ml of charcoal buffer (10% activated charcoal in 0.02 M Tris–HCl buffer at pH 7.5) and shaken for 30 min. The samples were subjected to centrifugation at 19 000 g for 15 min and 0.2 ml of the supernatant was counted in a liquid scintillation counter (WinSpectral 1414, Wallac).
Statistical analyses
All data are presented as mean±s.e.m. Metabolic data from the electroporated C57BL/6J mice and skeletal muscle gene expression from the exercise training cohort were analyzed using a paired Student's t-test. Differences in gene expression in C2C12 cells, lean vs ob/ob mice, and normal glucose tolerant vs type 2 diabetic participants were analyzed using Student's t-test after natural log transformation. Palmitate oxidation and glycogen synthesis in C2C12 myoblasts were analyzed using a two-way ANOVA, followed by Bonferroni's correction for multiple comparison. The analyses were performed using GraphPad version 5.04 (GraphPad Software, Inc., La Jolla, CA, USA). Comparisons were considered to be statistically significant at P<0.05.
Results
Overexpression of Twist1 or Twist2 in mouse tibialis anterior muscle
Tibialis anterior muscle of C57BL/6J mice was electroporated with a vector containing an optimized sequence for either Twist1 or Twist2, or a control empty plasmid into the contralateral leg. While overexpression did not affect the mRNA level of endogenous Twist, the exogenous transcript was overexpressed 3.3 times for Twist1 and 3.5 times for Twist2 compared with the contralateral muscle receiving the control plasmid (Fig. 1A).
mRNA levels of a number of gene targets of Twist were determined using RT-PCR. As expected from previous investigation (Pan et al. 2009), overexpression of Twist1 and Twist2 tended to reduce PGC1α mRNA expression (−36%±0.06 s.e.m. (P=0.08) when overexpressing Twist1 and −32%±0.05 s.e.m. (P=0.001) when overexpressing Twist2). The early differentiation marker Pax7 was increased following Twist1 overexpression in skeletal muscle (Fig. 1B), and intermediate and late differentiation markers MyoD and myogenin trended in the same direction. TWIST2 overexpression did not alter the expression of these genes (Fig. 1B). Pdk4 mRNA was reduced by 26 and 38% following TWIST1 or TWIST2 overexpression respectively (P<0.05). mRNA levels of inflammatory cytokines IL6, IL1β, and TNFα were increased by more than 60% (Fig. 1B and C, P<0.05).
A modified oral glucose tolerance test including an injection of radiolabeled 2-deoxy-d-glucose was carried out in mice 1 week after electroporation. Total radioactivity in tibialis anterior muscle harvested 2 h after a bolus glucose injection was measured. Glucose uptake was unaltered in skeletal muscle overexpressing either TWIST1 or TWIST2 vs the respective contralateral control muscle (Fig. 1D). In contrast, total glycogen content was decreased by 39 and 28% in tibialis anterior muscle overexpressing TWIST1 and TWIST2 respectively (Fig. 1E, P<0.05).
Overexpression of TWIST2 was confirmed at the protein level in the leg electroporated with Twist2 plasmid as compared with the control leg (Fig. 2). We were unable to obtain an antibody to reliably detect TWIST1 protein by western blot analysis, despite trying three different sources (see section Materials and methods). As TWIST1 and TWIST2 overexpression reduced skeletal muscle glycogen content, despite similar rates of glucose uptake, we measured GS and its inactive phosphorylated fraction (serine 641). However, GS and phospho-GS were unaltered in the skeletal muscle overexpressing TWIST2. In contrast, both total GS protein and its phosphorylated fraction were reduced by 40% by overexpression of TWIST1 (Fig. 2). We determined ACC content and ACC phosphorylation on serine 79. Overexpression of TWIST1 or TWIST2 in skeletal muscle resulted in a reduction in total ACC, without altering the level of phosphorylated protein, suggesting a larger fraction of total ACC in an inactive state (Fig. 2). We also measured AKT and AKT phosphorylation on serine 473. Total AKT protein levels were unchanged by TWIST overexpression, whereas AKT phosphorylation was increased by 2.5-fold by TWIST1 and 1.9-fold by TWIST2 overexpression.
