Progestin increases the expression of gonadotropins in pituitaries of male zebrafish

in Journal of Endocrinology
Authors:
Cuili Wang State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences, Xiamen University, Xiamen, China
Fujian Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources, Xiamen, China

Search for other papers by Cuili Wang in
Current site
Google Scholar
PubMed
Close
,
Dongteng Liu State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences, Xiamen University, Xiamen, China
Fujian Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources, Xiamen, China

Search for other papers by Dongteng Liu in
Current site
Google Scholar
PubMed
Close
,
Weiting Chen Centre of Reproduction, Development and Aging (CRDA), Faculty of Health Sciences, University of Macau, Taipa, Macau, China

Search for other papers by Weiting Chen in
Current site
Google Scholar
PubMed
Close
,
Wei Ge Centre of Reproduction, Development and Aging (CRDA), Faculty of Health Sciences, University of Macau, Taipa, Macau, China

Search for other papers by Wei Ge in
Current site
Google Scholar
PubMed
Close
,
Wanshu Hong State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences, Xiamen University, Xiamen, China
Fujian Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources, Xiamen, China

Search for other papers by Wanshu Hong in
Current site
Google Scholar
PubMed
Close
,
Yong Zhu State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences, Xiamen University, Xiamen, China
Department of Biology, East Carolina University, Greenville, North Carolina, USA

Search for other papers by Yong Zhu in
Current site
Google Scholar
PubMed
Close
, and
Shi X Chen State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences, Xiamen University, Xiamen, China
Fujian Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources, Xiamen, China
State-Province Joint Engineering Laboratory of Marine Bioproducts and Technology, Xiamen University, Xiamen, China

Search for other papers by Shi X Chen in
Current site
Google Scholar
PubMed
Close

Free access

Sign up for journal news

Our previous study showed that the in vivo positive effects of 17α,20β-dihydroxy-4-pregnen-3-one (DHP), the major progestin in zebrafish, on early spermatogenesis was much stronger than the ex vivo ones, which may suggest an effect of DHP on the expression of gonadotropins. In our present study, we first observed that fshb and lhb mRNA levels in the pituitary of male adult zebrafish were greatly inhibited by 3 weeks exposure to 10nM estradiol (E2). However, an additional 24h 100nM DHP exposure not only reversed the E2-induced inhibition, but also significantly increased the expression of fshb and lhb mRNA. These stimulatory effects were also observed in male adult fish without E2 pretreatment, and a time course experiment showed that it took 24h for fshb and 12h for lhb to respond significantly. Because these stimulatory activities were partially antagonized by a nuclear progesterone receptor (Pgr) antagonist mifepristone, we generated a Pgr-knockout (pgr–/–) model using the TALEN technique. With and without DHP in vivo treatment, fshb and lhb mRNA levels of pgr–/– were significantly lower than those of pgr+/+. Furthermore, ex vivo treatment of pituitary fragments of pgr–/– with DHP stimulated lhb, but not fshb mRNA expression. Results from double-colored fluorescent in situ hybridization showed that pgr mRNA was expressed only in fshb-expressing cells. Taken together, our results indicated that DHP participated in the regulation of neuroendocrine control of reproduction in male zebrafish, and exerted a Pgr-mediated direct stimulatory effect on fshb mRNA at pituitary level.

Abstract

Our previous study showed that the in vivo positive effects of 17α,20β-dihydroxy-4-pregnen-3-one (DHP), the major progestin in zebrafish, on early spermatogenesis was much stronger than the ex vivo ones, which may suggest an effect of DHP on the expression of gonadotropins. In our present study, we first observed that fshb and lhb mRNA levels in the pituitary of male adult zebrafish were greatly inhibited by 3 weeks exposure to 10nM estradiol (E2). However, an additional 24h 100nM DHP exposure not only reversed the E2-induced inhibition, but also significantly increased the expression of fshb and lhb mRNA. These stimulatory effects were also observed in male adult fish without E2 pretreatment, and a time course experiment showed that it took 24h for fshb and 12h for lhb to respond significantly. Because these stimulatory activities were partially antagonized by a nuclear progesterone receptor (Pgr) antagonist mifepristone, we generated a Pgr-knockout (pgr–/–) model using the TALEN technique. With and without DHP in vivo treatment, fshb and lhb mRNA levels of pgr–/– were significantly lower than those of pgr+/+. Furthermore, ex vivo treatment of pituitary fragments of pgr–/– with DHP stimulated lhb, but not fshb mRNA expression. Results from double-colored fluorescent in situ hybridization showed that pgr mRNA was expressed only in fshb-expressing cells. Taken together, our results indicated that DHP participated in the regulation of neuroendocrine control of reproduction in male zebrafish, and exerted a Pgr-mediated direct stimulatory effect on fshb mRNA at pituitary level.

Introduction

Gonadal steroid hormones play key roles in regulating gametogenesis, but they also exert both positive and negative feedback effects at the hypothalamic and pituitary levels. In tetrapod vertebrates, progesterone (P4) is the dominant ovarian progestin, which regulates reproductive behavior (Blaustein 1986) and exerts feedback effects on both pituitary gonadotropin secretion (Turgeon & Waring 1990, 2000, Waring & Turgeon 1992) and hypothalamic gonadotropin-releasing hormone (GNRH) release (O’byrne et al. 1991, Skinner et al. 1998). 17α,20β-dihydroxy-4-pregnen-3-one (DHP) and 17α,20β,21-trihydroxy-pregn-4-en-3-one (20β-S) are the most potent and biologically relevant progestins in teleosts (Scott et al. 2010). In male fish, progestins induce spermiation (Ueda et al. 1985), increase seminal fluid production (Baynes & Scott 1985), and stimulate spermatozoa motility (Miura et al. 1992, Tubbs & Thomas 2008). Studies in Japanese eel (Anguilla japonica) demonstrated that DHP induces the entry of male germ cells into meiosis (Miura et al. 2006). Our recent studies in zebrafish showed that DHP treatment increased proliferation and differentiation of early spermatogonial generation (Chen et al. 2013). Interestingly, the in vivo effect of DHP on spermatogonia was more prominent than that ex vivo. One likely mechanism is that the effects of DHP in vivo may involve both direct action at the testicular level and indirect modulation of pituitary gonadotropin release. Alternatively, in vitro incubation could also lead to dysregulation of many paracrine and autocrine signaling around testes that are important for DHP signaling.

In mammalian models, some studies reported no effect of progesterone on luteinizing hormone (LH) (­Kerrigan et al. 1993, Park et al. 1996), while others using immortalized gonadotrope-derived LβT2 cells (L beta T2 gonadotrope cell line, Turgeon et al. 1996) demonstrated that progesterone suppressed LHβsubunit gene expression, in contrast to its stimulatory effect on the expression of follicle-stimulating hormone (FSH)βsubunit (Thackray et al. 2006, 2009). In teleosts, much progress has been made in understanding the regulation of the GNRH-Fsh/Lh system by androgens and 17β-estradiol (Zohar et al. 2010), but the potential roles of progestins in the neuroendocrine regulation of reproduction have received little attention. In female tilapia, DHP has been implicated in the regulation of Fsh and Lh release (Levavi-Sivan et al. 2006), but these DHP-mediated effects are considered to play a minor role in comparison to the dominant actions of androgen and 17β-estradiol (Van der Kraak 2009). Lack of information hinders an overall understanding of steroid hormones in regulating reproductive processes in teleosts.

The effects of progestins are mainly mediated through an intracellular nuclear progestin receptor (Pgr) that belongs to the nuclear receptor family (Conneely et al. 1986). In addition, multiple membrane progestin receptors (mPRs), which have no structural similarity to Pgr, also can mediate the nonclassical action of progestin (Zhu et al. 2003, Hanna & Zhu 2011, Tan & Thomas 2015). In zebrafish, the Pgr is expressed robustly in the preoptic region of the hypothalamus (Hanna et al. 2010), and membrane progestin receptors (mPRs) in scattered cells in the pituitary (Hanna & Zhu 2009), suggesting potential roles of progestins in the brain–pituitary complex and the involvement of multiple progestin receptors and signaling pathways.

Recently, we have clearly shown that Pgr knockout (pgr–/–) causes completely anovulation and infertility in female zebrafish, but male knockout fish is still fertile (Zhu et al. 2015). In current study, we focused on the effects and molecular mechanisms of progestin (DHP) signaling in male zebrafish. We demonstrate that DHP can enhance the expression of gonadotropins (fshb and lhb transcripts) in the pituitaries of male adult zebrafish, independently of estradiol (E2) inhibition. We also provide clear evidence from studies of Pgr antagonist, knockout and in situ to indicate that effects of progestin (DHP), especially, on fshb are mediated directly at least in part by Pgr that is expressed in Fsh-expressing cells in the pituitary of male zebrafish.

Materials and methods

Zebrafish husbandry

The experimental fish were Tübingen strain, which were housed in the zebrafish (Danio rerio) facility (ESSEN, China) and maintained in recirculating freshwater (pH 7.2–7.6) at 28°C with a 14L:10D photoperiod (lights on at 08:00). The fish were fed three times per day with commercial tropical fish food (Otohime B2, Reed Mariculture, Campbell, CA, USA), using standard conditions for this species (Westerfield 2000). All the fish used were mature adult males (age 4–6 months, body length 2.4–2.8cm, body weight 275–440mg). Experimental protocols were approved by the Institutional Animal Care and Use Committee of Xiamen University.

