Metformin increases hepatic leptin receptor and decreases steatosis in mice

in Journal of Endocrinology

In addition to the ascertained efficacy as antidiabetic drug, metformin is increasingly being used as weight-loss agent in obesity, and as insulin sensitizer in nonalcoholic fatty liver disease (NAFLD). However, the mechanisms underlying these effects are still incompletely understood. Emerging evidence suggest metformin as leptin sensitizer to mediate the weight-loss effect in the brain. In this study, we investigated effects of metformin on expression of leptin receptors in liver and kidney in mice. C57BL/6 mice were fed with chow diet (CD) or high-fat diet (HF) for 5months. Afterward, mice were treated with metformin (50mg/kg or 200mg/kg) for 15days. Metabolic parameters and hepatic gene expression were analyzed at the end of the treatment. We also tested the effects of metformin on plasma-soluble leptin receptor (sOB-R) levels in newly diagnosed type 2 diabetes mellitus (T2DM) patients, and assessed its effect on hepatosteatosis in mice. Results showed that metformin upregulates the expression of leptin receptors (OB-Ra, -Rb, -Rc, and -Rd) in liver but not kidney. The stimulation effect is dose-dependent in both chow and HF mice. Upregulation of OB-Rb, long signaling isoform, needs a relatively higher dose of metformin. This effect was paralleled by increased sOBR levels in mice and T2DM patients, and decreased hepatic triglyceride (TG) content and lipogenic gene expression, including sterol regulatory element-binding protein 1c (SREBP-1c), fatty acid synthase (FAS) and acetyl-CoA carboxylase-1 (ACC-1). Taken together, these data identify hepatic leptin receptor as target gene being upregulated by metformin which may enhance leptin sensitivity in liver to alleviate steatosis.

Abstract

In addition to the ascertained efficacy as antidiabetic drug, metformin is increasingly being used as weight-loss agent in obesity, and as insulin sensitizer in nonalcoholic fatty liver disease (NAFLD). However, the mechanisms underlying these effects are still incompletely understood. Emerging evidence suggest metformin as leptin sensitizer to mediate the weight-loss effect in the brain. In this study, we investigated effects of metformin on expression of leptin receptors in liver and kidney in mice. C57BL/6 mice were fed with chow diet (CD) or high-fat diet (HF) for 5months. Afterward, mice were treated with metformin (50mg/kg or 200mg/kg) for 15days. Metabolic parameters and hepatic gene expression were analyzed at the end of the treatment. We also tested the effects of metformin on plasma-soluble leptin receptor (sOB-R) levels in newly diagnosed type 2 diabetes mellitus (T2DM) patients, and assessed its effect on hepatosteatosis in mice. Results showed that metformin upregulates the expression of leptin receptors (OB-Ra, -Rb, -Rc, and -Rd) in liver but not kidney. The stimulation effect is dose-dependent in both chow and HF mice. Upregulation of OB-Rb, long signaling isoform, needs a relatively higher dose of metformin. This effect was paralleled by increased sOBR levels in mice and T2DM patients, and decreased hepatic triglyceride (TG) content and lipogenic gene expression, including sterol regulatory element-binding protein 1c (SREBP-1c), fatty acid synthase (FAS) and acetyl-CoA carboxylase-1 (ACC-1). Taken together, these data identify hepatic leptin receptor as target gene being upregulated by metformin which may enhance leptin sensitivity in liver to alleviate steatosis.

Introduction

Metformin is the first-line antihyperglycemia agent for T2DM patients. The mechanisms by which metformin improves glycemic control is mainly by reducing hepatic glucose production, and to a lesser extent, via enhancing peripheral insulin sensitivity, blocking gastrointestinal glucose absorption, modulating gut microbiota and promoting incretin axis (Ikeda et al. 2000, Green et al. 2006, Maida et al. 2011, Miller et al. 2013, Foretz et al. 2014, Madiraju et al. 2014, Shin et al. 2014). In addition to its antidiabetic effects, metformin demonstrates multiple beneficial ‘side effects’ such as antiobesity, antihepatosteatotic and anti-inflammatory effects, and is currently in clinical trials to treat obesity (Malin & Kashyap 2014), NAFLD (Zheng et al. 2015), polycystic ovary syndrome (PCOS) (Misso & Teede 2015) and certain types of cancer (Leone et al. 2014, Morales & Morris 2015). Emerging evidence suggests that enhanced leptin sensitivity may contribute to the weight-loss effect of this drug (Aubert et al. 2011, Malin & Kashyap 2014). However, literature regarding metformin as leptin sensitizer is so far scarce.

Leptin is an adipocyte-derived hormone that exerts powerful effects both centrally and peripherally. In the brain, leptin inhibits food intake, promotes energy expenditure and regulates autonomic nerve control, thus playing a key role in body weight regulation (Zhang et al. 1994, Flak & Myers 2016). In peripheral tissues, leptin directly acts on liver, muscle or pancreas to promote fat oxidation (Muoio & Lynis Dohm 2002) or inhibiting insulin secretion (Marroquí et al. 2012). Mutations in the functional leptin (ob/ob) or leptin receptors gene (db/db) in mice and humans display abnormalities ranging from hyperphagia, diabetes, hypercortisolemia, infertility, cold intolerance to fatty liver and skeleton aberrations (Coleman 1982, Montague et al. 1997, Clément et al. 1998, Farooqi et al. 2007). Leptin replacement therapy reverses these abnormalities in leptin-deficient animals and patients. However, instead of lacking this hormone, most obese individuals (humans and animals) have elevated serum levels of leptin but with blunted response to the endogenous or exogenous leptin, a state which is defined as leptin resistance. Central leptin resistance plays a key role in pathogenesis of obesity (Caro et al. 1996, de Luca et al. 2005, Myers et al. 2010), while hepatic leptin resistance is a key determinant of lipid accumulation in liver (Fishman et al. 2007). Therefore, rescuing leptin sensitivity would provide opportunity to reverse obesity-associated diseases.

Leptin acts primarily by binding to a signaling leptin receptor, known as long isoform OB-Rb (Flak & Myers 2016), whereas short receptor isoforms, OB-Ra, -Rc and -Rd, modulate leptin bioavailability and function via two mechanisms: control of leptin transport across the blood–brain barrier (BBB) (Kastin et al. 1999) and proteolytic cleavage production as sOBR, the major leptin-binding protein in circulation (Maamra et al. 2001, Ge et al. 2002). Much evidence indicate sOBR serve as a novel biomarker for leptin sensitivity. Decreased sOBR levels have been negatively correlated with increased obesity, serum leptin level, fasting plasma glucose (FPG), fasting insulin (FINs) and homeostasis model assessment of insulin resistance (HOMA-IR), biomarkers for hyperglycemia, leptin and insulin resistance (Ogawa et al. 2004, Hamnvik et al. 2011). However, increased sOBR levels have been positively correlated with high-density lipoprotein (HDL)-cholesterol and serum adiponectin levels (Ogawa et al. 2004, Hamnvik et al. 2011, Yu et al. 2011). In a recent large prospective study, increased plasma sOBR levels are associated with lowered risk of T2DM (Sun et al. 2010). In support, mice overexpressing sOB-R demonstrated reduced food intake, increased basal metabolic rate and increased lipid oxidation, metabolic phenotypes of higher leptin sensitivity (Lou et al. 2010). In agreement, liver-specific insulin receptor knockout (LIRKO) mice displays markedly increased sOBR levels in circulation and enhanced leptin sensitivity (Cohen et al. 2007). Moreover, obese subjects after weight loss surgery (Laimer et al. 2002, Siejka et al. 2013), diet therapy (Wolfe et al. 2004, Gajewska et al. 2013) or physical training (Balagopal et al. 2010, Gajewska et al. 2013) demonstrated increased sOBR levels, indicating the restoration in leptin sensitivity. Taken together, these studies implicate that manipulating sOBR levels may provide a therapeutic approach for rescue of leptin sensitivity.

Metformin has recently been shown to upregulate hypothalamic expression of OB-Rb in rats (Aubert et al. 2011). Currently, it is unknown whether metformin upregulates peripheral expression of leptin receptors and sOBR levels. Given the fact that liver has a high abundance of leptin receptors (Brabant et al. 2004, Cohen et al. 2005), thus shedding of which produce the majority of plasma sOBR (Maamra et al. 2001, Ge et al. 2002). Therefore, in this study, we tested the effects of metformin on plasma sOB-R levels in T2DM patients and mice, and analyzed the expression of major isoforms of leptin receptor in mice liver and kidney, and assessed its effect on hepatosteatosis.

Materials and methods

Patients ethical statement

Informed written consent was obtained from the patients receiving metformin and accepting the collection of blood samples. This study protocol was approved by the Medical Ethics Committee in Xinqiao Hospital, the Third Military Medical University. Twelve newly diagnosed T2DM from May to November in 2013 were included. All of the patients underwent a thorough physical examination and laboratory evaluation. Those with pregnancy, chronic diseases (cardiovascular, gastrointestinal and respiratory), a history of drug use (antibiotics, steroids, narcotics, antipsychotics, radioactive pharmaceuticals, toxic drugs for medical use and alcoholics), endocrine pathology (Cushing syndrome and hypothyroidism) and recent history of surgery were excluded from the study. These patients were given metformin treatment at 500mg each time for three times a day (a total of 1500mg/day) for a month, and then came back for plasma samples collection.