Effect of TWIST1 or TWIST2 overexpression in C2C12 myoblasts
Overexpression of TWIST1 or TWIST2 was observed in cultured C2C12 mouse myoblasts. The experiments were carried out in myoblast cultures because TWIST1 has been shown to lead to dedifferentiation in C2C12 myotubes (Hjiantoniou et al. 2008). Overexpression of TWIST2 increased mRNA levels by more than tenfold (P<0.05, Fig. 3A). Confirming studies reported by other investigators (Hebrok et al. 1997, Murakami et al. 2008), Twist1 mRNA was undetected in cultured C2C12, and thus the overexpression that Twist1 achieved could not be related with endogenous levels. Nevertheless, the overexpression Ct values achieved were similar for Twist1 and Twist2 (24.2 Ct for Twist1 and 25.0 Ct for Twist2 respectively). Similar to the results achieved following the in vivo overexpression, we noted a 30% reduction in Pdk4 mRNA levels and an increase of more than 60% in Il6 mRNA levels (Fig. 3B and C) in cultured myoblasts 24 h after transfection.
We determined the media appearance of Il6, Il1β, and Tnfα in 16-h conditioned media from C2C12 myoblasts. IL6 and TNFα were not detectable under any conditions investigated. The media content levels of IL1β were not significantly altered by overexpression of TWIST1 or TWIST2 (29±7 pg/ml for control, 22±4 pg/ml for TWIST1, and 27±8 pg/ml for TWIST2 respectively, NS)
Glucose incorporation into glycogen and lipid oxidation was determined in myoblasts overexpressing TWIST1 or TWIST2. Insulin increased glucose incorporation by 40% in control myoblasts. However, overexpression of either TWIST1 or TWIST2 did not alter either basal or insulin-stimulated glycogen synthesis (Fig. 4A). Moreover, palmitate oxidation was unaltered in the myoblasts overexpressing either TWIST1 or TWIST2 (Fig. 4B).
Effects of obesity, T2D, or exercise training on Twist expression
The mRNA levels of Twist1 and Twist2 were determined in tibialis anterior muscle from insulin resistant ob/ob mice and lean WT mice. As expected ob/ob mice were heavier than their lean counterparts (55.5 g±2.2 for ob/ob vs 20.7±0.5 for WT, mean±s.e.m., P<0.001) but had not significantly different levels of blood glucose level (13.0±4.5 s.e.m. for the ob/ob vs 7.9±0.3 s.e.m. for the WT, P=0.27). Although a tendency for reduced Twist1 mRNA was noted in tibialis anterior muscle from ob/ob mice (P=0.085), mRNA levels of either Twist1 or Twist2 tibialis anterior were not significantly altered (Fig. 5A). Likewise, TWIST1 mRNA was unaltered in the skeletal muscle from type 2 diabetic patients vs normal glucose tolerant control subjects (Fig. 5B). Finally, the mRNA level was determined in skeletal muscle biopsies from young healthy people before and after a 3-week exercise training program. Although exercise training improved maximal oxygen uptake and other clinical features (Czepluch et al. 2011), mRNA expression of TWIST1 or TWIST2 was unaltered (Fig. 5B).
Discussion
TWIST1 and TWIST2 expression is altered in adipose tissue in the context of metabolic disease and implicated in the regulation of cytokine expression (Sosic et al. 2003, Pan et al. 2009, Pettersson et al. 2010, 2011). We hypothesized that TWIST proteins play a similar role in skeletal muscle. To this end, we induced overexpression of TWIST1 or TWIST2 in tibialis anterior muscle of C57BL/6J mice and cultured mouse C2C12 skeletal muscle myoblast cells. We also determined the effects of obesity, T2D, and exercise training on mRNA levels of TWIST1 and TWIST2 in skeletal muscle from different cohorts. Taken together, while our data support a role for TWIST proteins in metabolic processes, TWIST1 or TWIST2 levels in skeletal muscle are not altered in metabolic disease.