Generating and characterizing pgr–/– zebrafish using TALENs

Instead of using an unit assembly protocol and a modified FokI (Huang et al. 2011, Zhu et al. 2015), we used a Golden Gate TALEN assembly protocol and wild type (WT) FokI (Cermak et al. 2011) to generate TALEN expression vectors targeting one locus as per the previous target (Zhu et al. 2015) located in the first exon (Fig. 1A) of the zebrafish pgr gene (Ensembl No. ENSDARG00000035966). Thereafter, assembled pgr GoldyTALEN expression vectors were linearized using SacI (Thermo Scientific), and transcribed into mRNAs using the Mmessage mMACHINE T3 Transcription Kit (Life Technologies).

Figure 1
Figure 1

Genomic structure of the rzebrafish pgr gene, TALEN targets, and a representative mutation induced by TALENs. (A) TALENs were designed to target the first exon of the pgr gene. The left and right binding sites of TALENs are underlined, and a restriction enzyme cleavage site with PauI used for mutation analysis is highlighted in bold. Forward and reverse primers for PCR amplification of the genomic fragment including the target region are also indicated by the arrow lines. (B) Mutation detection in injected F0 founder embryos using PauI restriction enzyme digestion (mutation efficiency 29.1%). (C) Genotype examination of F1 adult zebrafish using restriction enzyme digestion and tailfin clipping. Fish were individually numbered and are indicated on the top of the figure. No. 3 and 5 were wild-type fish, No. 1, 2, 4, 6, 7, and 8 were heterozygote fish. (D) Genotype examination of F2 adult zebrafish. Individual fish were numbered and are indicated on the top of the figure. No. 1, 2, 3, 4, 6, 7, 8, and 9 were heterozygote fish; No. 5 was a homozygote fish. (E) DNA sequences of wild type or Pgr mutant. Nucleotide deletion is indicated by dashed lines. The numbers at the right side show the number of deleted base pairs. (F) Western blot of the Pgr of zebrafish testes. Sample types are indicated on the top of the figure. F, forward; R, reverse; No., number; WT, wild type; pgr–/–, Pgr knockout.

Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0073

Approximately 1nL containing ~75pg of each TALEN mRNA was injected into the yolk of each embryo at the one-cell stage. For examining the mutation rate of the injected embryos, a pool of genomic DNA was extracted from 30 injected embryos or the same number of WT embryos. With genomic DNA as template, a DNA fragment containing the TALEN target site was amplified using PCR (Fig. 1A and Table 1), followed by restriction endonuclease (PauI; Thermo Scientific) digestion, and checked with agarose gel electrophoresis. Area densities of cut and uncut bands on the gel were measured using the Gel-Pro Analyzer Program (Media Cybernetics, Rockville, MD, USA) (Fig. 1B), mutation efficiency being calculated as (%)=uncut/(cut+uncut) × 100%.

Table 1

Primers used in present study.

Primer name Primer sequence (5′–3′) Expected size (bp) GenBank accession number Purpose
pgr-TALEN Forward AGGAATACGTCGCACACTTT 965 Ensembl No. ENSDARG00000035966 Positive gene Knockout fish screening
pgr-TALEN Reverse CGCCATTTTAATTCGACCTC
pgr-Forward GGGTCTCGCTGCGTAATTTT 841 Ensembl No. ENSDARG00000035966 RT-PCR
pgr-Reverse GCCTGGTAGCACTTTCGAAG
ef1a-Forward GGCTGACTGTGCTGTGCTGATTG 409 Bbib64291 Real-time PCR
ef1a-Reverse CTTGTCGGTGGGACGGCTAGG
fshb-Forward CAGATGAGGATGCGTGTGC 281 AY424303 Real-time PCR
fshb-Reverse ACCCCTGCAGGACAGCC
lhb-Forward GCAGAGACACTTACAACAGCC 145 AY424304/AY424305 Real-time PCR
lhb-Reverse AAAACCAAGCTCTGAGCAGCC

To obtain homozygous mutant zebrafish, adult (>90dpf) F0 founder fish were outcrossed with WT fish. From each cross, a pool of genomic DNA was extracted from 30 randomly selected F1 embryos, and the status of the TALEN target site was analyzed via PCR amplification, and restriction enzyme digestion as described above. Based on the mutation efficiency, the remaining F1 embryos from F0 founder fish with high rates of germline transmission were raised to adulthood and were genotyped individually using tail fin-clip screening assay in order to obtain heterozygous F1. Based on the DNA sequence of the TALEN target sites, heterozygous F1 fish with the same frame shift mutation were intercrossed to produce F2 offspring (Fig. 1C). Homozygous Pgr-knockout (pgr–/–), heterozygotes (pgr+/–) and homozygous wild type (pgr+/+) in F2 fish were identified via PCR amplification followed by restriction enzyme digestion analysis as described above (Fig. 1D).

In order to examine the pgr mRNA sequence in pgr–/– male fish, cDNA was synthesized using a Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific) from the total RNA extracted from pooled pituitary samples using RNAzol reagent (MRC, Cincinnati, OH, USA). The specific PCR product was obtained using the Pgr-primers (Table 1), followed by cloning and Sanger sequencing.

In order to examine if Pgr protein was absent in pgr–/– male fish, testicular samples of WT and pgr–/– fish were collected for western blot assay as described previously (Hanna et al. 2010). Total protein samples were extracted by immediately placing freshly excised testis into 1×SDS buffer, denatured by boiling for 5 min, and then cooled on ice. Equal amounts (60μg) of protein samples were loaded and separated using a 12% SDS–PAGE gel and were transferred onto a PVDF membrane. The membrane was blocked in TBS containing 0.1% (v:v) Tween 20 and 1% (w:v) bovine serum albumin for 1h at room temperature (RT), before the membrane was incubated with Pgr antibody (Hanna et al. 2010) for 24h at 4°C. After five washes with TBST, the membrane was incubated for 1h at RT with the horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000, v:v). A Bio-Rad ECL kit was used to detect signals on the PVDF membrane. Protein size was determined by comparing blotted protein size to a biotinylated protein ladder (Cell Signaling Technology, #7727s) following the manufacturer’s directions.

Expression of fshb and lhb mRNA during the diurnal cycle

To examine the expression of fshb and lhb mRNA levels in the pituitary during the diurnal cycle, mature WT male fish (>90dpf) from the same batch were randomly chosen. Pituitary samples were collected every 4h starting at 10:00 until 06:00. Since maximum levels were found at 06:00, expression levels of WT and pgr–/– fish were compared at 06:00. Three pituitaries were pooled as one sample for these mRNA quantification studies.

In vivo exposure to sex steroids

Using a zebrafish model of estrogen-induced androgen insufficiency (De Waal et al. 2009), adult (>90dpf) males were kept for 3 weeks in water containing 10nM estradiol (E2) (Sigma-Aldrich). Fish were then exposed again to 10nM E2 either with or without 100nM DHP (Sigma-Aldrich) for another 24h. From the same batch of male fish, animals without E2 pretreatment were exposed to 100nM DHP for 24h. Male fish were killed in ice water; pituitaries were collected (three pituitaries were pooled as one sample), frozen quickly in dry ice, and stored at −80°C for RNA extraction.

For other in vivo exposure experiments, adult (>90dpf) male fish were randomly divided into the control and DHP treatment groups. To determine an appropriate exposure concentration, fish were exposed to 10 or 100nM DHP for 24h (starting at 13:00), while the control group was exposed to the vehicle (ethyl alcohol at a concentration of 0.0001%, v:v). For time course experiments, treatment groups were exposed to 100nM DHP at 13:00, and pituitary samples were collected as described above at 16:00, 19:00, 01:00, and 13:00 to determine appropriate length of exposure time.

To study if the effects of DHP on fshb and lhb transcript levels were Pgr-dependent, male fish were exposed to DHP (100nM) and Pgr-specific antagonist (RU486, 0.1 or 1μM) for 24h. An additional control group was exposed only to 1μM RU486 for 24h. In addition, pgr–/– male fish were exposed to the vehicle (as control, 0.0001% ethyl alcohol, v:v) or DHP (100nM) for a period of 24h. We also quantified the basal fshb and lhb mRNA levels in pgr+/+ fish.

Pituitary ex vivo exposure to sex steroids

Pituitaries of mature male fish were removed, washed three times with Hank's balanced salt solution (without magnesium and calcium) in a 24-well plate (NEST, Rahway, NJ, USA), and then incubated individually in basal culture medium consisting of 15mg/mL Leibovitz’s L-15 medium (Invitrogen), supplemented with 10mM Hepes (Merck), 0.5% w/v BSA (MULT Sciences, China), 200U/mL penicillin, and 200mg/L streptomycin (Invitrogen); pH was adjusted to 7.4 with NaOH. Pituitary samples were incubated for 24h in basal culture medium containing either 100nM DHP, or 0.0001% (v:v) ethyl alcohol as control. Incubation was carried out in a humidified air atmosphere at 28°C for 24h, and three pituitaries were pooled to obtain one sample for gene expression analysis.

Gene expression analysis

Total RNA was extracted from pituitary samples using RNAzol reagent (MRC, Cincinnati, OH, USA). Three pituitaries were pooled as one sample to obtain sufficient RNA for cDNA synthesis. The same amount of total RNA (1.0μg) was used for the synthesis of the first-strand cDNAs using a Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific) following the manufacturer’s instructions.

The relative expression levels of fshb, lhb, and the house-keeping-gene ef1a were determined using real-time quantitative PCR (qPCR) with gene-specific primers (Table 1), which had been examined for their specificity and amplification efficiency on serial dilutions of respective target gene plasmid DNA (2×102–2×107 copies/2μL). qPCR was performed in a 20μL reaction mixture on the 7500 FAST real-time PCR detection system (Applied Biosystems) using default settings. Copies of ef1α, which showed no significant difference among different stages, were used as internal control. The relative mRNA levels of the target genes were determined using the comparative Ct method (Schmittgen & Livak 2008).

