Abstract
The glucocorticoids bind and activate both the glucocorticoid receptor (GR) as well as the mineralocorticoid receptor in adipocytes. Despite several studies to determine the function of these two receptors in mediating glucocorticoids effects, their relative contribution in adipose tissue expansion and obesity is unclear. To investigate the effect of GR in adipose tissue function, we generated an adipocyte-specific Gr-knockout mouse model (Grad-ko). These mice were submitted either to a standard diet or a high-fat high sucrose diet. We found that adipocyte-specific deletion of Gr did not affect body weight gain or adipose tissue formation and distribution. However, the lack of Gr in adipocyte promotes a diet-induced inflammation determined by higher pro-inflammatory genes expression and macrophage infiltration in the fat pads. Surprisingly, the adipose tissue inflammation in Grad-ko mice was not correlated with insulin resistance or dyslipidemia, but with disturbed glucose tolerance. Our data demonstrate that adipocyte-specific ablation of Gr in vivo may affect the adipose tissue function but not its expansion during a high calorie diet.
Introduction
Glucocorticoids, represented by cortisol in humans and corticosterone in rodents, play an essential role in several steps of adipocyte biology (Peckett et al. 2011). During adipogenesis, glucocorticoids are required to induce the adipogenic transcriptional program allowing the differentiation of preadipocytes to mature adipocytes (Hauner et al. 1989). In the final step of differentiation, glucocorticoids promote also the lipid uptake and lipid storage in mature adipocytes (Berdanier 1989, Fried et al. 1993). In mice, adipocyte-specific amplification of glucocorticoids through selective overexpression of 11βHSD1, the enzyme converting the inactive cortisone to active cortisol, induces central obesity and associated metabolic disorders (Masuzaki et al. 2001). Conversely, adipocyte-specific reduction of glucocorticoids through selective overexpression of 11βHSD2, the enzyme converting the active cortisol to inactive cortisone, protects mice against obesity and diet-induced disorders (Morton et al. 2004, Kershaw et al. 2005). In humans, excess of glucocorticoids (Cushing's syndrome), caused by chronic steroid medications or by abnormal adrenal gland secretion, results in an increase in adipose tissues mass, particularly in the central region (Wajchenberg et al. 1995).
The absence of 11βHSD2 expression in adipocytes allows the glucocorticoids to mediate their effects through binding to the glucocorticoid receptor (GR) as well as the mineralocorticoid receptor (MR). Once activated by the ligand, these receptors mediate two types of responses: an early and a late response. The early response also called the ‘nongenomic response’ is rapid and depends on the activation of secondary messengers triggering the cross-talk with additional signaling pathways (Dooley et al. 2012, Kadmiel & Cidlowski 2013, Faresse 2014). The molecular mechanisms behind the nongenomic responses induced by these steroid receptors are still unclear. The late response also called the ‘classical response’ is endorsed by the intrinsic transcriptional activity of the receptors. MR and GR are mainly cytoplasmic at the basal state. Once activated by the ligand, they translocate to the nucleus as homo- or heterodimers to regulate their target genes. To date, no specific MR response element has been identified in adipocytes and it is accepted that MR shares a common hormone-response-element with GR.
Involvement of MR and GR in the transduction of glucocorticoids effects in adipocytes is still under fervent debates (Armani et al. 2014, Lee & Fried 2014b). We previously found that pharmacological inhibition of both MR and GR abolished the adipogenesis and prevented adipose tissue expansion and adipocyte hypertrophy during a chronic high fat diet (Desarzens et al. 2014). Other studies evidenced that GR has a more prevalent role, compared with MR, in promoting the maturation of preadipocytes (Lee & Fried 2014a). However, divergent reports showed that MR inhibition blocked the adipogenesis in vitro, whereas downregulation of GR did not (Caprio et al. 2007, 2011). Besides their effects on adipocytes growth, glucocorticoids play a well-known anti-inflammatory role, limiting the obesity-induced inflammation in adipose tissue (Fried et al. 1998, Patsouris et al. 2009). However, the relative contribution of MR and GR in this process is not totally resolved. Pharmacological inhibition of MR by eplerenone reduces the expression of pro-inflammatory genes and macrophage infiltration into adipose tissue in obese mice (Guo et al. 2008, Hirata et al. 2009, Lee et al. 2014). Conversely, selective activation of GR by dexamethasone decreases pro-inflammatory cytokine expression and macrophage infiltration into adipose tissue (Fried et al. 1998, Patsouris et al. 2009, Singh et al. 2015). Given that the chronic low-grade inflammation and the activation of the immune system are central in the pathogenesis of obesity-related disorders (Esser et al. 2014, Chen et al. 2015), the clarification of the respective roles of MR and GR in adipocytes becomes crucial.
To better understand the physiological relevance of adipocyte GR on adipose tissue function, we have selectively disrupted GR expression in mouse adipose tissues using Cre-loxP-mediated recombination. We found that reduction of GR expression in adipose tissue was not essential for adipose tissue growth and did not lead to major metabolic disturbances on a standard or a high caloric diet. However, in accordance to the anti-inflammatory role of GR, we found that adipocyte Gr deletion promoted pro-inflammatory markers expression and macrophage infiltration in adipose tissue.
Materials and methods
Animal experiments
Animal studies were carried out in accordance to Swiss animal welfare regulations after successful evaluation by the veterinarian office of the Canton of Zurich, Switzerland. To establish the Grad-ko mice, we first crossed homozygous Gr floxed mice (Tronche et al. 1999), with transgenic mice expressing the Adipoq-Cre (B6;FVB-Tg(Adipoq-cre)1Evdr/J, Jackson Laboratories). In this study, 8-week-old littermate male mice Grfl/fl and Grad-ko in C57BL/6 background were fed either standard chow (4.2% fat, 10.8% sucrose by weight) or high-fat high sucrose diets (21.2% fat, 34.5% sucrose by weight, TD.88137 Harlan Laboratories, Venray, the Netherlands) and the body weight was monitored weekly. After 15 weeks, mice were singly housed in metabolic cages (Techniplast, Buguggiate, Italy) for 4 days after 3 days of gradual adaptation to measure manually water/food consumption and for collection of urine/feces. Mice were then anesthetized by isoflurane inhalation for blood collection and killed for tissue collection. For the ITT and GTT, insulin (0.75U/kg body weight) or glucose (2.5g/kg body weight) was injected intraperitoneally and blood was collected from the tail vein at indicated time points. Blood glucose was measured using the glucometer Accu-Check (Roche).