We determined the effect of TWIST1 or TWIST2 overexpression in intact mouse muscle and C2C12 myoblasts. As revealed by RT-PCR, TWIST1 overexpression in differentiated muscle increased the expression of Pax7, a gene involved in early-stage differentiation and an inducer of MyoD transcription (Hu et al. 2008). In line with the increase in Pax7, MyoD mRNA expression displayed a similar trend (P=0.07). Nevertheless, TWIST1 is a known inhibitor of MYOD transactivation (Hamamori et al. 1997) and its overexpression is likely to block any possible effect of an increase in MYOD. Furthermore, mRNA levels of Myogenin revealed a similar trend to MyoD. Interestingly, these three mRNA levels were not altered in skeletal muscle following TWIST2 overexpression, highlighting a specific difference in gene regulation between TWIST1 and TWIST2. The noted changes in mRNA levels of genes important for differentiation in TWIST1-overexpressing skeletal muscle could be due to an increase in cells (re)-entering cell-cycle as a compensation to the de-differentiation stimulus induced by TWIST1 (Hjiantoniou et al. 2008). The lack of change in Pax7 in response to TWIST2 overexpression could reflect the fact that TWIST2 is not critical in the differentiation process of skeletal muscle cells as whole-body knock-out mice are born with similar skeletal muscle mass as WT animals (Sosic et al. 2003).
We determined mRNA expression of several inflammatory cytokines. Our findings were consistent with previous results in human primary white adipocytes whereby TWIST1 silencing reduces mRNA expression of IL6 and TNFα (Pettersson et al. 2010). In contrast, both whole-body knock-out of TWIST2 or siRNA gene silencing of TWIST1 when coupled with TNFα stimulation in cultured adipocytes increases the expression of inflammatory cytokines (Sosic et al. 2003, Pettersson et al. 2011). Thus overexpression and ablation have similar effects, which may initially appear contradictory. However, as TWIST is a bHLH transcription factor, overexpression could have similar effects to silencing where homodimers have opposing effects to those mediated by heterodimers (Firulli et al. 2007, Connerney et al. 2008). Thus, the effects of TWIST proteins on cytokine expression appear to have a U-shaped curve with both extremes triggering a pro-inflammatory response.
We attempted to quantitate media appearance of IL-6 and TNFα secretion in C2C12 myoblasts, but these were below the assay detection limit. Secretion of TNFα and IL6 in C2C12 myoblasts has previously been reported to be close to the detection limit (Chen et al. 2007) or only detectable after 10 ng/ml epinephrine stimulation (Frost et al. 2004). While media content of IL1β was detectable, no significant difference was noted in the expression of this cytokine following overexpression of either TWIST1 or TWIST2. Whether the increased mRNA levels of these cytokines following overexpression of either TWIST1 or TWIST2 would modulate the secretion of differentiated or TNFα-stimulated cells remains to be determined. In a previous study in adipocytes, TWIST1 affected MCP1 but not IL6 secretion following stimulation with TNFα (Pettersson et al. 2011).
Whole-body-targeted ablation of Twist2 in mouse models decreases glycogen stores (Sosic et al. 2003). However, using electroporation-mediated gene transfer, we note that overexpression of TWIST2 depleted muscle glycogen content. These results, although paradoxical, are consistent with the hypothesis that TWIST has analogous effects when ablated or overexpressed. Despite reduced glycogen stores in muscle overexpressing Twist, glucose uptake was unaltered. Based on this observation, we hypothesized that the glucose flux into the cell may be shifted toward the Krebs cycle. Thus, we determined Pdk4 expression because this enzyme is the master regulator of pyruvate dehydrogenase in skeletal muscle (Sugden & Holness 2006). The reduced Pdk4 mRNA expression noted following TWIST overexpression is consistent with an activation of pyruvate dehydrogenase and increased glucose flux into the Krebs cycle, rather than glycogen synthesis. Our results are further supported by a reduction in the total and active (nonphosphorylated) GS in TWIST1-overexpressing skeletal muscle. Whether glycogen phosphorylase or de-branching enzyme activity was altered in TWIST-overexpressing muscle was not assessed in the current study; however, neither basal nor insulin-stimulated glycogen synthesis was altered in TWIST-overexpressing myoblasts. Taken together, our data suggest that overexpression of TWIST1 or TWIST2 results in an increased rate of glycogen utilization.
