Hepatocyte-specific, PPARγ-regulated mechanisms to promote steatosis in adult mice

in Journal of Endocrinology
Authors:
Abigail Wolf GreensteinResearch and Development Division, Jesse Brown Veterans Affairs Medical Center, Chicago, Illinois, USA
Section of Endocrinology, Diabetes, and Metabolism, Department of Medicine, University of Illinois at Chicago, Chicago, Illinois, USA
Biologic Resources Laboratory, University of Illinois at Chicago, Chicago, Illinois, USA

Search for other papers by Abigail Wolf Greenstein in
Current site
Google Scholar
PubMed
Close
,
Neena MajumdarResearch and Development Division, Jesse Brown Veterans Affairs Medical Center, Chicago, Illinois, USA
Section of Endocrinology, Diabetes, and Metabolism, Department of Medicine, University of Illinois at Chicago, Chicago, Illinois, USA

Search for other papers by Neena Majumdar in
Current site
Google Scholar
PubMed
Close
,
Peng YangResearch and Development Division, Jesse Brown Veterans Affairs Medical Center, Chicago, Illinois, USA
Section of Endocrinology, Diabetes, and Metabolism, Department of Medicine, University of Illinois at Chicago, Chicago, Illinois, USA

Search for other papers by Peng Yang in
Current site
Google Scholar
PubMed
Close
,
Papasani V SubbaiahResearch and Development Division, Jesse Brown Veterans Affairs Medical Center, Chicago, Illinois, USA
Section of Endocrinology, Diabetes, and Metabolism, Department of Medicine, University of Illinois at Chicago, Chicago, Illinois, USA

Search for other papers by Papasani V Subbaiah in
Current site
Google Scholar
PubMed
Close
,
Rhonda D KinemanResearch and Development Division, Jesse Brown Veterans Affairs Medical Center, Chicago, Illinois, USA
Section of Endocrinology, Diabetes, and Metabolism, Department of Medicine, University of Illinois at Chicago, Chicago, Illinois, USA

Search for other papers by Rhonda D Kineman in
Current site
Google Scholar
PubMed
Close
, and
Jose Cordoba-ChaconResearch and Development Division, Jesse Brown Veterans Affairs Medical Center, Chicago, Illinois, USA
Section of Endocrinology, Diabetes, and Metabolism, Department of Medicine, University of Illinois at Chicago, Chicago, Illinois, USA

Search for other papers by Jose Cordoba-Chacon in
Current site
Google Scholar
PubMed
Close
View More View Less

Free access

Peroxisome proliferator-activated receptor γ (PPARγ) is the target for thiazolidinones (TZDs), drugs that improve insulin sensitivity and fatty liver in humans and rodent models, related to a reduction in hepatic de novo lipogenesis (DNL). The systemic effects of TZDs are in contrast to reports suggesting hepatocyte-specific activation of PPARγ promotes DNL, triacylglycerol (TAG) uptake and fatty acid (FA) esterification. As these hepatocyte-specific effects of PPARγ could counterbalance the positive therapeutic actions of systemic delivery of TZDs, the current study used a mouse model of adult-onset, liver (hepatocyte)-specific PPARγ knockdown (aLivPPARγkd). This model has advantages over existing congenital knockout models, by avoiding compensatory changes related to embryonic knockdown, thus better modeling the impact of altering PPARγ on adult physiology, where metabolic diseases most frequently develop. The impact of aLivPPARγkd on hepatic gene expression and endpoints in lipid metabolism was examined after 1 or 18 weeks (Chow-fed) or after 14 weeks of low- or high-fat (HF) diet. aLivPPARγkd reduced hepatic TAG content but did not impact endpoints in DNL or TAG uptake. However, aLivPPARγkd reduced the expression of the FA translocase (Cd36), in 18-week Chow- and HF-fed mice, associated with increased NEFA after HF feeding. Also, aLivPPARγkd dramatically reduced Mogat1 expression, that was reflected by an increase in hepatic monoacylglycerol (MAG) levels, indicative of reduced MOGAT activity. These results, coupled with previous reports, suggest that Cd36-mediated FA uptake and MAG pathway-mediated FA esterification are major targets of hepatocyte PPARγ, where loss of this control explains in part the protection against steatosis observed after aLivPPARγkd.