Adipocytes and stromal vascular fraction isolation
The epididymal, inguinal and peri-renal fat pads mice were dissected, pooled according to the genotype, washed with PBS and were subsequently finely minced. The extracellular matrix was digested by collagenase (1mg/mL; 60min at 37°C under constant agitation). Enzyme activity was neutralized with DMEM containing 10% FBS, and the digested tissue was filtered with a 100µm nylon filter and centrifuged for 5min at 1200 g at room temperature. Floating adipocytes were collected and washed twice with PBS. The pelleted stromal vascular cells were washed twice with erythrocyte lysis buffer (155mM NH4Cl; 10mM KHCO3; 0.1mM EDTA, pH=7.3). Cell lysates were extracted and submitted to immunoblotting as described previously (Faresse et al. 2012).
Blood metabolites
Blood was withdrawn from anesthetized animals between 09:00 h and 11:00h. Quantification of corticosterone in plasma was performed using a commercial kit (ENZO, ADI-900-097). Insulin levels were determined using a commercial kit (Sigma, RAB017) as well as the FFAs (Sigma, MAK044) according to the manufacturer’s protocol. The glucose, cholesterol, HDL cholesterol and triglycerides levels were measured by the Zurich Integrative Rodent Physiology (ZIRP) core facility of the University of Zurich using standard techniques. Liver triglycerides content was measured after lysis and extraction of the triglycerides using a commercial kit (Abcam).
Histology
Collected tissues were fixed with 4% paraformaldehyde in PBS for 48h and embedded in paraffin blocs. Ten-micrometer sections were stained with hematoxylin and eosin. Images were acquired under a light microscope and the size of adipocytes was determined using ImageJ software (NIH).
Real-time quantitative PCR
Total RNA was extracted using the RNeasy Mini Kit (Qiagen) and was reverse transcribed using RevertAidTM cDNA Synthesis Kit (Thermo Scientific). Sequences of primers are indicated in Table 1. Quantitative RT-PCR was performed in duplicate for each sample in a Light Cycler 480 Real-Time PCR System by using Master I SYBR Green qPCR Master Mix (Roche), according to the manufacturer’s instructions. Relative amounts of mRNA were determined using the 2-ΔΔCt method for the quantification and were normalized to Gapdh mRNA expression, for which Ct values remain unaltered between genotypes or diets.
Primer sequences used in qRT-PCR experiments.
| Genes | Forward | Reverse |
|---|---|---|
| Cebpα | GACAAGAACAGCAACGAGTA | AGCTGGCGGAAGATGC |
| Gr | ATTATGGGGTGCTGACGTG | GACATTTTCGATAGCGGCAT |
| Mr | AGTTCCTTTCCGCCTGTCAA | TGACACCCAGAAGCCTCATC |
| 11βHsd1 | CTTCCATGACGACATCCACT | AAAAGAACCCATCCAGAGCA |
| Pparγ | TTCACAAGAGCTGACCCAAT | AAGCCTGATGCTTTATCCCC |
| Cebpα | GACAAGAACAGCAACGAGTA | AGCTGGCGGAAGATGC |
| Lpl | GGAGGTGGACATCGGAGAAC | ACACTGCTGAGTCCTTTCCC |
| Glut4 | ACACTGGTCCTAGCTGTATTCT | CCAGCCACGTTGCATTGTA |
| Fas | AAGCGGTCTGGAAAGCTGAA | TCTGAACCACTCACACCCAC |
| Srebp1 | AGCCACACTTCATCAAGGCA | GTGGATGGGCAGTTTGTCTG |
| Lipocalin 2 | GTCGCTACTGGATCAGAACA | CTTGGTTCTTCCATACAGGGT |
| Il1β | TGCCACCTTTTGACAGTGATG | TGATGTGCTGCTGCGAGATT |
| Mcp1 | GTCACCAAGCTCAAGAGAGA | GTGGAAAAGGTAGTGGATGC |
| Tnfα | CCCCAAAGGGATGAGAAGTT | TCTTTGAGATCCATGCCGTT |
| Il6 | TCTCTGGGAAATCGTGGAAA | CCAGGTAGCTATGGTACTCC |
| Leptin | CTGGCAGTCTATCAACAGGTC | TCCACCTCTGTGGAGTAGAG |
| Vegf | GTGGACATCTTCCAGGAGTACC | TGCTGTAGGAAGCTCATTCTCT |
| Adiponectin | TGCCGAAGATGACGTTACTA | TCTCACCCTTAGGACCAAGA |
| Hgf | GGTGTTTCACAAGCAATCCA | GCCCTTGTCGGGATATCTTT |
| Cd68 | AAAAGGCCGTTACTCTCCTG | TGTGGCATGAGAAATTGTGG |
| F4/80 | GTGCCATCATTGCGGGATTC | TGGAAGCCCATAGCCAAAGG |
| Gapdh | CCA TCA CCA TCT TCC AGG AG | TCC ATG GTG GTG AAG ACA C |
Immunoblotting
Tissue extracts were prepared as previously described and 30µg protein extracts were subjected to SDS–PAGE and immunoblotting (Faresse et al. 2010). The antibodies and dilutions used are indicated in Table 2. Detection of proteins was performed using a chemi-luminescence kit (GE HealthCare) and autoradiography films. Quantification of the immunoblots was performed using ImageJ software (NIH).