Double-colored fluorescent in situ hybridization

The colocalization of pgr with either fshb or lhb mRNA in zebrafish pituitary was investigated using double-colored fluorescent in situ hybridization (FISH), as described previously (Chen & Ge 2012), except that cryosections were used. In brief, pituitaries of adult male zebrafish were dissected and fixed in 4% w/v paraformaldehyde in PBS at 4°C overnight, followed by immersion in 25% w/v sucrose in PBS at 4°C until sinking, and then embedded in optimal cutting compound (Tissue-Tek, Sakura, USA) by freezing in liquid nitrogen. Embedded pituitaries were processed for serial frozen sectioning at 10μm thickness, rehydrated and digested with proteinase K (5μg/mL; Roche Applied Science) at 37°C for 5 min, followed by hybridization with fluorescein-labeled and DIG-labeled RNA probes at 55°C overnight. The probes for the detection of fshb, lhb and pgr mRNA were generated as described previously (Chen et al. 2010, Chen & Ge 2012). After hybridization, the cryosections were washed with 2×saline-sodium citrate (SSC; 0.06M NaCl and 0.006M sodium citrate) for 30 min at RT, 30% v/v formamide deionized in 2×SSC for 15 min at 65°C, 0.2×SSC for 15 min at 65°C, and 0.2×SSC for 15 min at RT. After washing, a TSA Plus Cyanine3/Fluorescein (TSA-Cy3) System (PerkinElmer) was used to detect the hybridization signal. The first signal was detected using HRP-conjugated anti-fluorescein antibody (Roche Applied Science) with TSA Fluorescein following the manufacturer’s instructions. In order to detect the second signal, cryosections were incubated in 1% H2O2 for 60 min to deactivate the HRP from the first staining. HRP-conjugated anti-DIG antibody (Roche Applied Science) were added to the sections, followed by detection with the TSA-Cy3 system. After mounting with the medium for fluorescence reagent (Vector Laboratories, Burlingame, CA, USA), the slides were observed and the images recorded using a Zeiss LSM 780 NLO two photon laser scanning system (Zeiss).

Statistical analysis

All data are presented as mean±s.e.m. of the mean. Depending on the experimental setup, data were analyzed using either Student’s t-test or one-way ANOVA followed by Tukey’s post hoc test to assess statistical differences between two or more groups. The analyses were performed using GraphPad Prism 4 software package (GraphPad Software).

Results

Generating the pgr–/– zebrafish model and knockout phenotype

Mutant lines targeting two different loci with three different frame shift mutations caused by small deletions and/or insertions of nucleotides in the first exon of pgr genomic sequences have been generated and characterized using a unit assembly protocol and modified FokI (for details, Zhu et al. 2015). In current study, we targeted same locus as one of the previous targets (Fig. 1A) using a different TALEN assembly protocol and wild type FokI (Cermak et al. 2011), and successfully generated a new knockout line with a different frame shift (7-bp deletion) and a premature stop codon (Fig. 1B, C, D and E). Pgr protein was undetectable in the testes of pgr–/– fish (Fig. 1F). We found exact same anovulation and infertility in newly generated knockout female zebrafish, which validated our previous finding (Zhu et al. 2015). Similarly, we found that Pgr knockout had no obvious effect in male fertility. So this new Pgr line was chosen for the following experiments.

E2 inhibited but DHP stimulated the expression of fshb and lhb, independently from E2 inhibition

Both fshb and lhb transcripts in the pituitaries of male zebrafish decreased significantly to 2 (fshb) or 20% (lhb) of the control after 3 weeks of E2 (10nM) exposure (Fig. 2). By contrast, expression of the fshb and lhb transcripts in the pituitaries of male zebrafish increased significantly compared with the control when male fish were exposed to DHP both with or without E2 (Fig. 2).

Figure 2
Figure 2

Effects of E2and DHP administration on fshb (A) and lhb (B) mRNA levels in the pituitaries of wild-type male zebrafish. Zebrafish were maintained in the presence of E2 (10nM) alone for 3 weeks (E2) or in the additional presence of 100 nM DHP during the last 24h (E2+DHP) of the total 3-week-long exposure to E2 in vivo. The same batch of male zebrafish without E2 pretreatment were treated with DHP (100 nM) for 24h in vivo. The levels of fshb and lhb mRNA were determined using qPCR and normalized to the internal control gene (ef1a). Data are expressed as the mean ± s.e.m. (n=6) relative to the respective transcript levels of the control value. Mean values marked with different letters are significantly different from each other (P < 0.05).

Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0073

Dose and time-dependent stimulatory effects of progestin on the expression of fshb and lhb

Because pituitary fshb and lhb transcript levels increased to similar levels in response to DHP irrespective of an E2 pretreatment, the subsequent DHP exposure experiments were carried out without E2 pretreatment.

Both fshb and lhb transcripts in the pituitaries of male fish increased significantly (fivefold for fshb, sevenfold for lhb) when fish were exposed to 100nM DHP water for 24h; while 10nM DHP exposure had no significant effects (Fig. 3A and B). The time course experiment indicated that significant increases of fshb and lhb transcript levels in response to DHP (100nM) required at least 24h and 12h exposure, respectively (Fig. 3C and D).

Figure 3
Figure 3

Dose- (A and B) and time (C and D)-dependent stimulation of progestin on the expression of fshb and lhb transcripts in the pituitaries of wild-type male zebrafish in vivo. Male zebrafish were treated with DHP (10 or 100nM) for 24h (13:00–13:00 next day) in vivo (panels A and B). Thereafter, based on the dose-response experiment, an optimal dose level (100nM) was selected in the time course experiment (panels C and D). Transcript levels of fshb or lhb at time zero without progestin exposure are defined as one, and data (mean ± s.e.m., n=6) are expressed as fold changes to the zero value. Mean values marked with different letters are significantly different from each other (P<0.05).

Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0073

RU486 inhibited DHP-induced expression of fshb and lhb in the pituitary

Effects of a Pgr-specific antagonist (RU486) were examined in order to determine if DHP-induced fshb and lhb expression was mediated through Pgr. RU486 alone, up to a concentration of 1μM, did not alter fshb and lhb expression levels (Fig. 4), but RU486 significantly inhibited the stimulatory effects of DHP on the expression of fshb and lhb, in a dose-dependent manner (Fig. 4).

Figure 4
Figure 4

Effects of RU486 on DHP-stimulated fshb and lhb transcript expression levels of the wild-type (WT) male zebrafish. Data are expressed as the mean ± s.e.m. (n=6) relative to the respective transcript levels of the WT control (A and B). Mean values marked with different letters are significantly different from each other (P < 0.05).

Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0073

Daily expression levels of fshb and lhb transcripts in the pituitary of pgr–/– male fish

Expression of fshb and lhb mRNA showed distinct diurnal changes in WT male fish. Both transcripts of fshb and lhb were low in the late morning (10:00) after spawning and in the afternoon (14:00). The levels increased in the evening (18:00) and reached peak levels in early morning (06:00), 2h before the lights came on and the start of spawning activity (Fig. 5A and B). The highest transcript level of fshb was ~7.5-fold higher than the lowest one, while that of lhb was ~4.0-fold higher than the lowest one. Furthermore, we observed that there was no difference in fshb or lhb transcript levels between control WT male (i.e., not treated with TALENs) and pgr+/+ male pituitaries collected at 06:00 (Fig. 5C and D). This excluded potential TALEN induced off-target effects on the site that might affect the reproductive system. In addition, the levels of fshb and lhb mRNA of pgr–/– male fish were significantly lower than those of WT and pgr+/+ collected at 06:00 (Fig. 5C and D).

Figure 5
Figure 5

Diurnal changes of fshb (A) and lhb (B) transcripts in the pituitaries of the wild-type (WT) male zebrafish, and the levels of fshb (C) and lhb (D) in the pituitaries of the WT, pgr+/+, and pgr–/– male zebrafish collected at 06:00. Data are expressed as the mean ± s.e.m. (n=6) relative to the respective transcript levels at 10:00 (A and B) or WT (C and D). Mean values marked with different letters are significantly different from each other (P < 0.05).

Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0073

Effects of DHP on the expression of fshb and lhb in pgr–/– male zebrafish

Surprisingly, we found that DHP still significantly increased the mRNA levels of fshb and lhb in pgr–/– fish, but the magnitudes of the increases were significantly lower than those observed in WT fish (Fig. 6A and B).

Figure 6
Figure 6

Stimulatory effects of DHP in the expression of fshb (A) and lhb (B) transcripts in the pituitaries were significantly blocked in pgr–/– male zebrafish. Wild type (WT+DHP group) and pgr–/– (pgr–/– + DHP group) male zebrafish were treated with (100 nM) DHP for 24 h (13:00–13:00 next day). Wild-type control (WT control) and pgr–/– control groups were treated with the vehicle (0.0001%) for 24 h (13:00–13:00 next day). The levels of fshb and lhb mRNA were determined using qPCR and normalized to the internal control gene (ef1a). Transcript levels of fshb and lhb obtained at the WT control are defined as one, and data (mean ± s.e.m., n=6) are expressed as fold changes to the WT control. Mean values marked with different letters are significantly different from each other (P < 0.05).

Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0073

To examine whether DHP acts directly at the pituitary level to increase fshb and lhb mRNA levels, an ex vivo pituitary culture system was used. Both fshb and lhb transcripts increased significantly (~2-fold for fshb, ~2.5-fold for lhb) in the cultured pituitary tissue fragments of both WT and pgr+/+ males exposed to 100nM DHP for 24h (Fig. 7). Furthermore, compared with the pgr–/– control, there was a significant increase (~twofold) of lhb transcript levels in pituitary fragments of pgr–/– fish following exposure to 100nM DHP for 24h (Fig. 7B), while fshb transcript levels no longer responded to DHP in pituitaries of pgr–/– males (Fig. 7A).