Abstract

Peroxisome proliferator-activated receptor γ (PPARγ) is the target for thiazolidinones (TZDs), drugs that improve insulin sensitivity and fatty liver in humans and rodent models, related to a reduction in hepatic de novo lipogenesis (DNL). The systemic effects of TZDs are in contrast to reports suggesting hepatocyte-specific activation of PPARγ promotes DNL, triacylglycerol (TAG) uptake and fatty acid (FA) esterification. As these hepatocyte-specific effects of PPARγ could counterbalance the positive therapeutic actions of systemic delivery of TZDs, the current study used a mouse model of adult-onset, liver (hepatocyte)-specific PPARγ knockdown (aLivPPARγkd). This model has advantages over existing congenital knockout models, by avoiding compensatory changes related to embryonic knockdown, thus better modeling the impact of altering PPARγ on adult physiology, where metabolic diseases most frequently develop. The impact of aLivPPARγkd on hepatic gene expression and endpoints in lipid metabolism was examined after 1 or 18 weeks (Chow-fed) or after 14 weeks of low- or high-fat (HF) diet. aLivPPARγkd reduced hepatic TAG content but did not impact endpoints in DNL or TAG uptake. However, aLivPPARγkd reduced the expression of the FA translocase (Cd36), in 18-week Chow- and HF-fed mice, associated with increased NEFA after HF feeding. Also, aLivPPARγkd dramatically reduced Mogat1 expression, that was reflected by an increase in hepatic monoacylglycerol (MAG) levels, indicative of reduced MOGAT activity. These results, coupled with previous reports, suggest that Cd36-mediated FA uptake and MAG pathway-mediated FA esterification are major targets of hepatocyte PPARγ, where loss of this control explains in part the protection against steatosis observed after aLivPPARγkd.

Introduction

Non-alcoholic fatty liver disease (NAFLD) is defined as excessive accumulation of fat (steatosis) within hepatocytes that is independent of alcohol intake. NAFLD increases the risk of diabetes, non-alcoholic steatohepatitis (NASH), cirrhosis and hepatocellular carcinoma (Michelotti et al. 2013, Lade et al. 2014). Importantly, NAFLD is now recognized as the leading cause of chronic liver disease in the US (Younossi et al. 2011) and the third most common reason for liver transplants (Zezos & Renner 2014). Given the negative association between NAFLD and human health, a concerted effort is being made to understand the cellular and molecular mechanisms that control hepatocyte triacylglycerol (TAG) content. It is clear that hepatocyte TAG content is dictated by the balance between fatty acid (FA) synthesis, uptake, esterification and oxidation, as well as TAG release via very-low-density lipoprotein (VLDL) (Browning & Horton 2004). A better understanding of the mechanisms controlling these processes could help to identify individuals with higher risk of NAFLD, as well as identify novel drug targets to design therapeutic strategies that prevent or reverse NAFLD progression.

Thiazolidinones (TZDs) are synthetic agonists of the nuclear receptor, peroxisome proliferator-activated receptor γ (PPARγ) used to treat diabetes type 2 (Ahmadian et al. 2013). Treating patients with non-alcoholic steatohepatitis (an advance stage of NAFLD featured by elevated markers of liver injury and fibrosis) with TZDs reduces steatosis with variable effects on fibrosis (Belfort et al. 2006, Ratziu et al. 2008, Sanyal et al. 2010). The reduction in steatosis is associated with a reduction in hepatic de novo lipogenesis (DNL; Beysen et al. 2008). Similar to clinical studies, TZDs have also been shown to reduce hepatic fat content in rodent models (Nan et al. 2009, Gupte et al. 2010). However, in striking contrast to the global impact of TZDs: (1) hepatocyte-specific PPARγ expression is positively associated with fatty liver in humans (Pettinelli & Videla 2011) and mouse models (Rahimian et al. 2001, Gavrilova et al. 2003, Matsusue et al. 2003, Inoue et al. 2005); (2) adenoviral overexpression of a PPARγ transgene in the liver of high-fat (HF)-fed PPARα knockout or WT mice dramatically increases hepatic fat content (Yu et al. 2003, Bai et al. 2011); (3) congenital hepatocyte-specific knockout of PPARγ reduces hepatic fat content in mice fed a HF diet (Moran-Salvador et al. 2011), as well as in mice with fatty liver due to inactivating mutations in the leptin gene (ob/ob; Matsusue et al. 2003) or lipodystrophy induced by lack of adipocyte development (AZIP; Gavrilova et al. 2003). This disconnect between the impact of systemic TZD (PPARγ agonist) delivery compared to the impact of hepatic-specific alterations in PPARγ function can be attributed to the integrated effects of PPARγ on multiple target tissues. Specifically, TZDs increase systemic insulin sensitivity, which in turn reduces insulin demands. These changes are associated with an increase in adiponectin production by the adipocyte. Adiponectin in turn promotes hepatic fatty acid oxidation via phosphorylation of AMPK and ACC (Yamauchi et al. 2002, Xu et al. 2003), which suppresses DNL (Xu et al. 2003). Therefore, TZD’s effects on lowering steatosis are likely due to extra-hepatocyte mechanisms (Furnsinn & Waldhausl 2002).