Overexpression of TWIST1 or TWIST2 in intact mouse muscle resulted in a reduced ACC protein content, which could indicate a decreased fatty acid synthesis capacity. Furthermore, the total level of the phosphorylated form of ACC was unchanged, leading to a larger ratio of inactivated ACC. In cultured C2C12 cells overexpressing TWIST1 or TWIST2, fatty acid oxidation in vitro was unchanged. Thus if glucose utilization is increased while fatty acid oxidation is unaffected, total energy probably increased. This for example could be reflected by an increase in inflammation, as suggested by the increase in inflammatory cytokine transcripts. Cell growth is also an energy-requiring process in which a role for TWIST proteins has been implicated (Shiota et al. 2008, Isenmann et al. 2009). In line with this, AKT Ser473 phosphorylation was increased in TWIST1 or TWIST2-overexpressing muscles 2 h after a glucose challenge. Activation of AKT is closely linked to cell growth and cell survival (Jacinto et al. 2006), two energy-demanding processes. Thus, overexpression of TWIST1 in skeletal muscle reduces glycogen content, while glucose uptake and glycogen synthesis appear unaffected. As fatty acid oxidation is also unchanged, glycogen stores may be utilized for energy-dependent processes partly induced by AKT activation. These results underpin a role of TWIST in facilitation of glucose utilization, which is a key feature in cancer development (Warburg 1956).
We also determined whether TWIST expression in skeletal muscle is altered due to obesity, T2D, or exercise training. While TWIST1 has been previously reported to be undetectable in skeletal muscle (Pettersson et al. 2010), our analysis in human as well as mouse skeletal muscles indicates that there is a consistent and detectable amount of the transcript, which is in agreement with other available expression data (Roth et al. 2006, Hagg et al. 2009). Nevertheless, skeletal muscle TWIST mRNA levels were unaltered by obesity in ob/ob mice, as well as in patients with T2D or after exercise training in healthy people. Thus, alterations in TWIST expression in skeletal muscle do not account for changes in insulin sensitivity in obesity, T2D, or exercise training.
TWIST1 has been implicated in the regulation of IL6 in adipose tissue. As skeletal muscle is also a source of IL6 (Steensberg et al. 2000), we reasoned that TWIST1 may impact IL6 expression in skeletal muscle. ob/ob mice present an extreme obesity phenotype and have higher circulatory levels of IL6 (Harkins et al. 2004). However, as noted above, if anything, Twist1 expression tended to be reduced in skeletal muscle from obese mice, consistent with data associating a reduced Twist1 expression with an increased Il6 expression in adipose tissue (Pettersson et al. 2011). Furthermore, an endurance exercise bout is associated with acute IL6 production (Drenth et al. 1995). While TWIST1 and TWIST2 mRNA levels were unaltered following exercise training, the biopsy was obtained 48 h after the last bout of exercise, when the plasma IL6 concentration returns to baseline level (Ostrowski et al. 1998). Whether exercise training leads to an acute and transient change in TWIST expression remains to be determined. Taken together, the data presented in this study provide evidence that IL6 expression in skeletal muscle is regulated via TWIST1 and TWIST2, but whether acute changes in IL6 expression are dependent on TWIST is currently not known.