Figure 7
Figure 7

Ex vivo effects of DHP administration on fshb (A) and lhb (B) mRNA levels. Pituitary fragments of wild type (WT), pgr+/+, and pgr–/– male zebrafish were treated with 100 nM DHP for 24 h (13:00–13:00 next day). WT, pgr+/+, and pgr–/– controls were treated with the vehicle (0.0001%) for 24h (13:00–13:00 next day). The levels of fshb and lhb mRNA were determined using qPCR and normalized to the internal control gene (ef1a). Transcript levels of fshb or lhb obtained at the WT control are defined as one, and data are expressed as the mean ± s.e.m. (n=6) relative to the respective transcript levels of the WT control value. Bars marked with * are significantly different from their respective controls (P<0.05).

Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0073

pgr mRNA were expressed in fshb-expressing cells but not in lhb-expressing cells

Because the above results suggested that at least some part of DHP effects on gonadotropin hormone (GTH) expression were likely mediated by pgr, we further investigated if pgr mRNA was expressed in gonadotropin cells for a direct action of DHP. Using double-colored FISH, which could detect the expression of two genes in the same section as reported previously (Chen & Ge 2012), we observed that the fshb-expressing cells scattered individually in the pituitary, whereas the lhb-expressing cells normally formed aggregates (Fig. 8A), which is consistent with a recent report (Golan et al. 2016). Because the expression level of pgr mRNA was much lower than those of fshb and lhb mRNA in the pituitary, the FISH signals of pgr mRNA were observed only in a few cells scattered individually (Fig. 8B, C, D, E and F). The FISH signal of pgr transcript was mostly observed in fshb-expressing cells (Fig. 8C, D, E and F), but none in lhb-expressing cells (Fig. 8B).

Figure 8
Figure 8

pgr mRNAs were expressed in fshb-expressing cells but not in lhb-expressing cells. (A) Cryosection stained for fshb (red) and lhb (green); (B) Cryosection stained for lhb (red) and pgr (green); (C and D) Cryosection stained for fshb (red) and pgr (green); and (E and F) Cryosection stained for fshb (red) and pgr (green); scale bars=50 μM. A full colour version of this figure is available at http://dx.doi.org/10.1530/JOE-16-0073.

Citation: Journal of Endocrinology 230, 1; 10.1530/JOE-16-0073

Discussion

Gonadal steroids exert negative or positive feedbacks on gonadotropin synthesis and secretion in various vertebrates. In the present study, we investigated the potential roles of DHP in regulating gonadotropin transcription in adult male zebrafish using morphological, physiological, and molecular approaches. The results showed that DHP was able to stimulate the transcription levels of both fshb and lhb. Importantly, using pgr–/– fish, we demonstrated that the stimulatory effect of DHP on fshb mRNA was mediated by the Pgr which was expressed in fshb-expressing pituitary cells.

We first applied the long-term E2 treatment model to examine the effects of DHP on gonadotropin subunit expression in vivo. Our results showed that DHP significantly increased gonadotropin subunit mRNA expression in the presence and absence of E2. This was different from that in mammalian models, in which many studies have shown that progesterone can suppress LH mRNA levels in the presence of estrogen (Abbot et al. 1988, Simard et al. 1988, Corbani et al. 1990). Therefore, it seemed that there was no interaction between DHP and E2 in regulating GTH subunit expression in male zebrafish.

Extensive studies in goldfish have demonstrated that waterborne DHP is a pheromone which can increase LH, steroid, and seminal fluid production (Stacey & Sorensen 1986, Dulka et al. 1987, Kobayashi et al. 2002). Because of the exposure via water in the present study, it is possible that DHP exerted its stimulatory effects as a pheromone. While the zebrafish ovary can produce steroid glucuronides, including 17,20β-P-glucuronide, which are attractive to males, 17,20β-P-glucuronide has never been tested as a sex pheromone in male zebrafish. However, 17,20β-P-sulfate is the only steroid that males appear to be able to smell (Belanger et al. 2010). Sex pheromones usually induce a rapid endocrine response at low concentrations (pM and low nM). For example, exposure of goldfish to 0.5nM DHP increases serum LH levels after only 15 min (Dulka et al. 1987). However, in the present study, the significant response of fshb and lhb to DHP exposure required 24h and 12h, respectively, reaching maximum levels after 24h exposure, and DHP induced the upregulation of fshb mRNA expression only at a high concentration (100nM). Moreover, using the primary pituitary ex vivo culture system, we observed a stimulatory effect of DHP on GTH expression. Taken together, it was most likely that DHP induced GTH upregulation, especially fshb mRNA expression, through an endocrine pathway.

Several studies in fish report that plasma LH levels are very low during the early spermatogenesis stage and become detectable when germ cells entered meiosis; however, the increase is not prominent until the spawning season (Schulz et al. 2010). Similarly, the highest levels of circulating progestins are observed during the entire spermiation process, especially during the spawning ­season (Schulz et al. 2010). One physiological mechanism to explain this coincidence is that LH induced the production of DHP (Schulz et al. 2010). Our previous study in zebrafish also demonstrates that recombinant zebrafish Lh induces DHP production ex vivo (Chen et al. 2010). Data from the present study showed that DHP had a positive feedback on lhb mRNA expression, which was in agreement with previous studies in female tilapia (Levavi-Sivan et al. 2006). These results might indicate that LH is the main factor regulating the production of the maturation-inducing hormone DHP.

An increase of fshb mRNA levels during spermiation is recorded in several teleost species, which may be due to environmental factors (i.e., temperature and photo­period) (Schulz et al. 2010). In the present study, we report that DHP increased fshb mRNA levels in male zebrafish. It is worth noting that this stimulatory effect required a high concentration of DHP (100nM), which is supposed to happen during spawning. Therefore, we examined the diurnal changes of fshb expression levels, and the results indicated that both fshb and lhb transcripts reached peak levels at 06:00, 2h before spawning. Interestingly, a previous study in female zebrafish also reports an obvious elevation of fshb expression at 01:00 and 04:00 before final oocyte maturation at 07:00 (So et al. 2005). Taken together, these results suggested that FSH may be involved in final gamete maturation, which is different from the current view that FSH in fish is involved in early gametogenesis, that is, promoting the early stage of spermatogenesis in the testis, and stimulating follicle growth or vitellogenesis in the ovary. As a continuous daily breeder with an asynchronous spermatogenic cyst, it is most likely that zebrafish initiate the early stages of spermatogenesis at some point of time every day. Results from our present study supported the suggestion from our previous study that DHP-induced early spermatogenesis is mainly mediated by triggering the release of gonadotropins (Chen et al. 2013). Recent studies in zebrafish indicate that FSH promotion of proliferation and differentiation of spermatogonia does not require androgen, but can also be mediated by suppressing an inhibitor of spermatogenesis (Skaar et al. 2011), or by inducing a stimulator of spermatogenesis (Igf3) (Nóbrega et al. 2015). Moreover, the testes in fshr–/– males showed significant retardation in growth with delayed spermatogenesis and gonad formation, though male fertility did not seem to be affected (Zhang et al. 2015a). In contrast to significant effects and infertility due to lh-knockout in female fish, male fertility was also apparently not affected in zebrafish (Chu et al. 2014, Zhang et al. 2015b). However, our present study clearly indicates expressions of fshb and lhb mRNA are regulated by feedback signaling of progestin in zebrafish. Taken together, FSH, LH, and progestin are working in concert to appropriately regulate gonadal growth, puberty onset, daily recruitment, and maturation of germ cells in male zebra­fish. Clearly, additional studies are required to understand effects, regulation, and conserved functions of LH, FSH, progestin, and their receptors during reproduction and evolution.

Three classes of progestin receptors (Pgr, mPR, and progesterone receptor membrane component (Pgrmc)) are reported in vertebrates (Thomas 2008, Zhu et al. 2008). Previous reports and the present results showed that both Pgr and mPR are expressed in the zebrafish hypothalamus and pituitary (Hanna & Zhu 2009, Chen et al. 2010, Hanna et al. 2010), so that DHP may induce GTH expression via Pgr or/and mPRs. The results from present study showed that the Pgr antagonist RU486 partially blocked the stimulatory effects of DHP. Furthermore, using a pituitary ex vivo culture system, we did not observe any stimulatory effect of DHP on fshb expression in the pgr–/– model. Moreover, results from double-colored FISH showed that most of the FISH signals revealed by the pgr probe were observed in fshb-expressing cells, but not in lhb-expressing cells. Our results clearly indicated that DHP exerted a direct stimulatory effect on fshb mRNA expression which was mediated by Pgr at the pituitary level. In mammals, it has been demonstrated that the full suppressive effect of progesterone on Lhb gene expression requires the unique amino-terminal region of the Pgr, but this suppression does not require direct binding of Pgr to the Lhb promoter although it is recruited to the endogenous promoter in live cells (Thackray et al. 2009). By contrast, progesterone directly activates Fshb through binding of Pgr in the proximal FSH promoter (Thackray et al. 2006). The molecular mechanism of progestins on fshb gene expression is conserved in vertebrates during evolution. Further study is necessary to show whether other progestin ­receptors are involved in mediating the stimulatory effect of DHP on lhb gene expression in fish.

Interestingly, DHP still caused upregulation of GTH expression in vivo in pgr–/– male fish, suggesting that nonnuclear receptor mediated pathways in other brain regions, most likely in the hypothalamus, might be involved in the stimulatory effects of DHP on GTH. However, the relevant information is less documented in teleosts. In mammals, the molecular mechanisms of progesterone on GNRH were also unambiguous. Classic Pgr (Skinner et al. 1998), PAQR (Sleiter et al. 2009) and PGRMC1 (Bashour & Wray 2012) are suggested as the key players in mediating progesterone action on GNRH. Further research is needed to address the involvement of other progestin receptors in mediating this effect.