Animal model

All animal experiments were conducted in accordance with the Third Military Medical University guidelines for the care and use of laboratory animals and were approved by the University Animal Care and Use Committee. To set up an animal model with impaired glucose metabolism, C57BL/6 mice, all male, aged 4–6weeks were randomized into two groups: one set of animals (n=21) received standard chow diet (CD) and the other set (n=21) a high-fat (HF) diet. Each group of mice was housed five per cage supplied with a normal rodent diet ad libitum in a pathogen free facility with a 12h light: 12h darkness cycle. The mice were fed the chow or HF diets for 5months. Body weights were measured every 2weeks. Fasting plasma glucose (FPG) was measured every month after depriving the mice from food overnight. Afterward, C57BL/6 mice were divided into six experimental groups and gavaged with metformin at 50mg/kg or 200mg/kg once a day for a continuous 15days, with the saline gavaged mice as control as follows: (1) normal chow (CD-control, n=7); (2) normal chow+metformin (50mg/kg/day, n=7); (3) normal chow+metformin (200mg/kg/day, n=7); (4) high-fat diet (HF-control, n=5); (5) high-fat diet+metformin (50mg/kg/day, n=6); (6) high-fat diet+metformin (200mg/kg/day, n=7). At the end of treatment, mice were fasted overnight before sacrifice, and body weight, FPG, FINs, HOMA-IR and sOB-R levels were determined.

Biochemical assays

The blood samples from animals and patients were immediately put on ice, and plasma was centrifuged with EDTA-containing tubes at 1200g for 10min at 4°C. The plasma was spun again at 1200g for 10min at 4°C, and the recovered plasma was stored in aliquots at −70°C. The EDTA-plasma was analyzed for glucose, insulin, total leptin (RIA; Linco Research) and sOB-R (ELISA; Diagnostic Systems Laboratories, Webster, TX, USA).

Insulin sensitivity assessment

Glucose and insulin tolerance tests were performed to assess the in vivo insulin sensitivity as we have described previously (Miao et al. 2014). Briefly, the mice were fasted overnight, and then given an i.p. injection of glucose (Sigma) (2g/kg body weight) in intraperitoneal glucose tolerance test (IPGTT) or an i.p. injection of insulin (Nanjing Pharmaceutical Co., China) (0.5U/kg body weight) in insulin tolerance test (ITT). Blood samples were drawn from the tail vein immediately before the challenge, as well as 30, 60 and 120min thereafter. HOMA-IR was used as an index of insulin resistance. HOMA-IR was calculated using the standard formula: fasting glucose (mmol/L)×FINs (μU/L)/22.5.

RNA isolation and real-time quantitative PCR

Total RNA were extracted from each mouse liver using the RNAout reagent (TIANDZ Co., China) according to the manufacturer’s protocol. The reverse transcription was performed using M-MLV reverse transcription kit (Invitrogen), as described previously (Miao et al. 2014). Real-time quantitative polymerase chain reaction (PCR) was performed with an Applied Biosystems PRISM 7500 Sequence Detector (Applied Biosystems), using the IQTMSYBGreen Supermix (Bio-Rad Laboratories). The primers used are listed in Table 1. The PCR procedure was heat at 94°C for 5min followed by 40 cycles of 95°C for 15s, 60°C 30s and 72°C 30s. The level of the designated gene expression was expressed as the ratio of this gene relative to mice β-actin levels using the formula of 2−ΔΔCt.

Table 1

Real-time PCR primers for detection of leptin receptors and their shedding enzymes.

GeneGenBank (Access NO)Primer (5′ to 3)Product (bp)
Mice-OB-RtNM_001032819.1Forward: CAACACTGAAGGGAAGACACT79
Reverse: CACTCTGTCCCAGTTTACA
Mice-OB-RaU49106.1Forward: AATGACGCAGGGCTGTATGT194
Reverse: ATGGACTGTTGGGAAGTTGG
Mice-OB-RbU49107.1Forward: TGCTTTTGACTGGTGAGGCA138
Reverse: CTGTGCGTGGAACAGGTTTG
Mice-OB-RcU49108.1Forward: CAAGCAGCAGAATGACGCAG133
Reverse: GTGACCTTTTGGAAATTCAGTCCT
Mice-OB-RdU49109.1Forward: ACGCAGGGCTGTATGTCATT117
Reverse: TCCTTTTGGAAATTCAGTCCTTG
Mice-Adam10NM_007399.3Forward: TGGAGTAGAGGAAGGAGCCC96
Reverse: CTTTCAGCCAGAGTTGTGCG
Mice-Adam17NM_009615.6Forward: GTGCTGGGAAGATCACCTCC81
Reverse: CACCACCTCTCTGGGAAACC
Mice-β-actinNM_007393.3Forward: CTGTCCCTGTATGCCTCTG218
Reverse: ATGTCACGCACGATTTCC

Western blotting analysis

Liver samples from experimental mice were processed to protein extraction and analyzed by Western blot. Antibodies against sheddase ADAM 10 (A disintegrin and metalloproteinase 10) and ADAM17 were incubated at 4°C overnight, followed by washing 5min for three times with TBST (0.05% Tween 20 in Tris-buffered saline, TBS) and incubation with horseradish peroxidase-conjugated secondary antibody (Zhongshan company Co, Beijing, China) for 2h at room temperature. The membranes were washed again as described above, and the bands were detected by chemiluminescence for visualization. β-actin was used as an internal control.

Liver morphological analysis

Small pieces of liver were fixed in a freshly prepared 4% paraformaldehyde in 0.1M phosphate buffer and processed into paraffin sections for hematoxylin and eosin staining and histopathological observation. The morphological changes of liver tissues were observed by two pathologists who were blinded from the experimental information.

Liver triglycerides assay

Quantitative analysis of liver TG content was performed by saponification of liver in ethanolic KOH. After neutraliza­tion with MgCl2, TG levels were measured by a colorimetric method (Zhejiang Dongou Biotechnical Company, China) according to the manufacturer’s instruction.

ELISA assay for sOB-R

ELISA analysis of plasma sOB-R levels using a mouse or human sOB-R ELISA kit (Huijia biotechnology, China) was carried according to manufacturer’s instructions. This ELISA kit detects sOB-R and other OB-R molecules that contain the ectodomain of OB-R.

Statistical analysis

All results are expressed as the mean±s.e.m. Data were analyzed using a one-factor analysis of variance to compare the means of all groups. Between-two group differences in continuous variables were assessed by a univariate analysis with Student’s t-test. One-way ANOVA was used for the comparison of more than two groups, followed by Turkey-Kramer post hoc test. P-value<0.05 was considered to indicate statistical significance.

Results

Metformin increases plasma soluble leptin receptor levels in humans and mice

To detect the effects of metformin therapy on sOBR levels, the plasma samples from newly diagnosed T2DM patients were tested before and after metformin (1500mg/day) for 1month. As shown in Table 2, FPG, FINs, glycated albumin and leptin levels were significantly decreased, whereas sOB-R levels significantly increased in patients after metformin treatment compared with pretreatment values.

Table 2

Effects of metformin therapy on serum metabolic parameters and biomarkers in newly diagnosed T2DM patients.

VariableBefore drug useAfter drug useP-value
n1212
Demography
 Age (year)56.15±9.4856.15±9.48NS
 Sex (no)
  Female66NS
  Male66NS
BMI (kg/m2)23.96±4.1423.52±3.08NS
 Waist circumference (cm)83.77±11.3183.48±10.59NS
 Hip circumference (cm)97.54±10.7896.79±10.63NS
 Waist-to-hip ratio0.86±0.080.86±0.06NS
Metabolism
 Fasting plasma glucose (mmol/L)7.03±0.906.11±0.73<0.05
 Fasting plasma insulin (μU/mL)13.84±6.0411.16±5.03<0.05
 Cholesterol levels (mmol/L)
  Total4.10±0.953.90±1.31NS
  LDL2.99±0.522.88±0.57NS
  HDL1.32±0.281.30±0.25NS
  Triglycerides (mmol/L)1.58±0.721.50±0.76NS
  Uric acid (μmol/L)334.08±60.34321.96±67.64NS
Biomarker
 HbAlc (%)6.86±1.906.68±1.80NS
 Glycated albumin18.04±5.4715.15±5.77<0.05
 Soluble leptin receptor (ng/mL)15.82±1.7131.08±6.78<0.05
 Leptin (ng/mL)41.47±4.4724.03±1.94<0.05

Plus–minus values are mean±s.e.m. The body mass index (BMI) is the weight in kilograms divided by the square of the height in meters. HbAlc, glycosylated hemoglobin; NS, not significant.

To investigate this drug effect in greater detail, we turned to metabolic-disturbed animal model by feeding mice with HF for 5months. As shown in Fig. 1, HF-induced elevated FPG levels (Fig. 1B), insulin resistance index HOMA-IR (Fig. 1D), impaired glucose tolerance (Fig. 1E) and insulin tolerance (Fig. 1F) were compared with CD-fed mice, whereas, body weight (Fig. 1A) and FINs (Fig. 1C) were not significantly changed. These data demonstrate the presence of HF-induced metabolic disturbance.