Antibody origin and dilution.
| Peptide/protein target | Name of antibody | Manufacturer catalog number | Species | Dilution |
|---|---|---|---|---|
| Glucocorticoid receptor | GR M-20 | Santa Cruz No. sc1004 | Rabbit polyclonal | 1/1000 |
| Mineralocorticoid receptor | MR | Provided by C Gomez-Sanchez | Mouse monoclonal | 1/100 |
| HSP90 | HSP90 | Cell Signaling No. 4877 | Rabbit polyclonal | 1/1000 |
| p38 MAPK | p38 | Cell Signaling No. 9212 | Rabbit polyclonal | 1/500 |
| phospho-p38 MAPK | P-p38 | Cell Signaling No. 4092 | Rabbit polyclonal | 1/1000 |
| c-Jun N-terminal kinase | JNK | Santa Cruz No. sc-571 | Rabbit polyclonal | 1/500 |
| phospho-JNK | P-JNK | Santa Cruz No. sc-6254 | Rabbit polyclonal | 1/1000 |
| Extracellular signal-regulated kinases1/2 | ERK1/2 | Santa Cruz No. C-14 | Rabbit polyclonal | 1/1000 |
| phospho-ERK1/2 | P-ERK | Santa Cruz No. E-4 | Rabbit polyclonal | 1/1000 |
| β-actin | anti-actin | Cell Signaling No. 3700 | Mouse monoclonal | 1/2000 |
Statistical analyses
All data are presented as mean ± s.e.m. and were analyzed by unpaired two-tailed Student’s t-test for comparisons of two groups, and two-way ANOVA with Bonferroni post hoc analyses for comparisons of multiple groups. P-values of <0.05 were considered to be significant. The statistical analyses were performed using Prism 5 software (GraphPad).
Results
Generation of adipocyte-specific Gr-KO mice
To establish the adipocyte-specific deletion of Gr, we crossed homozygous Gr floxed mice in which the exon 3 was flanked with loxP sites (Tronche et al. 1999), with the transgenic Adipoq-Cre, constitutively expressing the Cre recombinase under the control of the adiponectin promotor (Wang et al. 2010). The resulting Adipoq-Cre Grfl/fl mice (hereafter termed Grad-ko mice) were viable and present no anatomical differences compared with the control group (Grfl/fl mice). To validate the GR deletion effectiveness at the transcriptional level, isolated mRNA from different tissues were analyzed by qRT-PCR. We found that GR expression was significantly reduced in the epididymal, inguinal and peri-renal white adipose tissue but not in other organs analyzed (Fig. 1A). The evaluation of GR protein level in epididymal and peri-renal white adipose tissue showed also a major reduction in its expression of about 55% (Fig. 1B). To assess whether the remaining GR expression in Grad-ko mice was due to the nonadipocyte cells or to an incomplete deletion, we evaluated the GR protein expression in isolated mature adipocytes and stromal vascular fraction by immunoblot. We found that the stromal fraction from Grad-ko mice expressed a similar GR level than of Grfl/fl mice, but GR expression in isolated mature adipocyte was totally abrogated (Fig. 1C). Testing for a potential compensatory mechanism related to the GR deletion, we found that the mRNA expression level of Mr was slightly but not significantly upregulated. Furthermore, the mRNA level of 11βHsd1 was also not increased as expected, but rather downregulated (Fig. 1D). Finally, evaluation of the plasmatic corticosterone levels under anesthesia, which may affect glucocorticoid levels (Teilmann et al. 2014), did not show differences between the genotypes (Fig. 1E). Taken together, these data suggested that Grad-ko mice have an efficient deletion of Gr in the adipose tissue, with no detectable genetic or hormonal compensation.
Adipocyte-specific deletion of Gr. (A) The abundance of Gr mRNA expression relative to Gapdh was assessed by qRT-PCR in epididymal (eWAT), inguinal (inWAT), peri-renal (prWAT) and interscapular brown (BAT) adipose tissue, and in brain, liver and kidney of Grfl/fl and Grad-ko mice. (B) Epididymal and peri-renal fat lysates from Grfl/fl and Grad-ko mice were subjected to immunoblotting using antibodies against GR and actin as a loading control. (C) Lysates from isolated SVF and adipocytes were subjected to immunoblotting using antibodies against GR and HSP90 as a loading control. (D) The abundance of Mr and 11βHsd1 mRNA relative to Gapdh in eWAT was measured by qRT-PCR. (E) Plasma concentration of corticosterone in anesthetized Grfl/fl and Grad-ko mice. Values are mean ± s.e.m. **P<0.01, ***P<0.001, Grfl/fl vs Grad-ko.
Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0121
Adipocyte-specific deletion of Gr has no effect on adipose tissue growth
To test the hypothesis that adipocyte GR plays a central role in adipose tissue formation, we placed Grfl/fl and Grad-ko 8-week-old mice either on a standard chow diet (CD) or a high-fat high sucrose diet (HFSD) for 15 weeks and the body weight was assessed weekly. The HFSD significantly increased the body weight in Grfl/fl and Grad-ko mice, but no differences were observed between the genotypes (Fig. 2A). Grfl/fl and Grad-ko mice showed no differences in daily food and water intake, urine, feces production and observable activities either on CD or HFSD (Fig. 2B and C). We then evaluated the adiposity of the different groups of mice by isolation of white fat pads present in the inguinal, epididymal, mesenteric and peri-renal regions. The HFSD significantly increased the fat mass in all regions, but no differences were detected between Grfl/fl and Grad-ko mice. Moreover, histological analysis of the adipose tissue revealed no differences between genotypes concerning the adipocytes size (median on CD, Grfl/fl: 2406µm2 vs Grad-ko: 2470µm2, median on HFSD, Grfl/fl: 8118µm2 vs Grad-ko: 8063µm2).