In teleost fish, estrogenic compounds can inhibit androgen synthesis and prevent spermatogenesis (Van der Ven et al. 2003, 2007, Pawlowski et al. 2004, Van den Belt et al. 2004), but the mechanisms remain unclear. A study in zebrafish suggests that in vivo exposure to E2 causes a state of androgen insufficiency, involving feedback mechanisms on the hypothalamus–pituitary system (De Waal et al. 2009). In the present study, we observed in vivo a clear inhibitory effect of E2 on fshb and lhb mRNA levels, similar to what is described in the closely related goldfish (Kobayashi et al. 2000, Huggard-Nelson et al. 2002). However, direct estrogenic stimulation of pituitary cells elevates fshb and lhb transcript levels in zebrafish (Lin & Ge 2009). Therefore, we concluded that in zebrafish, long-term exposure to E2 inhibited stimulatory or strengthened inhibitory signaling toward the pituitary gonadotropin cells, and these effects overruled the direct, stimulatory effects of E2 on gonadotropin subunit expression.

In summary, the present study indicated that DHP played an important role in the regulation of gonado­tropin production in the male zebrafish pituitary. It is likely that the effect of DHP on gonadotropin gene expression may have resulted from integration of multiple effectors acting on the hypothalamus, as well as the pituitary. In addition, Pgr was the main but not the only receptor type for mediating this effect. However, at the pituitary level, DHP exerted a Pgr-mediated direct stimulatory effect on fshb mRNA. Despite this, pgr–/– male fish are fertile (Zhu et al. 2015), which is similar to a mice model (Schneider et al. 2005), and the biological significance of this stimulatory effect of DHP on gonadotropin gene expression remains to be clarified.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This study was supported by the National Natural Science Foundation of China (No. 31201977 & No. 41276129), the funding for Doctor Station of the Ministry of Education of China (No. 20120121110029), Xiamen Southern Oceanographic Center (No. 14GZY019NF19), and NIH 1R15GM100461-01A1.

Author contribution statement

C L W was involved in entire study. D T L performed TALEN synthesizing, mutation screen. W T C performed double-colored fluorescent in situ hybridization. W G, Y Z, and W S H supervised the project and prepared manuscript drafting. S X C conceived and supervised the project, analyzed results, and wrote the paper.

Acknowledgments

The authors would like to express our great appreciation to Professor John Hodgkiss for assistance with the English.

References

  • Abbot SD, Docherty K & Clayton RN 1988 Regulation of LH subunit mRNA levels by gonadal hormones in female rats. Journal of Molecular Endocrinology 1 4960. (doi:10.1677/jme.0.0010049)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bashour NM & Wray S 2012 Progesterone directly and rapidly inhibits GnRH neuronal activity via progesterone receptor membrane component 1. Endocrinology 153 44574469. (doi:10.1210/en.2012-1122)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Baynes SM & Scott AP 1985 Seasonal variations in parameters of milt production and in plasma concentration of sex steroids of male rainbow trout (Salmo gairdneri). General and Comparative Endocrinology 57 150160. (doi:10.1016/0016-6480(85)90211-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Belanger RM, Pachkowski MD & Stacey NE 2010 Methyltestosterone-induced changes in electro-olfactogram responses and courtship behaviors of cyprinids. Chemical Senses 35 6574. (doi:10.1093/chemse/bjp085)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Blaustein JD 1986 Steroid receptors and hormone action in the brain. Annals of the New York Academy of Sciences 474 400414. (doi:10.1111/j.1749-6632.1986.tb28030.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ & Voytas DF 2011 Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Research 185 19.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen W & Ge W 2012 Ontogenic expression profiles of gonadotropins (fshb and lhb) and growth hormone (gh) during sexual differentiation and puberty onset in female zebrafish. Biology of Reproduction 86 111.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen SX, Bogerd J, García-López Á, Jonge H, de Waal PP, Hong WS & Schulz RW 2010 Molecular cloning and functional characterization of a zebrafish nuclear progesterone receptor. Biology of Reproduction 82 171181. (doi:10.1095/biolreprod.109.077644)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen SX, Bogerd J, Schoonen NE, Martijn J, de Waal PP & Schulz RW 2013 A progestin (17α, 20β-dihydroxy-4-pregnen-3-one) stimulates early stages of spermatogenesis in zebrafish. General and Comparative Endocrinology 185 19. (doi:10.1016/j.ygcen.2013.01.005)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chu L, Li J, Liu Y, Hu W & Cheng CH 2014 Targeted gene disruption in zebrafish reveals noncanonical functions of LH signaling in reproduction. Molecular Endocrinology 28 92929296.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Conneely OM, Sullivan WP, Toft DO, Birnbaumer M, Cook RG, Maxwell BL, Zarucki-Schulz T, Greene GL, Schrader WT & O’Malley BW 1986 Molecular cloning of the chicken progesterone receptor. Science 233 767770. (doi:10.1126/science.2426779)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Corbani M, Counis R, Wolinska-Witort E, d’Angelo-Bernard G, Moumni M & Jutisz M 1990 Synergistic effects of progesterone and oestradiol on rat LH subunit mRNA. Journal of Molecular Endocrinology 4 119125.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • De Waal PP, Leal MC, García-López Á, Liarte S, de Jonge H, Hinfray N, Brion F, Schulz RW & Bogerd J 2009 Oestrogen-induced androgen insufficiency results in a reduction of proliferation and differentiation of spermatogonia in the zebrafish testis. Journal of Endocrinology 202 287297. (doi:10.1677/JOE-09-0050)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dulka JG, Stacey NE, Sorensen PW & Vanderkraak GJ 1987 A steroid sex pheromone synchronizes male–female spawning readiness in goldfish. Nature 325 251253. (doi:10.1038/325251a0)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Golan M, Martin AO, Mollard P & Levavi-Sivan B 2016 Anatomical and functional gonadotrope networks in the teleost pituitary. Scientific Reports 6 23777. (doi:10.1038/srep23777)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hanna RN & Zhu Y 2009 Expression of membrane progestin receptors in zebrafish (Danio rerio) oocytes, testis and pituitary. General and Comparative Endocrinology 161 153157. (doi:10.1016/j.ygcen.2008.10.006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hanna RN & Zhu Y 2011 Controls of meiotic signaling by membrane or nuclear progestin receptor in zebrafish follicle-enclosed oocytes. Molecular and Cellular Endocrinology 337 8088. (doi:10.1016/j.mce.2011.02.004)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hanna RN, Daly SCJ, Pang Y, Anglade I, Kah O, Thomas P & Zhu Y 2010 Characterization and expression of the nuclear progestin receptor in zebrafish gonads and brain. Biology of Reproduction 82 112122. (doi:10.1095/biolreprod.109.078527)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Huang P, Xiao A, Zhou M, Zhu Z, Lin S & Zhang BN 2011 Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology 29 699700. (doi:10.1038/nbt.1939)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Huggard-Nelson DL, Nathwani PS, Kermouni A & Habibi HR 2002 Molecular characterization of LH-β and FSH-β subunits and their regulation by estrogen in the goldfish pituitary. Molecular and Cellular Endocrinology 188 171193. (doi:10.1016/S0303-7207(01)00716-X)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kerrigan JR, Dalkin AC, Haisenleder DJ, Yasin M & Marshall JC 1993 Failure of gonadotropin-releasing hormone (GnRH) pulses to increase luteinizing hormone beta messenger ribonucleic acid in GnRH-deficient female rats. Endocrinology 133 20712079.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kobayashi M, Sohn YC, Yoshiur Y & Aida K 2000 Effects of sex steroids on the mRNA levels of gonadotropin subunits in juvenile and ovariectomized goldfish Carassius auratus. Fisheries Science 66 223231. (doi:10.1046/j.1444-2906.2000.00038.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kobayashi M, Sorensen PW & Stacey NE 2002 Hormonal and pheromonal control of spawning behavior in the goldfish. Fish Physiology Biochemistry 26 7184. (doi:10.1023/A:1023375931734)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Levavi-Sivan B, Biran J & Fireman E 2006 Sex steroids are involved in the regulation of gonadotropin-releasing hormone and dopamine D2 receptors in female tilapia pituitary. Biology of Reproduction 75 642650.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lin SW & Ge W 2009 Differential regulation of gonadotropins (FSH and LH) and growth hormone (GH) by neuroendocrine, endocrine, and paracrine factors in the zebrafish – an in vitro approach. General and Comparative Endocrinology 160 183193.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Miura T, Yamauchi K, Takahashi H & Nagahama Y 1992 The role of hormones in the acquisition of sperm motility in salmonid fish. Journal of Experimental Zoology 261 359363. (doi:10.1002/jez.1402610316)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Miura T, Higuchi M, Ozaki Y, Ohta T & Miura C 2006 Progestin is an essential factor for the initiation of the meiosis in spermatogenetic cells of the eel. PNAS 103 73337338. (doi:10.1073/pnas.0508419103)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nóbrega RH, Morais RD, Crespo D, de Waal PP, de Franca LR, Schulz RW & Bogerd J 2015 Fsh stimulates spermatogonial proliferation and differentiation in zebrafish via Igf3. Endocrinology 156 38043817. (doi:10.1210/en.2015-1157)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • O’byrne KT, Thalabard JC, Grosser PM, Wilson RC, Williams CL, Chen MD, Ladendorf D, Hotchkiss J & Knobil E 1991 Radiotelemetric monitoring of hypothalamic gonadotropin-releasing hormone pulse generator activity throughout the menstrual cycle of the rhesus monkey. Endocrinology 129 12071214. (doi:10.1210/endo-129-3-1207)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Park D, Kim C, Kim K & Ryu K 1996 Progesterone together with estradiol promotes luteinizing hormone β-subunit mRNA stability in rat pituitary cells cultured in vitro. European Journal of Endocrinology 134 236242. (doi:10.1530/eje.0.1340236)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pawlowski S, Van Aerle R, Tyler CR & Braunbeck T 2004 Effects of 17α-ethinylestradiol in a fathead minnow (Pimephales promelas) gonadal recrudescence assay. Ecotoxicology and Environmental Safety 57 330345. (doi:10.1016/j.ecoenv.2003.07.019)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schmittgen TD & Livak KJ 2008 Analyzing real-time PCR data by the comparative CT method. Nature Protocol 3 11011108. (doi:10.1038/nprot.2008.73)