In summary, we show that overexpression of TWIST1 or TWIST2 in skeletal muscle increases inflammatory gene expression, reduces glycogen content, promotes glucose utilization and cell growth pathways while reducing cell capacity for fatty acid synthesis but not for fatty acid oxidation. Skeletal muscle expression of TWIST was unaffected by altered metabolic contexts, such as obesity, T2D, or exercise training. Thus, while TWIST proteins are important for skeletal muscle development and alter glucose utilization and glycogen stores in differentiated mature muscle, our data indicate that TWIST expression in skeletal muscle is not altered with metabolic disease, underlining that the role of TWIST is differentiation, tissue, and context dependent.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
The work presented in this paper was supported by the Swedish Institute, the Swedish Research Council, the European Foundation for the Study of Diabetes, Swedish Diabetes Association, Novo Nordisk Research Foundation, Johan and Jakob Söderbergs Foundation, Diabetes Wellness Foundation, Stockholm County Council, the Diabetes Research Program at Karolinska Institute, and the Swedish Society of Medicine.
Author contribution statement
J M M performed the experiments, analyzed and researched data, and wrote the manuscript. F L M S and J M analyzed and researched data, contributed to discussion, reviewed and edited the manuscript. A K designed the study, analyzed data, contributed to discussion, wrote manuscript, and reviewed and edited the manuscript.
References
Al-Khalili L, Chibalin AV, Kannisto K, Zhang BB, Permert J, Holman GD, Ehrenborg E, Ding VD, Zierath JR & Krook A 2003 Insulin action in cultured human skeletal muscle cells during differentiation: assessment of cell surface GLUT4 and GLUT1 content. Cellular and Molecular Life Sciences 60 991–998. (doi:10.1007/s00018-003-3001-3)
Barres R, Yan J, Egan B, Treebak JT, Rasmussen M, Fritz T, Caidahl K, Krook A, O'Gorman DJ & Zierath JR 2012 Acute exercise remodels promoter methylation in human skeletal muscle. Cell Metabolism 15 405–411. (doi:10.1016/j.cmet.2012.01.001)
Castanon I, Von Stetina S, Kass J & Baylies MK 2001 Dimerization partners determine the activity of the Twist bHLH protein during Drosophila mesoderm development. Development 128 3145–3159.
Chen SE, Jin B & Li YP 2007 TNF-α regulates myogenesis and muscle regeneration by activating p38 MAPK. American Journal of Physiology. Cell Physiology 292 C1660–C1671. (doi:10.1152/ajpcell.00486.2006)
Connerney J, Andreeva V, Leshem Y, Mercado MA, Dowell K, Yang X, Lindner V, Friesel RE & Spicer DB 2008 Twist1 homodimers enhance FGF responsiveness of the cranial sutures and promote suture closure. Developmental Biology 318 323–334. (doi:10.1016/j.ydbio.2008.03.037)
Czepluch FS, Barres R, Caidahl K, Olieslagers S, Krook A, Rickenlund A, Zierath JR & Waltenberger J 2011 Strenuous physical exercise adversely affects monocyte chemotaxis. Thrombosis and Haemostasis 105 122–130. (doi:10.1160/TH10-06-0363)
Dobrian AD 2012 A tale with a Twist: a developmental gene with potential relevance for metabolic dysfunction and inflammation in adipose tissue. Frontiers in Endocrinology 3 108. (doi:10.3389/fendo.2012.00108)
Drenth JP, Van Uum SH, Van Deuren M, Pesman GJ, Van der Ven-Jongekrijg J & Van der Meer JW 1995 Endurance run increases circulating IL-6 and IL-1ra but downregulates ex vivo TNF-α and IL-1β production. Journal of Applied Physiology 79 1497–1503.
Firulli BA, Redick BA, Conway SJ & Firulli AB 2007 Mutations within helix I of Twist1 result in distinct limb defects and variation of DNA binding affinities. Journal of Biological Chemistry 282 27536–27546. (doi:10.1074/jbc.M702613200)
Frost RA, Nystrom GJ & Lang CH 2004 Epinephrine stimulates IL-6 expression in skeletal muscle and C2C12 myoblasts: role of c-Jun NH2-terminal kinase and histone deacetylase activity. American Journal of Physiology. Endocrinology and Metabolism 286 E809–E817. (doi:10.1152/ajpendo.00560.2003)
Hagg S, Skogsberg J, Lundstrom J, Noori P, Nilsson R, Zhong H, Maleki S, Shang MM, Brinne B & Bradshaw M et al. 2009 Multi-organ expression profiling uncovers a gene module in coronary artery disease involving transendothelial migration of leukocytes and LIM domain binding 2: the Stockholm Atherosclerosis Gene Expression (STAGE) study. PLoS Genetics 5 e1000754. (doi:10.1371/journal.pgen.1000754)
Hamamori Y, Wu HY, Sartorelli V & Kedes L 1997 The basic domain of myogenic basic helix–loop–helix (bHLH) proteins is the novel target for direct inhibition by another bHLH protein, Twist. Molecular and Cellular Biology 17 6563–6573.