Adipocyte Gr deletion did not affect adiposity. Grfl/fl and Grad-ko male mice were fed a CD or HFSD for 15 weeks starting from 8 weeks of age (n=8–11 for each group). The absolute body weight (A), the ratio between food consumption and feces production (B), the ratio between water intake and urine production (C) and the fat depots mass (D) were determined for each mice. (E) Representative histological images of epididymal adipose tissue fixed and stained with hematoxylin and eosin. Scale bar, 50 µm. (F) The distribution frequency of adipocytes according to cell surface was calculated using ImageJ software (n=300 adipocytes from three mice for each group). All values are given as mean ± s.e.m., ## P<0.01, ### P<0.001 CD vs HFSD.
Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0121
Grad-ko mice did not present defects in lipid storage
Disorders in adipose tissue function may lead to defects in proper storage of energy in adipocytes. To test whether the lipid storage was affected in Grad-ko mice, we measured the plasmatic levels of free fatty acids, triglycerides, cholesterol and HDL cholesterol in Grfl/fl and Grad-ko mice fed a CD or an HFSD. Except for a slight decrease in triglyceride levels on a CD, we did not observe abnormal concentrations of these metabolites in the plasma of Grad-ko mice, suggesting a comparable lipids handling to Grfl/fl mice (Fig. 3A, B, C and D). A dysfunction of adipose tissue may also lead to ectopic lipid deposition in the liver leading to an enlargement of the liver, inflammation, fibrosis and several associated disorders (Rasouli et al. 2007). Therefore, we evaluated the liver weight of Grfl/fl and Grad-ko mice on both diets. We found that the HFSD increased significantly the liver mass without differences between the genotypes (Fig. 3E). Assessment of the triglycerides content of the liver confirmed that the HFSD increased the lipid accumulation in the liver similarly in Grfl/fl and Grad-ko mice (Fig. 3F).
Lipid handling is not disturbed in adipocyte Grad-ko mice. Plasma concentration of free fatty acids (A), cholesterol (B), triglycerides (C), HDL cholesterol (D), liver mass (E) and liver triglycerides (F) were evaluated in Grfl/fl and Grad-ko mice fed a CD or a HFSD for 15 weeks. All values are given as mean ± s.e.m. (n=6 for each group), # P<0.05, ### P<0.001 CD vs HFSD.
Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0121
Normal insulin sensitivity and perturbed glucose tolerance in Grad-ko mice
To further characterize the effects of Gr deletion in adipocytes, we examined the response of Grad-ko mice to glucose and insulin. The glucose and insulin levels trended higher on HFSD compared with CD, but no differences were detected between Grfl/fl and Grad-ko mice (Fig. 4A and B). We then performed a glucose tolerance test by injecting 2.5g/kg of body weight of glucose solution intra-peritoneally (Fig. 4C and D). If no difference was observed on CD, we found that control mice were more resistant to glucose loading compared with Grad-ko mice on HFSD. The areas under the curves revealed a significant increase for Grad-ko mice on HFSD vs CD, but not for Grfl/fl mice (Fig. 4E). Then, we performed an insulin tolerance test to evaluate the insulin sensitivity of each group of mice. Injection of 0.75U/kg of body weight of insulin solution intra-peritoneally led to a similar lowering of glycemia between Grfl/fl and Grad-ko mice in both CD and HFSD (Fig. 4F and G) and similar areas under the curves (Fig. 4H).
Normal insulin sensitivity and disturbed glucose handling in Grad-ko mice. Plasma concentration of glucose (A) and insulin (B) in Grfl/fl and Grad-ko mice fed a CD or a HFSD for 15 weeks. Glucose tolerance test (GTT) (C and D), insulin tolerance test (ITT) (F and G) and the area under the curve (AUC) (E and H) during the tests in Grfl/fl and Grad-ko on a CD or HFSD. All values are given as mean ± s.e.m. (n=6 for each group), # P<0.05, ## P<0.01 CD vs HFSD.
Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0121
Gr deletion in adipocytes promotes obesity-mediated inflammation of the adipose tissue
Glucocorticoids via the glucocorticoid receptor have been proposed to regulate several aspects of adipocyte function including adipogenesis (Lee & Fried 2014a), inflammation (Lee et al. 2011, Singh et al. 2015) or endocrine functions (Lee & Fried 2014a, Lee et al. 2014). To test these previous findings in vivo, we analyzed the expression levels of a panel of key genes expressed by adipocytes involved in lipogenesis, inflammation and secreted adipokines in diet-induced obese Grfl/fl and Grad-ko mice. As shown in Fig. 5A, Gr deletion has a slight or no effects on lipogenic genes as well as adipokines expression. However, pro-inflammatory markers tended to be higher in Grad-ko mice, particularly TNFα and lipocalin-2, two important markers of obesity-mediated low-grade inflammation in adipose tissue (Fig. 5A). To test whether Gr deleted mice showed a higher adipose tissue inflammation, we assessed the macrophage infiltration in adipose tissue from Grfl/fl and Grad-ko mice fed a HFSD. It has been shown that the large majority of macrophages infiltrating the adipose tissue of obese animals and humans is arranged around dead adipocytes, forming characteristic crown-like structures (Cinti et al. 2005). Histological analysis of adipose tissue from HFSD-fed Grfl/fl and Grad-ko mice quantitatively showed more crown-like structures in Grad-ko than Grfl/fl mice (Fig. 5B). This observation was confirmed by evaluating the expression levels of specific macrophage markers (CD68 and F4/80) that were higher in Grad-ko compared with Grfl/fl (Fig. 5C). Clinical evidences demonstrated that serum concentrations of lipocalin-2 are closely associated with obesity and its related chronic inflammation (Wang et al. 2007). Quantification of this glycoprotein showed a significantly higher plasma concentration in Grad-ko mice (Fig. 5D). Finally, pro-inflammatory changes in adipose tissue have been shown to activate stress kinase signaling pathways, including JNK, ERK1/2 and P38 (Hirosumi et al. 2002). In our model, Gr deletion significantly increased the activation of JNK without detectable effects on ERK1/2 or P38 (Fig. 5E and F).