  • Schneider JS, Burgess C, Sleiter NC, DonCarlos LL, Lydon JD & O’Malley B 2005 Enhanced sexual behaviors and androgen receptor immunoreactivity in the male progesterone receptor knockout mouse. Endocrinology 146 43404348. (doi:10.1210/en.2005-0490)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schulz RW, de França LR, Lareyre JJ, Gac FL, Garcia HC, Nobrega RH & Miura T 2010 Spermatogenesis in fish. General and Comparative Endocrinology 165 390411. (doi:10.1016/j.ygcen.2009.02.013)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Scott AP, Sumpter JP & Stacey N 2010 The role of the maturation-inducing steroid, 17, 20β-dihydroxypregn-4-en-3-one, in male fishes: a review. Journal of Fish Biology 76 183224.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Simard J, Labrie C, Hubert JF & Labrie F 1988 Modulation by sex steroids and [D-TRP6,Des-Gly-NH210] luteinizing hormone (LH)-releasing hormone ethylamide of α-subunit and LHβmessenger ribonucleic acid levels in the rat anterior pituitary gland. Molecular Endocrinology 2 775784. (doi:10.1210/mend-2-9-775)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Skaar KS, Nobrega RH, Magaraki A, Olsen LC, Schulz RW & Male R 2011 Proteolytically activated, recombinant anti-Müllerian hormone inhibits androgen secretion, proliferation, and differentiation of spermatogonia in adult zebrafish testis organ cultures. Endocrinology 152 35273540. (doi:10.1210/en.2010-1469)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Skinner DC, Evans NP, Delaleu B, Goodman RL, Bouchard P & Caraty A 1998 The negative feedback actions of progesterone on gonadotropin-releasing hormone secretion are transduced by the classical progesterone receptor. PNAS 95 1097810983.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sleiter N, Pang Y, Park C, Horton TH, Dong J, Thomas P & Levine JE 2009 Progesterone receptor A (PRA) and PRB-independent effects of progesterone on gonadotropin-releasing hormone release. Endocrinology 150 38333844.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • So WK, Kwok HF & Ge W 2005 Zebrafish gonadotropins and their receptors: II. Cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone subunits – their spatial-temporal expression patterns and receptor specificity. Biology of Reproduction 72 13821396. (doi:10.1095/biolreprod.104.038216)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Stacey NE & Sorensen PW 1986 17α, 20β-dihydroxy-4-pregnen-3-one: a steroidal primer pheromone increasing milt volume in the goldfish, Carassius auratus. Canadian Journal of Zoology 64 24122417. (doi:10.1139/z86-360)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tan W & Thomas P 2015 Involvement of epidermal growth factor receptors and mitogen-activated protein kinase in progestin-induction of sperm hypermotility in Atlantic croaker through membrane progestinreceptor-alpha. Molecular and Cellular Endocrinology 414 194201. (doi:10.1016/j.mce.2015.06.023)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thackray VG, McGillivray SM & Mellon PL 2006 Androgens, progestins, and glucocorticoids induce follicle-stimulating hormone β-subunit gene expression at the level of the gonadotrope. Molecular Endocrinology 20 20622079. (doi:10.1210/me.2005-0316)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thackray VG, Hunnicutt JL, Memon AK, Ghochani Y & Mellon PL 2009 Progesterone Inhibits basal and gonadotropin-releasing hormone induction of luteinizing hormone β-subunit gene expression. Endocrinology 150 23952403. (doi:10.1210/en.2008-1027)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thomas P 2008 Characteristics of membrane progestin receptor alpha (mPRα) and progesterone membrane receptor component 1 (PGMRC1) and their roles in mediating rapid progestin actions. Frontiers in Neuroendocrinology 29 292312.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tubbs C & Thomas P 2008 Functional characteristics of membrane progestin receptor alpha (mPRα) subtypes: a review with new data showing mPRα expression in seatrout sperm and its association with sperm motility. Steroids 73 935941. (doi:10.1016/j.steroids.2007.12.022)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Turgeon JL & Waring DW 1990 Rapid augmentation by progesterone of agonist-stimulated luteinizing hormone secretion by cultured pituitary cells. Endocrinology 127 773780. (doi:10.1210/endo-127-2-773)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Turgeon JL & Waring DW 2000 Progesterone regulation of the progesterone receptor in rat gonadotropes 1. Endocrinology 141 34223429.

  • Turgeon JL, Kimura Y, Waring DW & Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Molecular Endocrinology 10 439450.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ueda H, Kambegawa A & Nagahama Y 1985 Involvement of gonadotrophin and steroid hormones in spermiation in the amago salmon, Oncorhynchus rhodurus, and goldfish, Carassius auratus. General and Comparative Endocrinology 59 2430. (doi:10.1016/0016-6480(85)90415-0)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Van den Belt K, Berckmans P, Vangenechten C, Verheyen R & Witters H 2004 Comparative study on the in vitro/in vivo estrogenic potencies of 17β-estradiol, estrone, 17α-ethynylestradiol and nonylphenol. Aquatic Toxicology 66 183195. (doi:10.1016/j.aquatox.2003.09.004)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Van der Kraak G 2009 The GnRH system and the neuroendocrine regulation of reproduction. Fish Physiology 28 115149. (doi:10.1016/S1546-5098(09)28003-4)

  • Van der Ven L, Wester PW & Vos JG 2003 Histopathology as a tool for the evaluation of endocrine disruption in zebrafish (Danio rerio). Environmental Toxicology Chemistry 22 908913. (doi:10.1897/1551-5028(2003)022<0908:HAATFT>2.0.CO;2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Van der Ven L, Van den Brandhof EJ, Vos JH & Wester PW 2007 Effects of the estrogen agonist 17β-estradiol and antagonist tamoxifen in a partial life-cycle assay with zebrafish (Danio rerio). Environmental Toxicology Chemistry 26 9299. (doi:10.1897/06-092R1.1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Waring DW & Turgeon JL 1992 A pathway for luteinizing hormone releasing-hormone self-potentiation: cross-talk with the progesterone receptor. Endocrinology 130 32753282.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Westerfield M 2000 The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio). Eugene, OR, USA: University of Oregon Press.

  • Zhang Z, Lau SW, Zhang L & Ge W 2015a Disruption of zebrafish follicle-stimulating hormone receptor (fshr) but not luteinizing hormone receptor (lhcgr) gene by TALEN leads to failed follicle activation in females followed by sexual reversal to males. Endocrinology 156 37473762.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhang Z, Zhu B & Ge W 2015b Genetic analysis of zebrafish gonadotropin (FSH and LH) functions by TALEN-mediated gene disruption. Molecular Endocrinology 29 7698.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhu Y, Rice CD, Pang Y, Pace M & Thomas P 2003 Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. PNAS 100 22312236. (doi:10.1073/pnas.0336132100)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhu Y, Hanna RN, Schaaf MJM, Spaink HP & Thomas P 2008 Candidates for membrane progestin receptors – past approaches and future challenges. Comparative Biochemistry & Physiology Part C: Toxicology & Pharmacology 148 381389.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhu Y, Liu D, Shaner ZC, Chen S, Hong W & Stellwag EJ 2015 Nuclear progestin receptor (Pgr) knockouts in zebrafish demonstrate role for Pgr in ovulation but not in rapid non-genomic steroid mediated meiosis resumption. Frontiers in Endocrinology 6 37.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zohar Y, Muñoz-Cueto JA, Elizur A & Kah O 2010 Neuroendocrinology of reproduction in teleost fish. General and Comparative Endocrinology 165 438455. (doi:10.1016/j.ygcen.2009.04.017)

    • PubMed
    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • Genomic structure of the rzebrafish pgr gene, TALEN targets, and a representative mutation induced by TALENs. (A) TALENs were designed to target the first exon of the pgr gene. The left and right binding sites of TALENs are underlined, and a restriction enzyme cleavage site with PauI used for mutation analysis is highlighted in bold. Forward and reverse primers for PCR amplification of the genomic fragment including the target region are also indicated by the arrow lines. (B) Mutation detection in injected F0 founder embryos using PauI restriction enzyme digestion (mutation efficiency 29.1%). (C) Genotype examination of F1 adult zebrafish using restriction enzyme digestion and tailfin clipping. Fish were individually numbered and are indicated on the top of the figure. No. 3 and 5 were wild-type fish, No. 1, 2, 4, 6, 7, and 8 were heterozygote fish. (D) Genotype examination of F2 adult zebrafish. Individual fish were numbered and are indicated on the top of the figure. No. 1, 2, 3, 4, 6, 7, 8, and 9 were heterozygote fish; No. 5 was a homozygote fish. (E) DNA sequences of wild type or Pgr mutant. Nucleotide deletion is indicated by dashed lines. The numbers at the right side show the number of deleted base pairs. (F) Western blot of the Pgr of zebrafish testes. Sample types are indicated on the top of the figure. F, forward; R, reverse; No., number; WT, wild type; pgr–/–, Pgr knockout.