Figure 1
Figure 1

High-fat diet-induced metabolic disturbance in mice. Effects of high-fat diet on metabolic changes versus chow diet in male mice: (A) body weights; (B) concentration of fasting plasma glucose (FPG); (C) fasting insulin (FINs); (D) the homeostasis model assessment of insulin resistance (HOMA-IR); (E) intraperitoneal glucose tolerance test (IPGTT) and (F) insulin tolerance test (ITT). The values are mean±s.e.m. *P<0.05 and **P<0.01 between diet group (Chow vs HF).

Citation: Journal of Endocrinology 230, 2; 10.1530/JOE-16-0142

Metformin was then administrated at a low (50mg/kg/day) or high dose (200mg/kg/day) for a consecutive 15days. Results showed that treatment with this drug significantly decreased FPG (Fig. 2A), HOMA-IR (Fig. 2B) and improved glucose tolerance (Fig. 2E) in HF mice, while showed no significant effects in CD mice (Fig. 2A, B and D). Interestingly, serum sOBR levels signi­ficantly increased in both CD and HF mice with metformin treatment, and in a dose-dependent manner (Fig. 2C).

Figure 2
Figure 2

Metformin improved glucose metabolism in mice fed a high-fat diet. Effects of metformin for 15days at designated concentration on male mice: (A) FPG; (B) HOMA-IR; (C) sOB-R levels and its effect on glucose disposal ability at 200mg/kg/day; (D) IPGTT in CD mice and (E) IPGTT in HF mice. *P<0.05 and **P<0.01.

Citation: Journal of Endocrinology 230, 2; 10.1530/JOE-16-0142

Metformin upregulates leptin receptor expression in liver, but not in kidney

Given the evidence from in vivo radioactive ligand-binding assay that more than 80% of leptin was bound in liver, and 17% of which in kidney (Brabant et al. 2004), we thus detected the expression of leptin receptors in the two organs. Results showed that total leptin receptor (OB-Rt), measurement for the shared ectodomain region of this receptor, was significantly upregulated by metformin in liver, but not in kidney (Fig. 3A). As there are four membrane-anchored leptin receptor isoforms (OB-Ra, -Rb, -Rc and -Rd) in human, we subsequently measured the four homologous isoforms in mice. Results showed that metformin dose-dependently increases hepatic, but not renal, OB-Ra (Fig. 3C), -Rc (Fig. 3D) and -Rd (Fig. 3E) in both CD- and HF-mice. Worth to note is that only higher dose of this drug can increase OB-Rb expression (Fig. 3B), again in liver but not in kidney, in HF mice only.

Figure 3
Figure 3

Metformin significantly upregulates the expression of leptin receptors in liver, but not in kidney. The mRNA levels of both long and short leptin receptor isoforms were determined, in the absence or presence of metformin treatment, by real-time PCR using β-actin as an internal control in liver and kidney from CD or HF mice: (A) total leptin receptor (OB-Rt); (B) OB-Rb; (C) OB-Ra; (D) OB-Rc; (E) OB-Rd. The values are mean±s.e.m. *P<0.05 and **P<0.01.

Citation: Journal of Endocrinology 230, 2; 10.1530/JOE-16-0142

Metformin does not affect the expression of ADAM10 and ADAM17

Two metalloproteases, ADAM 10 (A disintegrin and metalloproteinase 10) and ADAM17, are reported to participate in enzymatic cleavage of this receptor (Schaab et al. 2012). We detected the effect of metformin on ADAM 10 and ADAM17 expression in liver and kidney. Results showed no significant changes in the mRNA (Fig. 4A and B) or protein levels (Fig. 4C) of both enzymes in liver or kidney (data not shown) before or after metformin treatment.

Figure 4
Figure 4

Metformin on expression of sheddases, a disintegrin and metalloproteinase (ADAM)-10 and ADAM-17 in mice liver. The mRNA levels of gene expression were determined by real-time PCR using β-actin as an internal control: (A) ADAM10; (B) ADAM17 and the protein levels by western blotting in mice liver from control or HF mice; (C) ADAM10 and (D) ADAM17.

Citation: Journal of Endocrinology 230, 2; 10.1530/JOE-16-0142

Effect of metformin on liver triglyceride contents and lipogenic gene expressions

We have previously shown in HepG2 cells that ectopic expression of OB-Rb markedly increased leptin signaling activity (Gan et al. 2012), function of which determines hepatic TG accumulation (Fishman et al. 2007). Therefore, we tested TG and cholesterol contents and observed the morphological changes before and after metformin treatment. Histological staining showed that HF induced extensive lipid droplets in hepatocytes (Fig. 5A2), compared with the chow diet mice (Fig. 5A1), and metformin treatment reduced hepatic steatosis (Fig. 5A4 and A6). In consistence, hepatic TG (Fig. 5B) are increased by HF, levels of which are significantly decreased after metformin treatment and with a greater reduction at higher drug dose. Real-time PCR showed that metformin significantly decreases the expression of SREBP-1c (Fig. 5C) and its target lipogenic genes FAS (Fig. 5D) and ACC-1 (Fig. 5E), whereas carnitine palmitoyltransferase-1 (CPT-1) did not show significant change (data not shown).

Figure 5
Figure 5

Effect of metformin on liver steatosis, triglyceride contents and lipogenic gene expression (A) Morphology observation of mice liver with HE staining; (B) contents of triglyceride (TG); (C) the mRNA levels of sterol regulatory element binding protein 1c (SREBP-1c); (D) fatty acid synthase (FAS) and (E) acetyl-CoA carboxylase-1 (ACC-1) in mice liver.

Citation: Journal of Endocrinology 230, 2; 10.1530/JOE-16-0142

Discussion

We hereby demonstrated that metformin upregulates plasma sOB-R levels in mice and T2DM patients. This is likely due to metformin-stimulated hepatic expression of leptin receptor, especially the short isoforms (OB-Ra, -Rc and -Rd). The stimulation effect is dose-dependent regardless of diet types (CD or HF) in mice. Long isoform OB-Rb can also be upregulated by metformin yet at a higher dose. Our findings that metformin treatment increases hepatic leptin receptors and sOB-R levels are new and underscore metformin as leptin sensitizer in liver.

There is numerous evidence showing the beneficial effects of metformin on improving NAFLD phenotypes. The main molecular mediator of these effects is regarded as adenosine monophosphate-activated protein kinase (AMPK) (Browning & Horton 2004, Woo et al. 2014, Zheng et al. 2015). By activation of AMPK, metformin improved hepatic lipid metabolism via decreasing activities of ACC-1 and hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase, promoting β-oxidation, and inhibiting SREBP 1-c, a master transcription factor that induces the expression of lipogenic genes including FAS (Li et al. 2011), leading to decreased steatosis levels. In this study, we have shown that metformin upregulates hepatic OB-Rb, suggesting metformin may directly enhance hepatic leptin sensitivity, an action that may contribute to its antisteatotic effects, especially in the context of obesity.

Indeed, leptin is shown to play a major role in deposition of TG in liver. In the absence of functional leptin (ob/ob) or its receptor (db/db), mice displayed substantial hepatic steatosis, and leptin replacement or re-expression of leptin receptor in the livers of leptin receptor-deficient Zucker diabetic fatty (ZDF) rats reversed this pathology (Lee et al. 2001). Administration of leptin markedly decreases hepatic TG content (by 63%, P<0.05) in normal rats, whereas this effect was abolished in ZDF rats (Fishman et al. 2007). Importantly, mice with ablated hepatic leptin signaling had increased lipid accumulation in the liver (Huynh et al. 2010). Therefore, our result showed that upregulation of hepatic OB-Rb expression under higher metformin dose (200mg/kg/day) (Fig. 3B)is associated with a further reduction in TG content (Fig. 5B) compared with lower dose of metformin (50mg/kg/day) and suggests that enhanced leptin sensitivity may contribute to the this antisteatotic effect. In support, expression of lipogenic genes FAS and ACC-1 shows a further decrease under this condition (Fig. 5D and E). Although we did not definitely assess signaling pathways downstream of OB-Rb in mediating the lipid-lowering effects in liver, reports indicate that AMPK and signal transducer and activator of transcription 3 (STAT3) are two pathways likely to be involved. In a recent report, adenovirus-mediated liver-specific OB-Rb overexpression has been shown to activate AMPK pathway to reduce lipid synthesis and promote lipid oxidation and eventually resulted in apparent amelioration of hepatosteatosis in mice under HF conditions (Yoshino et al. 2014). Meanwhile, a number of studies showed that deficiency in STAT3, a major signaling pathway downstream of OB-Rb, or its upstream gp130 in hepatocytes exacerbates fatty liver induced by a choline-deficient, ethionine-supplemented diet (Kroy et al. 2010), alcohol-containing diet (Horiguchi et al. 2008) or high-fat diet (Inoue et al. 2004), whereas overexpression of constitutively activated STAT3 ameliorates high-fat diet-induced fatty liver via inhibition of SREBP-1c (Inoue et al. 2004, Kinoshita et al. 2008). Future studies are thus required to clarify the physiological functions of AMPK and STAT3 pathways downstream of leptin/OB-Rb in mediating the antisteatotic effects of metformin in liver.