Adipocyte Gr deletion promotes diet-induced inflammation. (A) The abundance of key genes involved in lipogenesis, inflammation and adipokines expression was evaluated by qRT-PCR in epididymal fat from Grfl/fl and Grad-ko mice fed a HFSD (n=5 per group). (B) Representative histological images of epididymal adipose tissue fixed and stained with hematoxylin and eosin. The red arrows indicate the crown-like structures. Scale bar, 50 µm. (C) The abundance of macrophage markers Cd68 and F4/80 mRNA relative to Gapdh in adipose tissue was measured by qRT-PCR. (D) Plasma concentration of Lipocalin 2. (E) Epididymal lysates were submitted to immunoblotting using antibodies against MR, GR, phospho-JNK, JNK, phospho-ERK1/2, ERK1/2, phospho-P38, P38 and actin as a loading control. (F) Immunoblots were quantified by Image J and normalized to actin. * P<0.05, GRfl/fl vs Grad-ko. A full colour version of this figure is available at http://dx.doi.org/10.1530/JOE-16-0121.
Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0121
Discussion
Glucocorticoids excess is a well-known disorder mediating an increase in adiposity in humans and rodent models. At the cellular level, glucocorticoids are required to induce the differentiation of preadipocytes to mature adipocytes (Chapman et al. 1985, Lee et al. 2014), and act synergistically with insulin to upregulate lipogenesis (Minshull & Strong 1985, Gathercole et al. 2011). However, whether the glucocorticoids effects on adipose tissue are mediated by GR or MR remains unclear. Several studies attempted to elucidate the relative contribution of these steroid receptors in glucocorticoids effects (Caprio et al. 2007, Hirata et al. 2012, Armani et al. 2014, Lee & Fried 2014a). In addition to the conflicting results obtained, most of the deductions were based on in vitro observations and all the studies resulted in same conclusions about the crucial need of adipose-specific Mr or Gr-knockout mice. In this study, we found that adipocyte-specific Gr deletion did not affect adipose tissue expansion, fat distribution and did not induce major metabolic disturbances either on standard diet or during a high caloric diet. These findings would suggest that GR plays a minor role in the transduction of glucocorticoids-mediated lipogenesis in adipocytes in vivo. However, one limitation of this study is the tissue-specific adiponectin promotor that drives the expression of the Cre recombinase only in mature adipocytes and not in the early stages of differentiation, according to the adiponectin expression (Korner et al. 2005). Given the importance of glucocorticoids in the early steps of adipogenesis, our mouse model is suitable to study the function of GR in fully mature adipocytes but not in the formation of new adipocytes.
Our results differ from the recently published study from de Kloet et al., showing a resistance to diet-induced obesity in a case of adipocyte GR deficiency (de Kloet et al. 2015). The authors observed that an acute exposure to a high fat diet (one week) was sufficient to detect a significant lower body weight in Gr-deficient mice. This difference was maintained until 5 weeks of diet and was principally due to a lower adiposity. In our study, despite a higher deletion efficiency of Gr (mRNA reduction of 74% vs 20% in eWAT), we did not observe any detectable difference between the genotypes even during the first weeks of diets. Such a discrepancy may have different explanations. In both studies, the same adiponectin-Cre mice were crossed with different Gr floxed mice. In our case, the exon 3 encoding the DNA-binding domain of GR was floxed, whereas in de Kloet study, the exon 2 encoding the activation function-1 (Af1) domain was floxed. Notably, it was shown that disruption of exon 2 of Gr gene may yield to a ligand-responsive C-terminal fragment that maintains its ability to regulate gene expression (Mittelstadt & Ashwell 2003). Furthermore, in our study the food was supplemented with high sucrose and the fat distribution analysis was performed after 15 weeks of diet, whereas in de Kloet study, the mice were fed a high fat diet and the body composition was analyzed only after 5 weeks of diet.
In addition to adipose tissue growth, the potent anti-inflammatory role of glucocorticoids/GR signaling is well-studied and synthetic GR agonists have become widely used for therapy (De Bosscher & Haegeman 2009). This anti-inflammatory action is explained by the genomic and nongenomic properties of GR. The nongenomic pathway involves the direct interaction of GR with the MAPK protein JNK in the cytoplasm, suppressing the activation of this pro-inflammatory pathway (De Bosscher & Haegeman 2009). The genomic action is mediated through the nuclear translocation of the receptor and activation of key anti-inflammatory genes (MKP1, IL10, Annexin-1) and repression of pro-inflammatory genes (TNFα, IL6, IL1β) (De Bosscher & Haegeman 2009, Nixon et al. 2012). Obesity is described as a low-grade inflammatory state with increased macrophage infiltration in adipose tissue contributing to insulin resistance and metabolic dysfunction (Gregor & Hotamisligil 2011). However, recently a provocative study showed that adipocyte inflammation is also essential for healthy adipose tissue expansion and remodeling (Wernstedt Asterholm et al. 2014). In our study, we found that adipocyte-specific Gr deletion increased pro-inflammatory cytokine expression, macrophage infiltration and activation of the stress kinase JNK in adipose tissue. These findings can be paralleled with in vitro and in vivo pharmacological studies showing that GR activators decrease whereas GR blockers increase pro-inflammatory adipokines expression and macrophage infiltration into adipose tissue (Patsouris et al. 2009, Hoppmann et al. 2010, Nikolic et al. 2013). Furthermore, the significant reduction of 11βHsd1 mRNA expression, that has been shown to be indirectly regulated by GR and dampen the inflammation process (Sai et al. 2008, Randall et al. 2014), may also contribute to the higher inflammation observed in Grad-ko mice. Adipocytes size, another hallmark of obesity, is also highly correlated with systemic insulin resistance, dyslipidemia and development of type 2 diabetes (McLaughlin et al. 2010, Yang et al. 2012). In our mouse model, we could not detect differences in adipocytes size, neither during chow nor high caloric diet and the higher inflammatory state was not paralleled with disturbances in insulin sensitivity or lipid handling. Nevertheless, the Grad-ko appeared to be less tolerant to glucose loading when fed a high caloric diet that may be secondary to the increase of adipose tissue inflammation observed in these animals. Hence, the connection between inflammation, adipocytes size and metabolic disorders in our Grad-ko mouse model would certainly benefit from deeper investigations.