  • Effects of E2and DHP administration on fshb (A) and lhb (B) mRNA levels in the pituitaries of wild-type male zebrafish. Zebrafish were maintained in the presence of E2 (10nM) alone for 3 weeks (E2) or in the additional presence of 100 nM DHP during the last 24h (E2+DHP) of the total 3-week-long exposure to E2 in vivo. The same batch of male zebrafish without E2 pretreatment were treated with DHP (100 nM) for 24h in vivo. The levels of fshb and lhb mRNA were determined using qPCR and normalized to the internal control gene (ef1a). Data are expressed as the mean ± s.e.m. (n=6) relative to the respective transcript levels of the control value. Mean values marked with different letters are significantly different from each other (P < 0.05).

  • Dose- (A and B) and time (C and D)-dependent stimulation of progestin on the expression of fshb and lhb transcripts in the pituitaries of wild-type male zebrafish in vivo. Male zebrafish were treated with DHP (10 or 100nM) for 24h (13:00–13:00 next day) in vivo (panels A and B). Thereafter, based on the dose-response experiment, an optimal dose level (100nM) was selected in the time course experiment (panels C and D). Transcript levels of fshb or lhb at time zero without progestin exposure are defined as one, and data (mean ± s.e.m., n=6) are expressed as fold changes to the zero value. Mean values marked with different letters are significantly different from each other (P<0.05).

  • Effects of RU486 on DHP-stimulated fshb and lhb transcript expression levels of the wild-type (WT) male zebrafish. Data are expressed as the mean ± s.e.m. (n=6) relative to the respective transcript levels of the WT control (A and B). Mean values marked with different letters are significantly different from each other (P < 0.05).

  • Diurnal changes of fshb (A) and lhb (B) transcripts in the pituitaries of the wild-type (WT) male zebrafish, and the levels of fshb (C) and lhb (D) in the pituitaries of the WT, pgr+/+, and pgr–/– male zebrafish collected at 06:00. Data are expressed as the mean ± s.e.m. (n=6) relative to the respective transcript levels at 10:00 (A and B) or WT (C and D). Mean values marked with different letters are significantly different from each other (P < 0.05).

  • Stimulatory effects of DHP in the expression of fshb (A) and lhb (B) transcripts in the pituitaries were significantly blocked in pgr–/– male zebrafish. Wild type (WT+DHP group) and pgr–/– (pgr–/– + DHP group) male zebrafish were treated with (100 nM) DHP for 24 h (13:00–13:00 next day). Wild-type control (WT control) and pgr–/– control groups were treated with the vehicle (0.0001%) for 24 h (13:00–13:00 next day). The levels of fshb and lhb mRNA were determined using qPCR and normalized to the internal control gene (ef1a). Transcript levels of fshb and lhb obtained at the WT control are defined as one, and data (mean ± s.e.m., n=6) are expressed as fold changes to the WT control. Mean values marked with different letters are significantly different from each other (P < 0.05).

  • Ex vivo effects of DHP administration on fshb (A) and lhb (B) mRNA levels. Pituitary fragments of wild type (WT), pgr+/+, and pgr–/– male zebrafish were treated with 100 nM DHP for 24 h (13:00–13:00 next day). WT, pgr+/+, and pgr–/– controls were treated with the vehicle (0.0001%) for 24h (13:00–13:00 next day). The levels of fshb and lhb mRNA were determined using qPCR and normalized to the internal control gene (ef1a). Transcript levels of fshb or lhb obtained at the WT control are defined as one, and data are expressed as the mean ± s.e.m. (n=6) relative to the respective transcript levels of the WT control value. Bars marked with * are significantly different from their respective controls (P<0.05).

  • pgr mRNAs were expressed in fshb-expressing cells but not in lhb-expressing cells. (A) Cryosection stained for fshb (red) and lhb (green); (B) Cryosection stained for lhb (red) and pgr (green); (C and D) Cryosection stained for fshb (red) and pgr (green); and (E and F) Cryosection stained for fshb (red) and pgr (green); scale bars=50 μM. A full colour version of this figure is available at http://dx.doi.org/10.1530/JOE-16-0073.

  • Abbot SD, Docherty K & Clayton RN 1988 Regulation of LH subunit mRNA levels by gonadal hormones in female rats. Journal of Molecular Endocrinology 1 4960. (doi:10.1677/jme.0.0010049)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bashour NM & Wray S 2012 Progesterone directly and rapidly inhibits GnRH neuronal activity via progesterone receptor membrane component 1. Endocrinology 153 44574469. (doi:10.1210/en.2012-1122)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Baynes SM & Scott AP 1985 Seasonal variations in parameters of milt production and in plasma concentration of sex steroids of male rainbow trout (Salmo gairdneri). General and Comparative Endocrinology 57 150160. (doi:10.1016/0016-6480(85)90211-4)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Belanger RM, Pachkowski MD & Stacey NE 2010 Methyltestosterone-induced changes in electro-olfactogram responses and courtship behaviors of cyprinids. Chemical Senses 35 6574. (doi:10.1093/chemse/bjp085)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Blaustein JD 1986 Steroid receptors and hormone action in the brain. Annals of the New York Academy of Sciences 474 400414. (doi:10.1111/j.1749-6632.1986.tb28030.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ & Voytas DF 2011 Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Research 185 19.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen W & Ge W 2012 Ontogenic expression profiles of gonadotropins (fshb and lhb) and growth hormone (gh) during sexual differentiation and puberty onset in female zebrafish. Biology of Reproduction 86 111.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen SX, Bogerd J, García-López Á, Jonge H, de Waal PP, Hong WS & Schulz RW 2010 Molecular cloning and functional characterization of a zebrafish nuclear progesterone receptor. Biology of Reproduction 82 171181. (doi:10.1095/biolreprod.109.077644)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen SX, Bogerd J, Schoonen NE, Martijn J, de Waal PP & Schulz RW 2013 A progestin (17α, 20β-dihydroxy-4-pregnen-3-one) stimulates early stages of spermatogenesis in zebrafish. General and Comparative Endocrinology 185 19. (doi:10.1016/j.ygcen.2013.01.005)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chu L, Li J, Liu Y, Hu W & Cheng CH 2014 Targeted gene disruption in zebrafish reveals noncanonical functions of LH signaling in reproduction. Molecular Endocrinology 28 92929296.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Conneely OM, Sullivan WP, Toft DO, Birnbaumer M, Cook RG, Maxwell BL, Zarucki-Schulz T, Greene GL, Schrader WT & O’Malley BW 1986 Molecular cloning of the chicken progesterone receptor. Science 233 767770. (doi:10.1126/science.2426779)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Corbani M, Counis R, Wolinska-Witort E, d’Angelo-Bernard G, Moumni M & Jutisz M 1990 Synergistic effects of progesterone and oestradiol on rat LH subunit mRNA. Journal of Molecular Endocrinology 4 119125.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • De Waal PP, Leal MC, García-López Á, Liarte S, de Jonge H, Hinfray N, Brion F, Schulz RW & Bogerd J 2009 Oestrogen-induced androgen insufficiency results in a reduction of proliferation and differentiation of spermatogonia in the zebrafish testis. Journal of Endocrinology 202 287297. (doi:10.1677/JOE-09-0050)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dulka JG, Stacey NE, Sorensen PW & Vanderkraak GJ 1987 A steroid sex pheromone synchronizes male–female spawning readiness in goldfish. Nature 325 251253. (doi:10.1038/325251a0)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Golan M, Martin AO, Mollard P & Levavi-Sivan B 2016 Anatomical and functional gonadotrope networks in the teleost pituitary. Scientific Reports 6 23777. (doi:10.1038/srep23777)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hanna RN & Zhu Y 2009 Expression of membrane progestin receptors in zebrafish (Danio rerio) oocytes, testis and pituitary. General and Comparative Endocrinology 161 153157. (doi:10.1016/j.ygcen.2008.10.006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hanna RN & Zhu Y 2011 Controls of meiotic signaling by membrane or nuclear progestin receptor in zebrafish follicle-enclosed oocytes. Molecular and Cellular Endocrinology 337 8088. (doi:10.1016/j.mce.2011.02.004)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hanna RN, Daly SCJ, Pang Y, Anglade I, Kah O, Thomas P & Zhu Y 2010 Characterization and expression of the nuclear progestin receptor in zebrafish gonads and brain. Biology of Reproduction 82 112122. (doi:10.1095/biolreprod.109.078527)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Huang P, Xiao A, Zhou M, Zhu Z, Lin S & Zhang BN 2011 Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology 29 699700. (doi:10.1038/nbt.1939)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Huggard-Nelson DL, Nathwani PS, Kermouni A & Habibi HR 2002 Molecular characterization of LH-β and FSH-β subunits and their regulation by estrogen in the goldfish pituitary. Molecular and Cellular Endocrinology 188 171193. (doi:10.1016/S0303-7207(01)00716-X)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kerrigan JR, Dalkin AC, Haisenleder DJ, Yasin M & Marshall JC 1993 Failure of gonadotropin-releasing hormone (GnRH) pulses to increase luteinizing hormone beta messenger ribonucleic acid in GnRH-deficient female rats. Endocrinology 133 20712079.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kobayashi M, Sohn YC, Yoshiur Y & Aida K 2000 Effects of sex steroids on the mRNA levels of gonadotropin subunits in juvenile and ovariectomized goldfish Carassius auratus. Fisheries Science 66 223231. (doi:10.1046/j.1444-2906.2000.00038.x)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kobayashi M, Sorensen PW & Stacey NE 2002 Hormonal and pheromonal control of spawning behavior in the goldfish. Fish Physiology Biochemistry 26 7184. (doi:10.1023/A:1023375931734)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Levavi-Sivan B, Biran J & Fireman E 2006 Sex steroids are involved in the regulation of gonadotropin-releasing hormone and dopamine D2 receptors in female tilapia pituitary. Biology of Reproduction 75 642650.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lin SW & Ge W 2009 Differential regulation of gonadotropins (FSH and LH) and growth hormone (GH) by neuroendocrine, endocrine, and paracrine factors in the zebrafish – an in vitro approach. General and Comparative Endocrinology 160 183193.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Miura T, Yamauchi K, Takahashi H & Nagahama Y 1992 The role of hormones in the acquisition of sperm motility in salmonid fish. Journal of Experimental Zoology 261 359363. (doi:10.1002/jez.1402610316)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Miura T, Higuchi M, Ozaki Y, Ohta T & Miura C 2006 Progestin is an essential factor for the initiation of the meiosis in spermatogenetic cells of the eel. PNAS 103 73337338. (doi:10.1073/pnas.0508419103)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nóbrega RH, Morais RD, Crespo D, de Waal PP, de Franca LR, Schulz RW & Bogerd J 2015 Fsh stimulates spermatogonial proliferation and differentiation in zebrafish via Igf3. Endocrinology 156 38043817. (doi:10.1210/en.2015-1157)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • O’byrne KT, Thalabard JC, Grosser PM, Wilson RC, Williams CL, Chen MD, Ladendorf D, Hotchkiss J & Knobil E 1991 Radiotelemetric monitoring of hypothalamic gonadotropin-releasing hormone pulse generator activity throughout the menstrual cycle of the rhesus monkey. Endocrinology 129 12071214. (doi:10.1210/endo-129-3-1207)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Park D, Kim C, Kim K & Ryu K 1996 Progesterone together with estradiol promotes luteinizing hormone β-subunit mRNA stability in rat pituitary cells cultured in vitro. European Journal of Endocrinology 134 236242. (doi:10.1530/eje.0.1340236)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pawlowski S, Van Aerle R, Tyler CR & Braunbeck T 2004 Effects of 17α-ethinylestradiol in a fathead minnow (Pimephales promelas) gonadal recrudescence assay. Ecotoxicology and Environmental Safety 57 330345. (doi:10.1016/j.ecoenv.2003.07.019)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schmittgen TD & Livak KJ 2008 Analyzing real-time PCR data by the comparative CT method. Nature Protocol 3 11011108. (doi:10.1038/nprot.2008.73)