Harkins JM, Moustaid-Moussa N, Chung YJ, Penner KM, Pestka JJ, North CM & Claycombe KJ 2004 Expression of interleukin-6 is greater in preadipocytes than in adipocytes of 3T3-L1 cells and C57BL/6J and ob/ob mice. Journal of Nutrition 134 2673–2677.
Hebrok M, Fuchtbauer A & Fuchtbauer EM 1997 Repression of muscle-specific gene activation by the murine Twist protein. Experimental Cell Research 232 295–303. (doi:10.1006/excr.1997.3541)
Hjiantoniou E, Anayasa M, Nicolaou P, Bantounas I, Saito M, Iseki S, Uney JB & Phylactou LA 2008 Twist induces reversal of myotube formation. Differentiation 76 182–192. (doi:10.1111/j.1432-0436.2007.00195.x)
Hosono S, Kajiyama H, Terauchi M, Shibata K, Ino K, Nawa A & Kikkawa F 2007 Expression of Twist increases the risk for recurrence and for poor survival in epithelial ovarian carcinoma patients. British Journal of Cancer 96 314–320. (doi:10.1038/sj.bjc.6603533)
Hu P, Geles KG, Paik JH, DePinho RA & Tjian R 2008 Codependent activators direct myoblast-specific MyoD transcription. Developmental Cell 15 534–546. (doi:10.1016/j.devcel.2008.08.018)
Isenmann S, Arthur A, Zannettino AC, Turner JL, Shi S, Glackin CA & Gronthos S 2009 TWIST family of basic helix–loop–helix transcription factors mediate human mesenchymal stem cell growth and commitment. Stem Cells 27 2457–2468. (doi:10.1002/stem.181)
Jacinto E, Facchinetti V, Liu D, Soto N, Wei S, Jung SY, Huang Q, Qin J & Su B 2006 SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell 127 125–137. (doi:10.1016/j.cell.2006.08.033)
Kulkarni SS, Karlsson HK, Szekeres F, Chibalin AV, Krook A & Zierath JR 2011 Suppression of 5’-nucleotidase enzymes promotes AMP-activated protein kinase (AMPK) phosphorylation and metabolism in human and mouse skeletal muscle. Journal of Biological Chemistry 286 34567–34574. (doi:10.1074/jbc.M111.268292)
Kulkarni SS, Salehzadeh F, Fritz T, Zierath JR, Krook A & Osler ME 2012 Mitochondrial regulators of fatty acid metabolism reflect metabolic dysfunction in type 2 diabetes mellitus. Metabolism 61 175–185. (doi:10.1016/j.metabol.2011.06.014)
Laursen KB, Mielke E, Iannaccone P & Fuchtbauer EM 2007 Mechanism of transcriptional activation by the proto-oncogene Twist1. Journal of Biological Chemistry 282 34623–34633. (doi:10.1074/jbc.M707085200)
Maestro R, Dei Tos AP, Hamamori Y, Krasnokutsky S, Sartorelli V, Kedes L, Doglioni C, Beach DH & Hannon GJ 1999 Twist is a potential oncogene that inhibits apoptosis. Genes and Development 13 2207–2217. (doi:10.1101/gad.13.17.2207)
Murakami M, Ohkuma M & Nakamura M 2008 Molecular mechanism of transforming growth factor-β-mediated inhibition of growth arrest and differentiation in a myoblast cell line. Development, Growth & Differentiation 50 121–130. (doi:10.1111/j.1440-169X.2007.00982.x)
Ostrowski K, Hermann C, Bangash A, Schjerling P, Nielsen JN & Pedersen BK 1998 A trauma-like elevation of plasma cytokines in humans in response to treadmill running. Journal of Physiology 513 889–894. (doi:10.1111/j.1469-7793.1998.889ba.x)
Ou DL, Chien HF, Chen CL, Lin TC & Lin LI 2008 Role of Twist in head and neck carcinoma with lymph node metastasis. Anticancer Research 28 1355–1359.