In this study, we have shown that metformin significantly increases sOBR levels, an effect likely resulted from the increased expression and substrate availability of hepatic leptin receptors (OB-Ra, -Rb, -Rc and -Rd). This is in full agreement with the notion that liver is the main source of plasma sOBR (Cohen et al. 2005). Currently, the biological impact of increased sOB-R levels is still under dispute, due to a comparable binding affinity of leptin to sOBR and its membrane receptor (Lammert et al. 2001). As a consequent, sOB-R may modulate leptin function in bidirectional ways: (1) either as an antagonist by its direct competition for the ligand with its specific membrane receptors (Zastrow et al. 2003; Zhang & Scarpace 2009) and inhibits leptin transport into the brain (Tu et al. 2008) (2) or as an agonist, via binding leptin, decreases its clearance in circulation and increases its half-life and function (Gavrilova et al. 1997). Accumulating data favor the view that elevated levels of sOBR is a beneficial biomarker for enhanced leptin sensitivity, which is generally associated with energy surplus condition as in obesity. Worth to mention is that increased plasma sOBR levels are also frequently associated with energy-deficient conditions, as is the case for fasting (Chan et al. 2002), food deprivation (Cohen et al. 2005), type 1 diabetes (Kratzsch et al. 2004, Kratzsch et al. 2006), eating disorders such as anorexia nervosa and bulimia nervosa (Monteleone et al. 2002) or catabolic states as in nephritic syndrome (Schroth et al. 2003) and severe malnutrition (Stein et al. 2006). In such conditions, the increased sOBR levels are generally regarded as a compensatory mechanism by which leptin action is antagonized; hence, food intake is promoted and energy consumptions decreased, so as to replenish the body’s energy shortage. Here, our data suggest that increased sOBR levels by metformin did not show an enhanced central leptin sensitivity, as our data exhibit no significant reduction in body weight in both mice (data not shown) and T2DM patients (Table 2). This is in discrepancy with previous report where sOBR transgenic mice demonstrated enhanced leptin sensitivity as shown by lower body weight, increased energy expenditure and lower body fat content compared with wild-type mice (Lou et al. 2010). One explanation for this discrepancy may be because the patients who receive metformin treatment and come back for blood testing are not obese (BMI 21.41±1.386) (Table 2), although their body weight, waist circumference and waist-to-hip ratio show a tendency of decrease (Table 2), yet not reach a statistical significance. The second explanation may be because the therapeutic time using metformin (1month in patients and 15days in mice) may not be long enough to show a distinguishable weight-loss effect. Further studies are required to determine the dose and time effects of metformin on leptin sensitivity in central and peripheral tissues, and should include patients with different degree of obesity.

Worth to mention, it is possible that when combined with additional endocrine abnormalities, the effect of metformin on leptin receptor expression and plasma sOBR levels may be absent or over-ridden. As has been reported previously, 4months therapy with metformin (1500mg daily) in seven obese women with hyperinsulinemia and PCOS did not affect the sOBR levels (Romualdi et al. 2008). It is possible that in the presence of high circulating levels of other hormones, metformin-stimulated signaling pathways are blunted and other regulatory mechanisms become more prominent. Hence, the mechanisms underlying metformin-stimulated leptin receptor gene expression warrant further investigation.

In conclusion, the findings that metformin increases sOBR levels and hepatic leptin receptors including OB-Rb implicate enhanced hepatic leptin sensitivity as an underlying mechanism, mediating its antisteatotic effect. Our study expands current understanding of metformin as leptin sensitizer not only in the brain (Aubert et al. 2011) but also in liver, results of which may provide novel rationale in future clinical uses of metformin in leptin resistance-associated disorders.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the National Natural Science Foundation of China (grant numbers 30971082, 81270482).

Author contribution statement

Xuemei Tang, Jingwen Li, Wei Xiang and Ye Cui conducted the experiments, analyzed the data and drew graphs. Bin Xie, Xiaodong Wang and Zihui Xu contributed to discussion and revised the paper. Lixia Gan designed experiments, wrote the manuscript and takes full responsibility for the present work.

References

  • AubertGMansuyVVoirolMJPellerinLPralongFP2011The anorexigenic effects of metformin involve increases in hypothalamic leptin receptor expression. Metabolism60327334. (doi:10.1016/j.metabol.2010.02.007)

    • Search Google Scholar
    • Export Citation
  • BalagopalPBGiddingSSBucklohLMYarandiHNSylvesterJEGeorgeDEFunanageVL2010Changes in circulating satiety hormones in obese children: a randomized controlled physical activity-based intervention study. Obesity1817471753. (doi:10.1038/oby.2009.498)

    • Search Google Scholar
    • Export Citation
  • BrabantGNaveHHornRAnderwaldCMüllerGRodenM2004In vivo and in vitro evidence for a hepatic modulation of the leptin signal in rats. European Journal of Clinical Investigation34831837. (doi:10.1111/j.1365-2362.2004.01427.x)

    • Search Google Scholar
    • Export Citation
  • BrowningJDHortonJD2004Molecular mediators of hepatic steatosis and liver injury. Journal of Clinical Investigation114147152. (doi:10.1172/JCI200422422)

    • Search Google Scholar
    • Export Citation
  • CaroJFKolaczynskiJWNyceMROhannesianJPOpentanovaIGoldmanWHLynnRBZhangPLSinhaMKConsidineRV1996Decreased cerebrospinal-fluid/serum leptin ratio in obesity: a possible mechanism for leptin resistance. Lancet348159161. (doi:10.1016/S0140-6736(96)03173-X)

    • Search Google Scholar
    • Export Citation
  • ChanJLBlüherSYiannakourisNSuchardMAKratzschJMantzorosCS2002Regulation of circulating soluble leptin receptor levels by gender, adiposity, sex steroids, and leptin: observational and interventional studies in humans. Diabetes5121052012. (doi:10.2337/diabetes.51.7.2105)

    • Search Google Scholar
    • Export Citation
  • ClémentKVaisseCLahlouNCabrolSPellouxVCassutoDGourmelenMDinaCChambazJLacorteJM1998A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature392398401. (doi:10.1038/32911)

    • Search Google Scholar
    • Export Citation
  • CohenPYangGYuXSoukasAAWolfishCSFriedmanJMLiC2005Induction of leptin receptor expression in the liver by leptin and food deprivation. Journal of Biological Chemistry2801003410039. (doi:10.1074/jbc.M413684200)

    • Search Google Scholar
    • Export Citation
  • CohenSEKokkotouEBiddingerSBKondoTGebhardtRKratzschJMantzorosCSKahnCR2007High circulating leptin receptors with normal leptin sensitivity in liver-specific insulin receptor knock-out (LIRKO) mice. Journal of Biological Chemistry2822367223678. (doi:10.1074/jbc.M704053200)

    • Search Google Scholar
    • Export Citation
  • ColemanDL1982Diabetes-obesity syndromes in mice. Diabetes3116. (doi:10.2337/diab.31.1.S1)

  • de LucaCKowalskiTJZhangYElmquistJKLeeCKilimannMWLudwigTLiuSMChuaSCJr2005Complete rescue of obesity, diabetes, and infertility in db/db mice by neuron- specific LEPR-B transgenes. Journal of Clinical Investigation11534843493. (doi:10.1172/JCI24059)

    • Search Google Scholar
    • Export Citation
  • FarooqiISWangensteenTCollinsSKimberWMatareseGKeoghJMLankEBottomleyBLopez-FernandezJFerraz-AmaroI2007Clinical and molecular genetic spectrum of congenital deficiency of the leptin receptor. New England Journal of Medicine356237247. (doi:10.1056/NEJMoa063988)

    • Search Google Scholar
    • Export Citation
  • FishmanSMuzumdarRHAtzmonGMaXYangXEinsteinFH2007Resistance to leptin action is the major determinant of hepatic triglyceride accumulation in vivo. FASEB Journal215360. (doi:10.1096/fj.06-6557com)

    • Search Google Scholar
    • Export Citation
  • FlakJNMyersMGJr2016Minireview: CNS mechanisms of leptin action. Molecular Endocrinology30312. (doi:10.1210/me.2015-1232)

  • ForetzMGuigasBBertrandLPollakMViolletB2014Metformin: from mechanisms of action to therapies. Cell Metabolism20953966. (doi:10.1016/j.cmet.2014.09.018)

    • Search Google Scholar
    • Export Citation
  • GajewskaJWekerHAmbroszkiewiczJSzamotulskaKChełchowskaMFranekELaskowska-KlitaT2013Alterations in markers of bone metabolism and adipokines following a 3-month lifestyle intervention induced weight loss in obese prepubertal children. Experimental and Clinical Endocrinology & Diabetes121498504. (doi:10.1055/s-00000017)

    • Search Google Scholar
    • Export Citation
  • GanLGuoKCremonaMLMcGrawTELeibelRLZhangY2012TNF-α up-regulates protein level and cell surface expression of the leptin receptor by stimulating its export via a PKC-dependent mechanism. Endocrinology15358215833. (doi:10.1210/en.2012-1510)

    • Search Google Scholar
    • Export Citation
  • GavrilovaOBarrVMarcus-SamuelsBReitmanM1997Hyperleptinemia of pregnancy associated with the appearance of a circulating form of the leptin receptor. Journal of Biological Chemistry2723054630551. (doi:10.1074/jbc.272.48.30546)

    • Search Google Scholar
    • Export Citation
  • GeHHuangLPourbahramiTLiC2002Generation of soluble leptin receptor by ectodomain shedding of membrane-spanning receptors in vitro and in vivo. Journal of Biological Chemistry2774589845903. (doi:10.1074/jbc.M205825200)