Due to the higher accumulation of fat in the central region during glucocorticoids excess (Wajchenberg et al. 1995), it was thought that visceral fat is more sensitive to glucocorticoids than the subcutaneous fat. This theory was supported by the fact that GR expression is higher in the omentum than in the subcutaneous fat (Miller et al. 1987, Pedersen et al. 1994). However, in our Grad-ko mouse model fed either a chow or a high caloric diet, the weight of the inguinal, epididymal, mesenteric or peri-renal fat pads was not affected, suggesting that the relative abundance of GR did not explain the depot-specific differences in glucocorticoids actions. Rather, the higher expression of MR and 11βHSD1 in the visceral adipose tissue may have a more prominent role in these differences (Hirata et al. 2012). If our observations did not allow a conclusion about MR, the fact that glucocorticoids bind to MR with ten-fold higher affinity than GR (Arriza et al. 1987), the high concentration of circulating glucocorticoids (100–1000-fold higher than aldosterone) and the increase of adipocytes MR expression during adipogenesis and obesity (Caprio et al. 2007, Hirata et al. 2009), it may be probable that glucocorticoids mediate their effects mainly through MR.
In summary, our findings brought a first piece of in vivo evidences about the role of GR in adipose tissue. We found that adipocyte GR has a negligible role in the regulation of body weight and adiposity in a standard as well as a high caloric diet. Furthermore, the absence of GR in adipocytes did not cause major metabolic disorders but promoted the diet-induced inflammation in adipose tissue.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work has been supported by the Swiss National Science Foundation Ambizione PZ00P3_142594/1, the National Centre of Competence in Research (NCCR) Kidney.CH Junior grant and an Olga Mayenfisch grant.
Author contribution statement
N F conceived and designed the experiments; S D performed the experiments; S D and N F analyzed the data; and N F wrote the paper.
Acknowledgments
The authors gratefully acknowledge J Loffing and his laboratory for their precious help to achieve this study.
References
Armani A, Marzolla V, Rosano G & Caprio M 2014 Mineralocorticoid vs glucocorticoid: solo players or team mates in the control of adipogenesis? International Journal of Obesity 38 1580–1581. (doi:10.1038/ijo.2014.68)
Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE & Evans RM 1987 Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237 268–275. (doi:10.1126/science.3037703)
Berdanier CD 1989 Role of glucocorticoids in the regulation of lipogenesis. FASEB Journal 3 2179–2183.
Caprio M, Feve B, Claes A, Viengchareun S, Lombes M & Zennaro MC 2007 Pivotal role of the mineralocorticoid receptor in corticosteroid-induced adipogenesis. FASEB Journal 21 2185–2194. (doi:10.1096/fj.06-7970com)
Caprio M, Antelmi A, Chetrite G, Muscat A, Mammi C, Marzolla V, Fabbri A, Zennaro MC & Feve B 2011 Antiadipogenic effects of the mineralocorticoid receptor antagonist potential implications for the treatment of metabolic syndrome. Endocrinology 152 113–125. (doi:10.1210/en.2010-0674)
Chapman AB, Knight DM & Ringold GM 1985 Glucocorticoid regulation of adipocyte differentiation: hormonal triggering of the developmental program and induction of a differentiation-dependent gene. Journal of Cell Biology 101 1227–1235. (doi:10.1083/jcb.101.4.1227)
Chen L, Chen R, Wang H & Liang F 2015 Mechanisms linking inflammation to insulin resistance. International Journal of Endocrinology 2015 508409. (doi:10.1155/2015/508409)
Cinti S, Mitchell G, Barbatelli G, Murano I, Ceresi E, Faloia E, Wang S, Fortier M, Greenberg AS & Obin MS 2005 Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. Journal of Lipid Research 46 2347–2355. (doi:10.1194/jlr.M500294-JLR200)
De Bosscher K & Haegeman G 2009 Minireview: latest perspectives on antiinflammatory actions of glucocorticoids. Molecular Endocrinology 23 281–291. (doi:10.1210/me.2008-0283)
de Kloet AD, Krause EG, Solomon MB, Flak JN, Scott KA, Kim DH, Myers B, Ulrich-Lai YM, Woods SC & Seeley RJ et al. 2015 Adipocyte glucocorticoid receptors mediate fat-to-brain signaling. Psychoneuroendocrinology 56 110–119. (doi:10.1016/j.psyneuen.2015.03.008)
Desarzens S, Liao WH, Mammi C, Caprio M & Faresse N 2014 Hsp90 blockers inhibit adipocyte differentiation and fat mass accumulation. PLoS ONE 9 e94127. (doi:10.1371/journal.pone.0094127)
Dooley R, Harvey BJ & Thomas W 2012 Non-genomic actions of from receptors and signals to membrane targets. Molecular and Cellular Endocrinology 350 223–234. (doi:10.1016/j.mce.2011.07.019)
Esser N, Legrand-Poels S, Piette J, Scheen AJ & Paquot N 2014 Inflammation as a link between obesity, metabolic syndrome and type 2 diabetes. Diabetes Research and Clinical Practice 105 141–150. (doi:10.1016/j.diabres.2014.04.006)
Faresse N 2014 Post-translational modifications of the mineralocorticoid how to dress the receptor according to the circumstances? Journal of Steroid Biochemistry and Molecular Biology 143 334–342. (doi:10.1016/j.jsbmb.2014.04.015)
Faresse N, Ruffieux-Daidie D, Salamin M, Gomez-Sanchez CE & Staub O 2010 Mineralocorticoid receptor degradation is promoted by Hsp90 inhibition and the ubiquitin-protein ligase CHIP. American Journal of Physiology. Renal Physiology 299 F1462–F1472. (doi:10.1152/ajprenal.00285.2010)
Faresse N, Vitagliano JJ & Staub O 2012 Differential ubiquitylation of the mineralocorticoid receptor is regulated by phosphorylation. FASEB Journal 26 4373–4382. (doi:10.1096/fj.12-209924)
Fried SK, Russell CD, Grauso NL & Brolin RE 1993 Lipoprotein lipase regulation by insulin and glucocorticoid in subcutaneous and omental adipose tissues of obese women and men. Journal of Clinical Investigation 92 2191–2198. (doi:10.1172/JCI116821)
Fried SK, Bunkin DA & Greenberg AS 1998 Omental and subcutaneous adipose tissues of obese subjects release interleukin-6: depot difference and regulation by glucocorticoid. Journal of Clinical Endocrinology and Metabolism 83 847–850.