  • Schneider JS, Burgess C, Sleiter NC, DonCarlos LL, Lydon JD & O’Malley B 2005 Enhanced sexual behaviors and androgen receptor immunoreactivity in the male progesterone receptor knockout mouse. Endocrinology 146 43404348. (doi:10.1210/en.2005-0490)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schulz RW, de França LR, Lareyre JJ, Gac FL, Garcia HC, Nobrega RH & Miura T 2010 Spermatogenesis in fish. General and Comparative Endocrinology 165 390411. (doi:10.1016/j.ygcen.2009.02.013)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Scott AP, Sumpter JP & Stacey N 2010 The role of the maturation-inducing steroid, 17, 20β-dihydroxypregn-4-en-3-one, in male fishes: a review. Journal of Fish Biology 76 183224.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Simard J, Labrie C, Hubert JF & Labrie F 1988 Modulation by sex steroids and [D-TRP6,Des-Gly-NH210] luteinizing hormone (LH)-releasing hormone ethylamide of α-subunit and LHβmessenger ribonucleic acid levels in the rat anterior pituitary gland. Molecular Endocrinology 2 775784. (doi:10.1210/mend-2-9-775)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Skaar KS, Nobrega RH, Magaraki A, Olsen LC, Schulz RW & Male R 2011 Proteolytically activated, recombinant anti-Müllerian hormone inhibits androgen secretion, proliferation, and differentiation of spermatogonia in adult zebrafish testis organ cultures. Endocrinology 152 35273540. (doi:10.1210/en.2010-1469)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Skinner DC, Evans NP, Delaleu B, Goodman RL, Bouchard P & Caraty A 1998 The negative feedback actions of progesterone on gonadotropin-releasing hormone secretion are transduced by the classical progesterone receptor. PNAS 95 1097810983.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sleiter N, Pang Y, Park C, Horton TH, Dong J, Thomas P & Levine JE 2009 Progesterone receptor A (PRA) and PRB-independent effects of progesterone on gonadotropin-releasing hormone release. Endocrinology 150 38333844.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • So WK, Kwok HF & Ge W 2005 Zebrafish gonadotropins and their receptors: II. Cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone subunits – their spatial-temporal expression patterns and receptor specificity. Biology of Reproduction 72 13821396. (doi:10.1095/biolreprod.104.038216)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Stacey NE & Sorensen PW 1986 17α, 20β-dihydroxy-4-pregnen-3-one: a steroidal primer pheromone increasing milt volume in the goldfish, Carassius auratus. Canadian Journal of Zoology 64 24122417. (doi:10.1139/z86-360)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tan W & Thomas P 2015 Involvement of epidermal growth factor receptors and mitogen-activated protein kinase in progestin-induction of sperm hypermotility in Atlantic croaker through membrane progestinreceptor-alpha. Molecular and Cellular Endocrinology 414 194201. (doi:10.1016/j.mce.2015.06.023)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thackray VG, McGillivray SM & Mellon PL 2006 Androgens, progestins, and glucocorticoids induce follicle-stimulating hormone β-subunit gene expression at the level of the gonadotrope. Molecular Endocrinology 20 20622079. (doi:10.1210/me.2005-0316)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thackray VG, Hunnicutt JL, Memon AK, Ghochani Y & Mellon PL 2009 Progesterone Inhibits basal and gonadotropin-releasing hormone induction of luteinizing hormone β-subunit gene expression. Endocrinology 150 23952403. (doi:10.1210/en.2008-1027)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thomas P 2008 Characteristics of membrane progestin receptor alpha (mPRα) and progesterone membrane receptor component 1 (PGMRC1) and their roles in mediating rapid progestin actions. Frontiers in Neuroendocrinology 29 292312.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tubbs C & Thomas P 2008 Functional characteristics of membrane progestin receptor alpha (mPRα) subtypes: a review with new data showing mPRα expression in seatrout sperm and its association with sperm motility. Steroids 73 935941. (doi:10.1016/j.steroids.2007.12.022)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Turgeon JL & Waring DW 1990 Rapid augmentation by progesterone of agonist-stimulated luteinizing hormone secretion by cultured pituitary cells. Endocrinology 127 773780. (doi:10.1210/endo-127-2-773)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Turgeon JL & Waring DW 2000 Progesterone regulation of the progesterone receptor in rat gonadotropes 1. Endocrinology 141 34223429.

  • Turgeon JL, Kimura Y, Waring DW & Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Molecular Endocrinology 10 439450.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ueda H, Kambegawa A & Nagahama Y 1985 Involvement of gonadotrophin and steroid hormones in spermiation in the amago salmon, Oncorhynchus rhodurus, and goldfish, Carassius auratus. General and Comparative Endocrinology 59 2430. (doi:10.1016/0016-6480(85)90415-0)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Van den Belt K, Berckmans P, Vangenechten C, Verheyen R & Witters H 2004 Comparative study on the in vitro/in vivo estrogenic potencies of 17β-estradiol, estrone, 17α-ethynylestradiol and nonylphenol. Aquatic Toxicology 66 183195. (doi:10.1016/j.aquatox.2003.09.004)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Van der Kraak G 2009 The GnRH system and the neuroendocrine regulation of reproduction. Fish Physiology 28 115149. (doi:10.1016/S1546-5098(09)28003-4)

  • Van der Ven L, Wester PW & Vos JG 2003 Histopathology as a tool for the evaluation of endocrine disruption in zebrafish (Danio rerio). Environmental Toxicology Chemistry 22 908913. (doi:10.1897/1551-5028(2003)022<0908:HAATFT>2.0.CO;2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Van der Ven L, Van den Brandhof EJ, Vos JH & Wester PW 2007 Effects of the estrogen agonist 17β-estradiol and antagonist tamoxifen in a partial life-cycle assay with zebrafish (Danio rerio). Environmental Toxicology Chemistry 26 9299. (doi:10.1897/06-092R1.1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Waring DW & Turgeon JL 1992 A pathway for luteinizing hormone releasing-hormone self-potentiation: cross-talk with the progesterone receptor. Endocrinology 130 32753282.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Westerfield M 2000 The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio). Eugene, OR, USA: University of Oregon Press.

  • Zhang Z, Lau SW, Zhang L & Ge W 2015a Disruption of zebrafish follicle-stimulating hormone receptor (fshr) but not luteinizing hormone receptor (lhcgr) gene by TALEN leads to failed follicle activation in females followed by sexual reversal to males. Endocrinology 156 37473762.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhang Z, Zhu B & Ge W 2015b Genetic analysis of zebrafish gonadotropin (FSH and LH) functions by TALEN-mediated gene disruption. Molecular Endocrinology 29 7698.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhu Y, Rice CD, Pang Y, Pace M & Thomas P 2003 Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. PNAS 100 22312236. (doi:10.1073/pnas.0336132100)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhu Y, Hanna RN, Schaaf MJM, Spaink HP & Thomas P 2008 Candidates for membrane progestin receptors – past approaches and future challenges. Comparative Biochemistry & Physiology Part C: Toxicology & Pharmacology 148 381389.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhu Y, Liu D, Shaner ZC, Chen S, Hong W & Stellwag EJ 2015 Nuclear progestin receptor (Pgr) knockouts in zebrafish demonstrate role for Pgr in ovulation but not in rapid non-genomic steroid mediated meiosis resumption. Frontiers in Endocrinology 6 37.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zohar Y, Muñoz-Cueto JA, Elizur A & Kah O 2010 Neuroendocrinology of reproduction in teleost fish. General and Comparative Endocrinology 165 438455. (doi:10.1016/j.ygcen.2009.04.017)

    • PubMed
    • Search Google Scholar
    • Export Citation