    • Search Google Scholar
    • Export Citation
  • GreenBDIrwinNDuffyNAGaultVAO’harteFPFlattPR2006Inhibition of dipeptidyl peptidase-IV activity by metformin enhances the antidiabetic effects of glucagon-like peptide-1. European Journal of Pharmacology547192199. (doi:10.1016/j.ejphar.2006.07.043)

    • Search Google Scholar
    • Export Citation
  • HamnvikOPLiuXPetrouMGongHChamberlandJPKimEHChristophiCAKalesSNChristianiDCMantzorosCS2011Soluble leptin receptor and leptin are associated with baseline adiposity and metabolic risk factors, and predict adiposity, metabolic syndrome, and glucose levels at 2-year follow-up: the Cyprus Metabolism Prospective Cohort Study.Metabolism60987993. (doi:10.1016/j.metabol.2010.09.009)

    • Search Google Scholar
    • Export Citation
  • HoriguchiNWangLMukhopadhyayPParkOJeongWILafdilFOsei-HyiamanDMohAFuXYPacherP2008Cell type-dependent pro- and anti-inflammatory role of signal transducer and activator of transcription 3 in alcoholic liver injury. Gastroenterology13411481158. (doi:10.1053/j.gastro.2008.01.016)

    • Search Google Scholar
    • Export Citation
  • HuynhFKLeviJDenrocheHCGraySLVosholPJNeumannUHSpeckMChuaSCCoveySDKiefferTJ2010Disruption of hepatic leptin signaling protects mice from age- and diet-related glucose intolerance. Diabetes5930323040. (doi:10.2337/db10-0074)

    • Search Google Scholar
    • Export Citation
  • IkedaTIwataKMurakamiH2000Inhibitory effect of metformin on intestinal glucose absorption in the perfused rat intestine. Biochemical Pharmacology59887890. (doi:10.1016/S0006-2952(99)00396-2)

    • Search Google Scholar
    • Export Citation
  • InoueHOgawaWOzakiMHagaSMatsumotoMFurukawaKHashimotoNKidoYMoriTSakaueH2004Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate metabolism in vivo. Nature Medicine10168174. (doi:10.1038/nm980)

    • Search Google Scholar
    • Export Citation
  • KastinAJPanWManessLMKoletskyRJErnsbergerP1999Decreased transport of leptin across the blood-brain barrier in rats lacking the short form of the leptin receptor. Peptides2014491453. (doi:10.1016/S0196-9781(99)00156-4)

    • Search Google Scholar
    • Export Citation
  • KinoshitaSOgawaWOkamotoYTakashimaMInoueHMatsukiYWatanabeEHiramatsuRKasugaM2008Role of hepatic STAT3 in the regulation of lipid metabolism. Kobe Journal of Medical Sciences54E200E208.

    • Search Google Scholar
    • Export Citation
  • KratzschJDeimelAGallerAKapellenTKlinghammerAKiessW2004Increased serum soluble leptin receptor levels in children and adolescents with type 1 diabetes mellitus. European Journal of Endocrinology151475481. (doi:10.1530/eje.0.1510475)

    • Search Google Scholar
    • Export Citation
  • KratzschJKnerrIGallerAKapellenTRaileKKörnerAThieryJDötschJKiessW2006Metabolic decompensation in children with type 1 diabetes mellitus associated with increased serum levels of the soluble leptin receptor. European Journal of Endocrinology155609614. (doi:10.1530/eje.1.02261)

    • Search Google Scholar
    • Export Citation
  • KroyDCBerazaNTschaharganehDFSanderLEErschfeldSGiebelerALiedtkeCWasmuthHETrautweinCStreetzKL2010Lack of interleukin-6/glycoprotein 130/signal transducers and activators of transcription-3 signaling in hepatocytes predisposes to liver steatosis and injury in mice. Hepatology51463473. (doi:10.1002/hep.23322)

    • Search Google Scholar
    • Export Citation
  • LaimerMEbenbichlerCFKaserSSandhoferAWeissHNehodaHAignerFPatschJR2002Weight loss increases soluble leptin receptor levels and the soluble receptor bound fraction of leptin. Obesity Research10597601. (doi:10.1038/oby.2002.81)

    • Search Google Scholar
    • Export Citation
  • LammertAKiessWBottnerAGlasowAKratzschJ2001Soluble leptin receptor represents the main leptin binding activity in human blood. Biochemical and Biophysical Research Communications283982988. (doi:10.1006/bbrc.2001.4885)

    • Search Google Scholar
    • Export Citation
  • LeeYWangMYKakumaTWangZWBabcockEMcCorkleKHigaMZhouYTUngerRH2001Liporegulation in diet-induced obesity. The antisteatotic role of hyperleptinemia. Journal of Biological Chemistry27656295635. (doi:10.1074/jbc.M008553200)

    • Search Google Scholar
    • Export Citation
  • LeoneADi GennaroEBruzzeseFAvalloneABudillonA2014New perspective for an old antidiabetic drug: metformin as anticancer agent. Cancer Treatment and Research159355376. (doi:10.1007/978-3-642-38007-5)

    • Search Google Scholar
    • Export Citation
  • LiYXuSMihaylovaMMZhengBHouXJiangBParkOLuoZLefaiEShyyJY2011AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metabolism13376388. (doi:10.1016/j.cmet.2011.03.009)

    • Search Google Scholar
    • Export Citation
  • LouPHYangGHuangLCuiYPourbahramiTRaddaGKLiCHanW2010Reduced body weight and increased energy expenditure in transgenic mice over-expressing soluble leptin receptor. PLoS ONE5e11669. (doi:10.1371/journal.pone.0011669)

    • Search Google Scholar
    • Export Citation
  • MaamraMBidlingmaierMPostel-VinayMCWuZStrasburgerCJRossRJ2001Generation of human soluble leptin receptor by proteolytic cleavage of membrane-anchored receptors. Endocrinology14243894393. (doi:10.1210/endo.142.10.8442)

    • Search Google Scholar
    • Export Citation
  • MadirajuAKErionDMRahimiYZhangXMBraddockDTAlbrightRAPrigaroBJWoodJLBhanotSMacDonaldMJ2014Metformin suppresses gluconeogenesis by inhibiting mitochondrial glycerophosphate dehydrogenase. Nature510542546. (doi:10.1038/nature13270)

    • Search Google Scholar
    • Export Citation
  • MaidaALamontBJCaoXDruckerDJ2011Metformin regulates the incretin receptor axis via a pathway dependent on peroxisome proliferator-activated receptor-α in mice. Diabetologia54339349. (doi:10.1007/s00125-010-1937-z)

    • Search Google Scholar
    • Export Citation
  • MalinSKKashyapSR2014Effects of metformin on weight loss: potential mechanisms. Current Opinion in Endocrinology Diabetes Obesity2123329. (doi:10.1097/med.0000000000000095)

    • Search Google Scholar
    • Export Citation
  • MarroquíLGonzalezAÑecoPCaballero-GarridoEVieiraERipollCNadalAQuesadaI2012Role of leptin in the pancreatic β-cell: effects and signaling pathways. Journal of Molecular Endocrinology49R9R17. (doi:10.1530/jme-12-0025)

    • Search Google Scholar
    • Export Citation
  • MiaoHOuJMaYGuoFYangZWigginsMLiuCSongWHanXWangM2014Macrophage CGI-58 deficiency activates ROS-inflammasome pathway to promote insulin resistance in mice. Cell Reports7223235. (doi:10.1016/j.celrep.2014.02.047)

    • Search Google Scholar
    • Export Citation
  • MillerRAChuQXieJForetzMViolletBBirnbaumMJ2013Biguanides suppress hepatic glucagon signalling by decreasing production of cyclic AMP. Nature494256260. (doi:10.1038/nature11808)

    • Search Google Scholar
    • Export Citation
  • MissoMLTeedeHJ2015Metformin in women with PCOS, cons. Endocrine48428433. (doi:10.1007/s12020-014-0394-8)

  • MontagueCTFarooqiISWhiteheadJPSoosMARauHWarehamNJSewterCPDigbyJEMohammedSNHurstJA1997Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature387903908. (doi:10.1038/43185)

    • Search Google Scholar
    • Export Citation
  • MonteleonePFabrazzoMTortorellaAFuschinoAMajM2002Opposite modifications in circulating leptin and soluble leptin receptor across the eating disorder spectrum. Molecular Psychiatry7641646. (doi:10.1038/sj.mp.4001043)

    • Search Google Scholar
    • Export Citation
  • MoralesDRMorrisAD2015Metformin in cancer treatment and prevention. Annual Review of Medicine661729. (doi:10.1146/annurev-med-062613-093128)

    • Search Google Scholar
    • Export Citation
  • MuoioDMLynis DohmG2002Peripheral metabolic actions of leptin. Best Practice & Research Clinical Endocrinology & Metabolism16653666. (doi:10.1053/beem.2002.0223)

    • Search Google Scholar
    • Export Citation
  • MyersMGJrLeibelRLSeeleyRJSchwartzMW2010Obesity and leptin resistance: distinguishing cause from effect. Trends in Endocrinology and Metabolism21643651. (doi:10.1016/j.tem.2010.08.002)

    • Search Google Scholar
    • Export Citation
  • OgawaTHiroseHYamamotoYNishikaiKMiyashitaKNakamuraHSaitoISarutaT2004Relationships between serum soluble leptin receptor level and serum leptin and adiponectin levels, insulin resistance index, lipid profile, and leptin receptor gene polymorphisms in the Japanese population. Metabolism53879885. (doi:10.1016/j.metabol.2004.02.009)