Pan D, Fujimoto M, Lopes A & Wang YX 2009 Twist-1 is a PPARδ-inducible, negative-feedback regulator of PGC-1α in brown fat metabolism. Cell 137 73–86. (doi:10.1016/j.cell.2009.01.051)
Pettersson AT, Laurencikiene J, Mejhert N, Naslund E, Bouloumie A, Dahlman I, Arner P & Ryden M 2010 A possible inflammatory role of twist1 in human white adipocytes. Diabetes 59 564–571. (doi:10.2337/db09-0997)
Pettersson AT, Mejhert N, Jernas M, Carlsson LM, Dahlman I, Laurencikiene J, Arner P & Ryden M 2011 Twist1 in human white adipose tissue and obesity. Journal of Clinical Endocrinology and Metabolism 96 133–141. (doi:10.1210/jc.2010-0929)
Roth RB, Hevezi P, Lee J, Willhite D, Lechner SM, Foster AC & Zlotnik A 2006 Gene expression analyses reveal molecular relationships among 20 regions of the human CNS. Neurogenetics 7 67–80. (doi:10.1007/s10048-006-0032-6)
Rune A, Osler ME, Fritz T & Zierath JR 2009 Regulation of skeletal muscle sucrose, non-fermenting 1/AMP-activated protein kinase-related kinase (SNARK) by metabolic stress and diabetes. Diabetologia 52 2182–2189. (doi:10.1007/s00125-009-1465-x)
Shiota M, Izumi H, Onitsuka T, Miyamoto N, Kashiwagi E, Kidani A, Yokomizo A, Naito S & Kohno K 2008 Twist promotes tumor cell growth through YB-1 expression. Cancer Research 68 98–105. (doi:10.1158/0008-5472.CAN-07-2981)
Sosic D, Richardson JA, Yu K, Ornitz DM & Olson EN 2003 Twist regulates cytokine gene expression through a negative feedback loop that represses NF-κB activity. Cell 112 169–180. (doi:10.1016/S0092-8674(03)00002-3)
Steensberg A, van Hall G, Osada T, Sacchetti M, Saltin B & Klarlund Pedersen B 2000 Production of interleukin-6 in contracting human skeletal muscles can account for the exercise-induced increase in plasma interleukin-6. Journal of Physiology 529 237–242. (doi:10.1111/j.1469-7793.2000.00237.x)
Sugden MC & Holness MJ 2006 Mechanisms underlying regulation of the expression and activities of the mammalian pyruvate dehydrogenase kinases. Archives of Physiology and Biochemistry 112 139–149. (doi:10.1080/13813450600935263)
Thisse B, el Messal M & Perrin-Schmitt F 1987 The twist gene: isolation of a Drosophila zygotic gene necessary for the establishment of dorsoventral pattern. Nucleic Acids Research 15 3439–3453. (doi:10.1093/nar/15.8.3439)
Warburg O 1956 On the origin of cancer cells. Science 123 309–314. (doi:10.1126/science.123.3191.309)
Witczak CA, Fujii N, Hirshman MF & Goodyear LJ 2007 Ca2+/calmodulin-dependent protein kinase kinase-α regulates skeletal muscle glucose uptake independent of AMP-activated protein kinase and Akt activation. Diabetes 56 1403–1409. (doi:10.2337/db06-1230)
Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A & Weinberg RA 2004 Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117 927–939. (doi:10.1016/j.cell.2004.06.006)