Gathercole LL, Morgan SA, Bujalska IJ, Hauton D, Stewart PM & Tomlinson JW 2011 Regulation of lipogenesis by glucocorticoids and insulin in human adipose tissue. PLoS ONE 6 e26223. (doi:10.1371/journal.pone.0026223)
Gregor MF & Hotamisligil GS 2011 Inflammatory mechanisms in obesity. Annual Review Immunology 29 415–445. (doi:10.1146/annurev-immunol-031210-101322)
Guo C, Ricchiuti V, Lian BQ, Yao TM, Coutinho P, Romero JR, Li J, Williams GH & Adler GK 2008 Mineralocorticoid receptor blockade reverses obesity-related changes in expression of adiponectin, peroxisome proliferator-activated receptor-gamma, and proinflammatory adipokines. Circulation 117 2253–2261. (doi:10.1161/CIRCULATIONAHA.107.748640)
Hauner H, Entenmann G, Wabitsch M, Gaillard D, Ailhaud G, Negrel R & Pfeiffer EF 1989 Promoting effect of glucocorticoids on the differentiation of human adipocyte precursor cells cultured in a chemically defined medium. Journal of Clinical Investigation 84 1663–1670. (doi:10.1172/JCI114345)
Hirata A, Maeda N, Hiuge A, Hibuse T, Fujita K, Okada T, Kihara S, Funahashi T & Shimomura I 2009 Blockade of mineralocorticoid receptor reverses adipocyte dysfunction and insulin resistance in obese mice. Cardiovascular Research 84 164–172. (doi:10.1093/cvr/cvp191)
Hirata A, Maeda N, Nakatsuji H, Hiuge-Shimizu A, Okada T, Funahashi T & Shimomura I 2012 Contribution of glucocorticoid-mineralocorticoid receptor pathway on the obesity-related adipocyte dysfunction. Biochemical and Biophysical Research Communications 419 182–187. (doi:10.1016/j.bbrc.2012.01.139)
Hirosumi J, Tuncman G, Chang L, Gorgun CZ, Uysal KT, Maeda K, Karin M & Hotamisligil GS 2002 A central role for JNK in obesity and insulin resistance. Nature 420 333–336. (doi:10.1038/nature01137)
Hoppmann J, Perwitz N, Meier B, Fasshauer M, Hadaschik D, Lehnert H & Klein J 2010 The balance between gluco- and mineralo-corticoid action critically determines inflammatory adipocyte responses. Journal of Endocrinology 204 153–164. (doi:10.1677/JOE-09-0292)
Kadmiel M & Cidlowski JA 2013 Glucocorticoid receptor signaling in health and disease. Trends in Pharmacological Sciences 34 518–530. (doi:10.1016/j.tips.2013.07.003)
Kershaw EE, Morton NM, Dhillon H, Ramage L, Seckl JR & Flier JS 2005 Adipocyte-specific glucocorticoid inactivation protects against diet-induced obesity. Diabetes 54 1023–1031. (doi:10.2337/diabetes.54.4.1023)
Korner A, Wabitsch M, Seidel B, Fischer-Posovszky P, Berthold A, Stumvoll M, Bluher M, Kratzsch J & Kiess W 2005 Adiponectin expression in humans is dependent on differentiation of adipocytes and down-regulated by humoral serum components of high molecular weight. Biochemical and Biophysical Research Communications 337 540–550. (doi:10.1016/j.bbrc.2005.09.064)
Lee MJ & Fried SK 2014a The glucocorticoid receptor, not the mineralocorticoid receptor, plays the dominant role in adipogenesis and adipokine production in human adipocytes. International Journal of Obesity 38 1228–1233. (doi:10.1038/ijo.2014.6)
Lee MJ & Fried SK et al. 2014b Reply to Armani Can cortisol stimulate adipogenesis without the glucocorticoid receptor? International Journal of Obesity 38 1578–1579. (doi:10.1038/ijo.2014.71)
Lee MJ, Gong DW, Burkey BF & Fried SK 2011 Pathways regulated by glucocorticoids in omental and subcutaneous human adipose a microarray study. American Journal of Physiology: Endocrinology and Metabolism 300 E571–E580. (doi:10.1152/ajpendo.00231.2010)
Lee MJ, Pramyothin P, Karastergiou K & Fried SK 2014 Deconstructing the roles of glucocorticoids in adipose tissue biology and the development of central obesity. Biochimica et Biophysica Acta 1842 473–481. (doi:10.1016/j.bbadis.2013.05.029)
Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR & Flier JS 2001 A transgenic model of visceral obesity and the metabolic syndrome. Science 294 2166–2170. (doi:10.1126/science.1066285)
McLaughlin T, Deng A, Yee G, Lamendola C, Reaven G, Tsao PS, Cushman SW & Sherman A 2010 Inflammation in subcutaneous adipose relationship to adipose cell size. Diabetologia 53 369–377. (doi:10.1007/s00125-009-1496-3)
Miller LK, Kral JG, Strain GW & Zumoff B 1987 Differential binding of dexamethasone to ammonium sulfate precipitates of human adipose tissue cytosols. Steroids 49 507–522. (doi:10.1016/0039-128X(87)90091-2)
Minshull M & Strong CR 1985 The stimulation of lipogenesis in white adipose tissue from fed rats by corticosterone. International Journal of Biochemistry 17 529–532. (doi:10.1016/0020-711X(85)90151-X)