    • Search Google Scholar
    • Export Citation
  • RomualdiDCampagnaGSelvaggiLJrCentoRProtoCLanzoneAGuidoM2008Metformin treatment does not affect total leptin levels and free leptin index in obese patients with polycystic ovary syndrome. Fertility and Sterility8912731276. (doi:10.1016/j.fertnstert.2007.05.004)

    • Search Google Scholar
    • Export Citation
  • SchaabMKauschHKlammtJNowickiMAndereggUGebhardtRRose-JohnSSchellerJThieryJKratzschJ2012Novel regulatory mechanisms for generation of the soluble leptin receptor: implications for leptin action. PLoS ONE7 e34787. (doi:10.1371/journal.pone.0034787)

    • Search Google Scholar
    • Export Citation
  • SchrothMKratzschJGröschlMRauhMRascherWDötschJ2003Increased soluble leptin receptor in children with nephrotic syndrome. Journal Clinical Endocrinology and Metabolism8854975501. (doi:10.1210/jc.2003-030539)

    • Search Google Scholar
    • Export Citation
  • ShinNRLeeJCLeeHYKimMSWhonTWLeeMSBaeJW2014An increase in the Akkermansia spp. population induced by metformin treatment improves glucose homeostasis in diet-induced obese mice. Gut63727735. (doi:10.1136/gutjnl-2012-303839)

    • Search Google Scholar
    • Export Citation
  • SiejkaAJankiewicz-WikaJKołomeckiKCywińskiJPiestrzeniewiczKSwiętosławskiJStępieńHKomorowskiJ2013Long-term impact of vertical banded gastroplasty (VBG) on plasma concentration of leptin, soluble leptin receptor, ghrelin, omentin-1, obestatin, and retinol binding protein 4 (RBP4) in patients with severe obesity. Cytokine64490493. (doi:10.1016/j.cyto.2013.07.026)

    • Search Google Scholar
    • Export Citation
  • SteinKVasquez-GaribayEKratzschJRomero-VelardeEJahreisG2006Influence of nutritional recovery on the leptin axis in severely malnourished children. Journal Clinical Endocrinology and Metabolism9110211026. (doi:10.1210/jc.2005-1394)

    • Search Google Scholar
    • Export Citation
  • SunQvan DamRMMeigsJBFrancoOHMantzorosCSHuFB2010Leptin and soluble leptin receptor levels in plasma and risk of type 2 diabetes in U.S. women: a prospective study. Diabetes59611618. (doi:10.2337/db09-1343)

    • Search Google Scholar
    • Export Citation
  • TuHKastinAJHsuchouHPanW2008Soluble receptor inhibits leptin transport. Journal of Cellular Physiology214301305. (doi:10.1002/jcp.21195)

    • Search Google Scholar
    • Export Citation
  • WolfeBEJimersonDCOrlovaCMantzorosCS2004Effect of dieting on plasma leptin, soluble leptin receptor, adiponectin and resistin levels in healthy volunteers. Clinical Endocrinology61332338. (doi:10.1111/j.1365-2265.2004.02101.x)

    • Search Google Scholar
    • Export Citation
  • WooSLXuHLiHZhaoYHuXZhaoJGuoXGuoTBotchlettRQiT2014Metformin ameliorates hepatic steatosis and inflammation without altering adipose phenotype in diet-induced obesity. PLoS ONE9e91111. (doi:10.1371/journal.pone.0091111)

    • Search Google Scholar
    • Export Citation
  • YoshinoSSatohTYamadaMHashimotoKTomaruTKatano-TokiAKakizakiSOkadaSShimizuHOzawaA2014Protection against high-fat diet-induced obesity in Helz2-deficient male mice due to enhanced expression of hepatic leptin receptor. Endocrinology15534593472. (doi:10.1210/en.2013-2160)

    • Search Google Scholar
    • Export Citation
  • YuDYuZSunQSunLLiHSongJMiMWuHLuLLiuC2011Effects of body fat on the associations of high-molecular-weight adiponectin, leptin and soluble leptin receptor with metabolic syndrome in Chinese. PLoS ONE6e16818. (doi:10.1371/journal.pone.0016818)

    • Search Google Scholar
    • Export Citation
  • ZastrowOSeidelBKiessWThieryJKellerEBöttnerAKratzschJ2003The soluble leptin receptor is crucial for leptin action: evidence from clinical and experimental data. International Journal of Obesity and Related Metabolic Disorders2714721478. (doi:10.1038/sj.ijo.0802432)

    • Search Google Scholar
    • Export Citation
  • ZhangJScarpacePJ2009The soluble leptin receptor neutralizes leptin-mediated STAT3 signalling and anorexic responses in vivo. British Journal of Pharmacology158475482. (doi:10.1111/j.1476-5381.2009.00246.x)

    • Search Google Scholar
    • Export Citation
  • ZhangYProencaRMaffeiMBaroneMLeopoldLFriedmanJM1994Positional cloning of the mouse obese gene and its human homologue. Nature372425432. (doi:10.1038/372425a0)

    • Search Google Scholar
    • Export Citation
  • ZhengJWooSLHuXBotchlettRChenLHuoYWuC2015Metformin and metabolic diseases: a focus on hepatic aspects. Frontiers of Medicine9173186. (doi:10.1007/s11684-015-0384-0)

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 1741 418 34
PDF Downloads 519 277 32
  • View in gallery

    High-fat diet-induced metabolic disturbance in mice. Effects of high-fat diet on metabolic changes versus chow diet in male mice: (A) body weights; (B) concentration of fasting plasma glucose (FPG); (C) fasting insulin (FINs); (D) the homeostasis model assessment of insulin resistance (HOMA-IR); (E) intraperitoneal glucose tolerance test (IPGTT) and (F) insulin tolerance test (ITT). The values are mean±s.e.m. *P<0.05 and **P<0.01 between diet group (Chow vs HF).

  • View in gallery

    Metformin improved glucose metabolism in mice fed a high-fat diet. Effects of metformin for 15days at designated concentration on male mice: (A) FPG; (B) HOMA-IR; (C) sOB-R levels and its effect on glucose disposal ability at 200mg/kg/day; (D) IPGTT in CD mice and (E) IPGTT in HF mice. *P<0.05 and **P<0.01.

  • View in gallery

    Metformin significantly upregulates the expression of leptin receptors in liver, but not in kidney. The mRNA levels of both long and short leptin receptor isoforms were determined, in the absence or presence of metformin treatment, by real-time PCR using β-actin as an internal control in liver and kidney from CD or HF mice: (A) total leptin receptor (OB-Rt); (B) OB-Rb; (C) OB-Ra; (D) OB-Rc; (E) OB-Rd. The values are mean±s.e.m. *P<0.05 and **P<0.01.

  • View in gallery

    Metformin on expression of sheddases, a disintegrin and metalloproteinase (ADAM)-10 and ADAM-17 in mice liver. The mRNA levels of gene expression were determined by real-time PCR using β-actin as an internal control: (A) ADAM10; (B) ADAM17 and the protein levels by western blotting in mice liver from control or HF mice; (C) ADAM10 and (D) ADAM17.

  • View in gallery

    Effect of metformin on liver steatosis, triglyceride contents and lipogenic gene expression (A) Morphology observation of mice liver with HE staining; (B) contents of triglyceride (TG); (C) the mRNA levels of sterol regulatory element binding protein 1c (SREBP-1c); (D) fatty acid synthase (FAS) and (E) acetyl-CoA carboxylase-1 (ACC-1) in mice liver.

  • AubertGMansuyVVoirolMJPellerinLPralongFP2011The anorexigenic effects of metformin involve increases in hypothalamic leptin receptor expression. Metabolism60327334. (doi:10.1016/j.metabol.2010.02.007)

    • Search Google Scholar
    • Export Citation
  • BalagopalPBGiddingSSBucklohLMYarandiHNSylvesterJEGeorgeDEFunanageVL2010Changes in circulating satiety hormones in obese children: a randomized controlled physical activity-based intervention study. Obesity1817471753. (doi:10.1038/oby.2009.498)

    • Search Google Scholar
    • Export Citation
  • BrabantGNaveHHornRAnderwaldCMüllerGRodenM2004In vivo and in vitro evidence for a hepatic modulation of the leptin signal in rats. European Journal of Clinical Investigation34831837. (doi:10.1111/j.1365-2362.2004.01427.x)

    • Search Google Scholar
    • Export Citation
  • BrowningJDHortonJD2004Molecular mediators of hepatic steatosis and liver injury. Journal of Clinical Investigation114147152. (doi:10.1172/JCI200422422)

    • Search Google Scholar
    • Export Citation
  • CaroJFKolaczynskiJWNyceMROhannesianJPOpentanovaIGoldmanWHLynnRBZhangPLSinhaMKConsidineRV1996Decreased cerebrospinal-fluid/serum leptin ratio in obesity: a possible mechanism for leptin resistance. Lancet348159161. (doi:10.1016/S0140-6736(96)03173-X)

    • Search Google Scholar
    • Export Citation
  • ChanJLBlüherSYiannakourisNSuchardMAKratzschJMantzorosCS2002Regulation of circulating soluble leptin receptor levels by gender, adiposity, sex steroids, and leptin: observational and interventional studies in humans. Diabetes5121052012. (doi:10.2337/diabetes.51.7.2105)

    • Search Google Scholar
    • Export Citation
  • ClémentKVaisseCLahlouNCabrolSPellouxVCassutoDGourmelenMDinaCChambazJLacorteJM1998A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature392398401. (doi:10.1038/32911)

    • Search Google Scholar
    • Export Citation
  • CohenPYangGYuXSoukasAAWolfishCSFriedmanJMLiC2005Induction of leptin receptor expression in the liver by leptin and food deprivation. Journal of Biological Chemistry2801003410039. (doi:10.1074/jbc.M413684200)

    • Search Google Scholar
    • Export Citation
  • CohenSEKokkotouEBiddingerSBKondoTGebhardtRKratzschJMantzorosCSKahnCR2007High circulating leptin receptors with normal leptin sensitivity in liver-specific insulin receptor knock-out (LIRKO) mice. Journal of Biological Chemistry2822367223678. (doi:10.1074/jbc.M704053200)

    • Search Google Scholar
    • Export Citation
  • ColemanDL1982Diabetes-obesity syndromes in mice. Diabetes3116. (doi:10.2337/diab.31.1.S1)

  • de LucaCKowalskiTJZhangYElmquistJKLeeCKilimannMWLudwigTLiuSMChuaSCJr2005Complete rescue of obesity, diabetes, and infertility in db/db mice by neuron- specific LEPR-B transgenes. Journal of Clinical Investigation11534843493. (doi:10.1172/JCI24059)

    • Search Google Scholar
    • Export Citation
  • FarooqiISWangensteenTCollinsSKimberWMatareseGKeoghJMLankEBottomleyBLopez-FernandezJFerraz-AmaroI2007Clinical and molecular genetic spectrum of congenital deficiency of the leptin receptor. New England Journal of Medicine356237247. (doi:10.1056/NEJMoa063988)

    • Search Google Scholar
    • Export Citation
  • FishmanSMuzumdarRHAtzmonGMaXYangXEinsteinFH2007Resistance to leptin action is the major determinant of hepatic triglyceride accumulation in vivo. FASEB Journal215360. (doi:10.1096/fj.06-6557com)

    • Search Google Scholar
    • Export Citation
  • FlakJNMyersMGJr2016Minireview: CNS mechanisms of leptin action. Molecular Endocrinology30312. (doi:10.1210/me.2015-1232)

  • ForetzMGuigasBBertrandLPollakMViolletB2014Metformin: from mechanisms of action to therapies. Cell Metabolism20953966. (doi:10.1016/j.cmet.2014.09.018)

    • Search Google Scholar
    • Export Citation
  • GajewskaJWekerHAmbroszkiewiczJSzamotulskaKChełchowskaMFranekELaskowska-KlitaT2013Alterations in markers of bone metabolism and adipokines following a 3-month lifestyle intervention induced weight loss in obese prepubertal children. Experimental and Clinical Endocrinology & Diabetes121498504. (doi:10.1055/s-00000017)

    • Search Google Scholar
    • Export Citation
  • GanLGuoKCremonaMLMcGrawTELeibelRLZhangY2012TNF-α up-regulates protein level and cell surface expression of the leptin receptor by stimulating its export via a PKC-dependent mechanism. Endocrinology15358215833. (doi:10.1210/en.2012-1510)

    • Search Google Scholar
    • Export Citation
  • GavrilovaOBarrVMarcus-SamuelsBReitmanM1997Hyperleptinemia of pregnancy associated with the appearance of a circulating form of the leptin receptor. Journal of Biological Chemistry2723054630551. (doi:10.1074/jbc.272.48.30546)

    • Search Google Scholar
    • Export Citation
  • GeHHuangLPourbahramiTLiC2002Generation of soluble leptin receptor by ectodomain shedding of membrane-spanning receptors in vitro and in vivo. Journal of Biological Chemistry2774589845903. (doi:10.1074/jbc.M205825200)

    • Search Google Scholar
    • Export Citation
  • GreenBDIrwinNDuffyNAGaultVAO’harteFPFlattPR2006Inhibition of dipeptidyl peptidase-IV activity by metformin enhances the antidiabetic effects of glucagon-like peptide-1. European Journal of Pharmacology547192199. (doi:10.1016/j.ejphar.2006.07.043)

    • Search Google Scholar
    • Export Citation
  • HamnvikOPLiuXPetrouMGongHChamberlandJPKimEHChristophiCAKalesSNChristianiDCMantzorosCS2011Soluble leptin receptor and leptin are associated with baseline adiposity and metabolic risk factors, and predict adiposity, metabolic syndrome, and glucose levels at 2-year follow-up: the Cyprus Metabolism Prospective Cohort Study.Metabolism60987993. (doi:10.1016/j.metabol.2010.09.009)

    • Search Google Scholar
    • Export Citation
  • HoriguchiNWangLMukhopadhyayPParkOJeongWILafdilFOsei-HyiamanDMohAFuXYPacherP2008Cell type-dependent pro- and anti-inflammatory role of signal transducer and activator of transcription 3 in alcoholic liver injury. Gastroenterology13411481158. (doi:10.1053/j.gastro.2008.01.016)

    • Search Google Scholar
    • Export Citation
  • HuynhFKLeviJDenrocheHCGraySLVosholPJNeumannUHSpeckMChuaSCCoveySDKiefferTJ2010Disruption of hepatic leptin signaling protects mice from age- and diet-related glucose intolerance. Diabetes5930323040. (doi:10.2337/db10-0074)

    • Search Google Scholar
    • Export Citation
  • IkedaTIwataKMurakamiH2000Inhibitory effect of metformin on intestinal glucose absorption in the perfused rat intestine. Biochemical Pharmacology59887890. (doi:10.1016/S0006-2952(99)00396-2)

    • Search Google Scholar
    • Export Citation
  • InoueHOgawaWOzakiMHagaSMatsumotoMFurukawaKHashimotoNKidoYMoriTSakaueH2004Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate metabolism in vivo. Nature Medicine10168174. (doi:10.1038/nm980)

    • Search Google Scholar
    • Export Citation
  • KastinAJPanWManessLMKoletskyRJErnsbergerP1999Decreased transport of leptin across the blood-brain barrier in rats lacking the short form of the leptin receptor. Peptides2014491453. (doi:10.1016/S0196-9781(99)00156-4)

    • Search Google Scholar
    • Export Citation
  • KinoshitaSOgawaWOkamotoYTakashimaMInoueHMatsukiYWatanabeEHiramatsuRKasugaM2008Role of hepatic STAT3 in the regulation of lipid metabolism. Kobe Journal of Medical Sciences54E200E208.

    • Search Google Scholar
    • Export Citation
  • KratzschJDeimelAGallerAKapellenTKlinghammerAKiessW2004Increased serum soluble leptin receptor levels in children and adolescents with type 1 diabetes mellitus. European Journal of Endocrinology151475481. (doi:10.1530/eje.0.1510475)

    • Search Google Scholar
    • Export Citation
  • KratzschJKnerrIGallerAKapellenTRaileKKörnerAThieryJDötschJKiessW2006Metabolic decompensation in children with type 1 diabetes mellitus associated with increased serum levels of the soluble leptin receptor. European Journal of Endocrinology155609614. (doi:10.1530/eje.1.02261)

    • Search Google Scholar
    • Export Citation
  • KroyDCBerazaNTschaharganehDFSanderLEErschfeldSGiebelerALiedtkeCWasmuthHETrautweinCStreetzKL2010Lack of interleukin-6/glycoprotein 130/signal transducers and activators of transcription-3 signaling in hepatocytes predisposes to liver steatosis and injury in mice. Hepatology51463473. (doi:10.1002/hep.23322)

    • Search Google Scholar
    • Export Citation
  • LaimerMEbenbichlerCFKaserSSandhoferAWeissHNehodaHAignerFPatschJR2002Weight loss increases soluble leptin receptor levels and the soluble receptor bound fraction of leptin. Obesity Research10597601. (doi:10.1038/oby.2002.81)

    • Search Google Scholar
    • Export Citation
  • LammertAKiessWBottnerAGlasowAKratzschJ2001Soluble leptin receptor represents the main leptin binding activity in human blood. Biochemical and Biophysical Research Communications283982988. (doi:10.1006/bbrc.2001.4885)

    • Search Google Scholar
    • Export Citation
  • LeeYWangMYKakumaTWangZWBabcockEMcCorkleKHigaMZhouYTUngerRH2001Liporegulation in diet-induced obesity. The antisteatotic role of hyperleptinemia. Journal of Biological Chemistry27656295635. (doi:10.1074/jbc.M008553200)

    • Search Google Scholar
    • Export Citation
  • LeoneADi GennaroEBruzzeseFAvalloneABudillonA2014New perspective for an old antidiabetic drug: metformin as anticancer agent. Cancer Treatment and Research159355376. (doi:10.1007/978-3-642-38007-5)

    • Search Google Scholar
    • Export Citation
  • LiYXuSMihaylovaMMZhengBHouXJiangBParkOLuoZLefaiEShyyJY2011AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metabolism13376388. (doi:10.1016/j.cmet.2011.03.009)

    • Search Google Scholar
    • Export Citation
  • LouPHYangGHuangLCuiYPourbahramiTRaddaGKLiCHanW2010Reduced body weight and increased energy expenditure in transgenic mice over-expressing soluble leptin receptor. PLoS ONE5e11669. (doi:10.1371/journal.pone.0011669)