Mittelstadt PR & Ashwell JD 2003 Disruption of glucocorticoid receptor exon 2 yields a ligand-responsive C-terminal fragment that regulates gene expression. Molecular Endocrinology 17 1534–1542. (doi:10.1210/me.2002-0429)
Morton NM, Paterson JM, Masuzaki H, Holmes MC, Staels B, Fievet C, Walker BR, Flier JS, Mullins JJ & Seckl JR 2004 Novel adipose tissue-mediated resistance to diet-induced visceral obesity in 11 beta-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes 53 931–938. (doi:10.2337/diabetes.53.4.931)
Nikolic I, Vujicic M, Saksida T, Berki T, Stosic-Grujicic S & Stojanovic I 2013 The role of endogenous glucocorticoids in glucose metabolism and immune status of MIF-deficient mice. European Journal of Pharmacology 714 498–506. (doi:10.1016/j.ejphar.2013.06.037)
Nixon M, Upreti R & Andrew R 2012 5alpha-reduced a story of natural selection. Journal of Endocrinology 212 111–127. (doi:10.1530/JOE-11-0318)
Patsouris D, Neels JG, Fan W, Li PP, Nguyen MT & Olefsky JM 2009 Glucocorticoids and thiazolidinediones interfere with adipocyte-mediated macrophage chemotaxis and recruitment. Journal of Biological Chemistry 284 31223–31235. (doi:10.1074/jbc.M109.041665)
Peckett AJ, Wright DC & Riddell MC 2011 The effects of glucocorticoids on adipose tissue lipid metabolism. Metabolism 60 1500–1510. (doi:10.1016/j.metabol.2011.06.012)
Pedersen SB, Jonler M & Richelsen B 1994 Characterization of regional and gender differences in glucocorticoid receptors and lipoprotein lipase activity in human adipose tissue. Journal of Clinical Endocrinology and Metabolism 78 1354–1359.
Randall MJ, Kostin SF, Burgess EJ, Hoyt LR, Ather JL, Lundblad LK & Poynter ME 2014 Anti-inflammatory effects of levalbuterol-induced 11beta-hydroxysteroid dehydrogenase type 1 activity in airway epithelial cells. Frontiers in Endocrinology 5 236. (doi:10.3389/fendo.2014.00236)
Rasouli N, Molavi B, Elbein SC & Kern PA 2007 Ectopic fat accumulation and metabolic syndrome. Diabetes, Obesity and Metabolism 9 1–10. (doi:10.1111/j.1463-1326.2006.00590.x)
Sai S, Esteves CL, Kelly V, Michailidou Z, Anderson K, Coll AP, Nakagawa Y, Ohzeki T, Seckl JR & Chapman KE 2008 Glucocorticoid regulation of the promoter of 11beta-hydroxysteroid dehydrogenase type 1 is indirect and requires CCAAT/enhancer-binding protein-beta. Molecular Endocrinology 22 2049–2060. (doi:10.1210/me.2007-0489)
Singh P, Brock CO, Volden PA, Hernandez K, Skor M, Kocherginsky M, Park JE, Brady MJ & Conzen SD 2015 Glucocorticoid receptor ChIP-sequencing of subcutaneous fat reveals modulation of inflammatory pathways. Obesity 23 2286–2293. (doi:10.1002/oby.21251)
Teilmann AC, Kalliokoski O, Jacobsen KR, Hau J & Abelson KS 2014 Impact of heparin and short term anesthesia on the quantification of cytokines in laboratory mouse plasma. Acta Veterinaria Scandinavica 56 33. (doi:10.1186/1751-0147-56-33)
Tronche F, Kellendonk C, Kretz O, Gass P, Anlag K, Orban PC, Bock R, Klein R & Schutz G 1999 Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nature Genetics 23 99–103. (doi:10.1038/12703)
Wajchenberg BL, Bosco A, Marone MM, Levin S, Rocha M, Lerario AC, Nery M, Goldman J & Liberman B 1995 Estimation of body fat and lean tissue distribution by dual energy X-ray absorptiometry and abdominal body fat evaluation by computed tomography in Cushing’s disease. Journal of Clinical Endocrinology and Metabolism 80 2791–2794.
Wang Y, Lam KS, Kraegen EW, Sweeney G, Zhang J, Tso AW, Chow WS, Wat NM, Xu JY & Hoo RL et al. 2007 Lipocalin-2 is an inflammatory marker closely associated with obesity, insulin resistance, and hyperglycemia in humans. Clinical Chemistry 53 34–41.
Wang ZV, Deng Y, Wang QA, Sun K & Scherer PE 2010 Identification and characterization of a promoter cassette conferring adipocyte-specific gene expression. Endocrinology 151 2933–2939. (doi:10.1210/en.2010-0136)
Wernstedt Asterholm I, Tao C, Morley TS, Wang QA, Delgado-Lopez F, Wang ZV & Scherer PE 2014 Adipocyte inflammation is essential for healthy adipose tissue expansion and remodeling. Cell Metabolism 20 103–118. (doi:10.1016/j.cmet.2014.05.005)
Yang J, Eliasson B, Smith U, Cushman SW & Sherman AS 2012 The size of large adipose cells is a predictor of insulin resistance in first-degree relatives of type 2 diabetic patients. Obesity 20 932– 938. (doi:10.1038/oby.2011.371)