    • Search Google Scholar
    • Export Citation
  • MaamraMBidlingmaierMPostel-VinayMCWuZStrasburgerCJRossRJ2001Generation of human soluble leptin receptor by proteolytic cleavage of membrane-anchored receptors. Endocrinology14243894393. (doi:10.1210/endo.142.10.8442)

    • Search Google Scholar
    • Export Citation
  • MadirajuAKErionDMRahimiYZhangXMBraddockDTAlbrightRAPrigaroBJWoodJLBhanotSMacDonaldMJ2014Metformin suppresses gluconeogenesis by inhibiting mitochondrial glycerophosphate dehydrogenase. Nature510542546. (doi:10.1038/nature13270)

    • Search Google Scholar
    • Export Citation
  • MaidaALamontBJCaoXDruckerDJ2011Metformin regulates the incretin receptor axis via a pathway dependent on peroxisome proliferator-activated receptor-α in mice. Diabetologia54339349. (doi:10.1007/s00125-010-1937-z)

    • Search Google Scholar
    • Export Citation
  • MalinSKKashyapSR2014Effects of metformin on weight loss: potential mechanisms. Current Opinion in Endocrinology Diabetes Obesity2123329. (doi:10.1097/med.0000000000000095)

    • Search Google Scholar
    • Export Citation
  • MarroquíLGonzalezAÑecoPCaballero-GarridoEVieiraERipollCNadalAQuesadaI2012Role of leptin in the pancreatic β-cell: effects and signaling pathways. Journal of Molecular Endocrinology49R9R17. (doi:10.1530/jme-12-0025)

    • Search Google Scholar
    • Export Citation
  • MiaoHOuJMaYGuoFYangZWigginsMLiuCSongWHanXWangM2014Macrophage CGI-58 deficiency activates ROS-inflammasome pathway to promote insulin resistance in mice. Cell Reports7223235. (doi:10.1016/j.celrep.2014.02.047)

    • Search Google Scholar
    • Export Citation
  • MillerRAChuQXieJForetzMViolletBBirnbaumMJ2013Biguanides suppress hepatic glucagon signalling by decreasing production of cyclic AMP. Nature494256260. (doi:10.1038/nature11808)

    • Search Google Scholar
    • Export Citation
  • MissoMLTeedeHJ2015Metformin in women with PCOS, cons. Endocrine48428433. (doi:10.1007/s12020-014-0394-8)

  • MontagueCTFarooqiISWhiteheadJPSoosMARauHWarehamNJSewterCPDigbyJEMohammedSNHurstJA1997Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature387903908. (doi:10.1038/43185)

    • Search Google Scholar
    • Export Citation
  • MonteleonePFabrazzoMTortorellaAFuschinoAMajM2002Opposite modifications in circulating leptin and soluble leptin receptor across the eating disorder spectrum. Molecular Psychiatry7641646. (doi:10.1038/sj.mp.4001043)

    • Search Google Scholar
    • Export Citation
  • MoralesDRMorrisAD2015Metformin in cancer treatment and prevention. Annual Review of Medicine661729. (doi:10.1146/annurev-med-062613-093128)

    • Search Google Scholar
    • Export Citation
  • MuoioDMLynis DohmG2002Peripheral metabolic actions of leptin. Best Practice & Research Clinical Endocrinology & Metabolism16653666. (doi:10.1053/beem.2002.0223)

    • Search Google Scholar
    • Export Citation
  • MyersMGJrLeibelRLSeeleyRJSchwartzMW2010Obesity and leptin resistance: distinguishing cause from effect. Trends in Endocrinology and Metabolism21643651. (doi:10.1016/j.tem.2010.08.002)

    • Search Google Scholar
    • Export Citation
  • OgawaTHiroseHYamamotoYNishikaiKMiyashitaKNakamuraHSaitoISarutaT2004Relationships between serum soluble leptin receptor level and serum leptin and adiponectin levels, insulin resistance index, lipid profile, and leptin receptor gene polymorphisms in the Japanese population. Metabolism53879885. (doi:10.1016/j.metabol.2004.02.009)

    • Search Google Scholar
    • Export Citation
  • RomualdiDCampagnaGSelvaggiLJrCentoRProtoCLanzoneAGuidoM2008Metformin treatment does not affect total leptin levels and free leptin index in obese patients with polycystic ovary syndrome. Fertility and Sterility8912731276. (doi:10.1016/j.fertnstert.2007.05.004)

    • Search Google Scholar
    • Export Citation
  • SchaabMKauschHKlammtJNowickiMAndereggUGebhardtRRose-JohnSSchellerJThieryJKratzschJ2012Novel regulatory mechanisms for generation of the soluble leptin receptor: implications for leptin action. PLoS ONE7 e34787. (doi:10.1371/journal.pone.0034787)

    • Search Google Scholar
    • Export Citation
  • SchrothMKratzschJGröschlMRauhMRascherWDötschJ2003Increased soluble leptin receptor in children with nephrotic syndrome. Journal Clinical Endocrinology and Metabolism8854975501. (doi:10.1210/jc.2003-030539)

    • Search Google Scholar
    • Export Citation
  • ShinNRLeeJCLeeHYKimMSWhonTWLeeMSBaeJW2014An increase in the Akkermansia spp. population induced by metformin treatment improves glucose homeostasis in diet-induced obese mice. Gut63727735. (doi:10.1136/gutjnl-2012-303839)

    • Search Google Scholar
    • Export Citation
  • SiejkaAJankiewicz-WikaJKołomeckiKCywińskiJPiestrzeniewiczKSwiętosławskiJStępieńHKomorowskiJ2013Long-term impact of vertical banded gastroplasty (VBG) on plasma concentration of leptin, soluble leptin receptor, ghrelin, omentin-1, obestatin, and retinol binding protein 4 (RBP4) in patients with severe obesity. Cytokine64490493. (doi:10.1016/j.cyto.2013.07.026)

    • Search Google Scholar
    • Export Citation
  • SteinKVasquez-GaribayEKratzschJRomero-VelardeEJahreisG2006Influence of nutritional recovery on the leptin axis in severely malnourished children. Journal Clinical Endocrinology and Metabolism9110211026. (doi:10.1210/jc.2005-1394)

    • Search Google Scholar
    • Export Citation
  • SunQvan DamRMMeigsJBFrancoOHMantzorosCSHuFB2010Leptin and soluble leptin receptor levels in plasma and risk of type 2 diabetes in U.S. women: a prospective study. Diabetes59611618. (doi:10.2337/db09-1343)

    • Search Google Scholar
    • Export Citation
  • TuHKastinAJHsuchouHPanW2008Soluble receptor inhibits leptin transport. Journal of Cellular Physiology214301305. (doi:10.1002/jcp.21195)

    • Search Google Scholar
    • Export Citation
  • WolfeBEJimersonDCOrlovaCMantzorosCS2004Effect of dieting on plasma leptin, soluble leptin receptor, adiponectin and resistin levels in healthy volunteers. Clinical Endocrinology61332338. (doi:10.1111/j.1365-2265.2004.02101.x)

    • Search Google Scholar
    • Export Citation
  • WooSLXuHLiHZhaoYHuXZhaoJGuoXGuoTBotchlettRQiT2014Metformin ameliorates hepatic steatosis and inflammation without altering adipose phenotype in diet-induced obesity. PLoS ONE9e91111. (doi:10.1371/journal.pone.0091111)

    • Search Google Scholar
    • Export Citation
  • YoshinoSSatohTYamadaMHashimotoKTomaruTKatano-TokiAKakizakiSOkadaSShimizuHOzawaA2014Protection against high-fat diet-induced obesity in Helz2-deficient male mice due to enhanced expression of hepatic leptin receptor. Endocrinology15534593472. (doi:10.1210/en.2013-2160)

    • Search Google Scholar
    • Export Citation
  • YuDYuZSunQSunLLiHSongJMiMWuHLuLLiuC2011Effects of body fat on the associations of high-molecular-weight adiponectin, leptin and soluble leptin receptor with metabolic syndrome in Chinese. PLoS ONE6e16818. (doi:10.1371/journal.pone.0016818)

    • Search Google Scholar
    • Export Citation
  • ZastrowOSeidelBKiessWThieryJKellerEBöttnerAKratzschJ2003The soluble leptin receptor is crucial for leptin action: evidence from clinical and experimental data. International Journal of Obesity and Related Metabolic Disorders2714721478. (doi:10.1038/sj.ijo.0802432)

    • Search Google Scholar
    • Export Citation
  • ZhangJScarpacePJ2009The soluble leptin receptor neutralizes leptin-mediated STAT3 signalling and anorexic responses in vivo. British Journal of Pharmacology158475482. (doi:10.1111/j.1476-5381.2009.00246.x)

    • Search Google Scholar
    • Export Citation
  • ZhangYProencaRMaffeiMBaroneMLeopoldLFriedmanJM1994Positional cloning of the mouse obese gene and its human homologue. Nature372425432. (doi:10.1038/372425a0)

    • Search Google Scholar
    • Export Citation
  • ZhengJWooSLHuXBotchlettRChenLHuoYWuC2015Metformin and metabolic diseases: a focus on hepatic aspects. Frontiers of Medicine9173186. (doi:10.1007/s11684-015-0384-0)

    • Search Google Scholar
    • Export Citation