Although the global therapeutic effects of TZDs have been largely positive, the direct actions of PPARγ on the hepatocyte could serve to counterbalance these effects. Therefore, to optimize the development and use of TZDs, it is important to understand the tissue (cell)-specific impact of PPARγ on lipid homeostasis. With respect to the hepatocyte, studies using hepatocyte-specific PPARγ-knockout models have led to the conclusion that PPARγ directly promotes hepatic fat accumulation by increasing lipid uptake, as well as promoting DNL (Gavrilova et al. 2003, Matsusue et al. 2003, 2014, Schadinger et al. 2005, Zhang et al. 2006). However, it remains unclear if the shifts in hepatic gene expression that support these conclusions are due directly to loss of hepatocyte PPARγ or to compensation by other hepatic genes during development and/or secondary to changes in the systemic metabolic milieu. Therefore, in the current study, we have employed a mouse model of adult-onset, hepatocyte-specific knockdown of PPARγ (aLivPPARγkd), that is generated by treating adult (10 weeks) PPARγfl/fl mice with an adeno-associated virus serotype 8 (AAV8) bearing a liver-specific thyroxine-binding globulin (TBG)-promoter driving a Cre recombinase transgene (AAV8-TBGp-Cre) vector. This model allows us to study the immediate impact of hepatocyte-specific loss of PPARγ in the adult liver and how this deficit influences liver function overtime under different dietary conditions. As indicated in this study and supported by accumulating evidence (Yanger et al. 2014, Ashpole et al. 2016, Shin et al. 2016), injection of AAV8-TBGp-Cre is an efficient and reproducible method to knockdown a floxed allele only in hepatocytes, independent of age.

Analysis of changes in hepatic gene expression and circulating metabolites, combined with assessment of hepatic FA composition (gas chromatography/mass spectrometry (GC/MS)) and relative levels of TAG, diacylglycerols (DAG) and monoacylglycerols (MAG) (liquid chromatography/mass spectrometry (LC/MS)), indicate that adult-onset loss of hepatocyte PPARγ has little direct impact on DNL, FA oxidation, lipid uptake and TAG export. However, evidence indicates that hepatic PPARγ plays a primary role in regulating FA uptake, likely through regulating the expression of Cd36, and the MAG pathway, by regulating expression of Mogat1, which esterifies FA to MAG to form DAG. Impairment of these pathways after the loss of hepatocyte PPARγ may explain, in part, the protection against age- and diet-induced steatosis.

Materials and methods

Animals

All mouse studies were approved by the IACUC of the Jesse Brown VA Medical Center and performed in accordance with the Guide for the Care and Use of Laboratory Animals. PPARγfl/fl (He et al. 2003) mice were purchased from Jackson Laboratories (Strain 004584, B3.129-Ppargtm2Rev/J, Bar Harbor, ME) and bred as homozygotes. Animals were housed in a temperature- (22–24°C) and humidity-controlled specific pathogen-free barrier facility with 12-h light/12-h darkness cycle (lights on at 06:00 h). Mice were fed a standard laboratory rodent chow diet (Formulab Diet 5008, Purina Mills, Richmond, IN, USA), unless otherwise indicated. Ten- to twelve-week-old male PPARγfl/fl littermate mice were randomized and injected in the lateral tail vein with 100 µL saline containing 1.5 × 1011 genome copies of an AAV8 bearing either a TBG-driven Cre recombinase (AAV8-TBGp-Cre, Penn Vector Core, University of Pennsylvania), which generates adult-onset hepatocyte (liver)-specific PPARγ-knockdown mice (aLivPPARγkd) or AAV8-TBGp-Null, which generates controls.

Chow-fed mice were killed in the post-absorptive state (4 h after food removal at 07:00 h), at 1 or 18 weeks after PPARγ knockdown. A separate group of PPARγfl/fl mice was fed a low-fat (LF) diet with 10% kcal fat (D12450B, Research Diets, Inc. New Brunswick, NJ, USA) from weaning onward. At 10–12 weeks of age, mice were injected with either AAV8-TBGp-Cre or AAV8-TBGp-Null, and half the mice in each group switched to a nutrient-matched 60% HF diet (D12492, Research Diets, Inc), whereas the remaining mice continued to receive a LF diet. Animals were maintained on their respective diets for 14 weeks and killed in the post-absorptive state.

Mice were killed by decapitation, and trunk blood was collected to determine blood glucose (Alphatrack2, Abbott), plasma insulin (Mercodia, Uppsala, Sweden), TAG, NEFA, cholesterol and 3β-hydroxybutyrate (Wako Diagnostics) levels following the manufacturer’s instructions. Liver and fat sub-depots were weighed. Livers were snap-frozen in liquid nitrogen and stored at −80°C. In a subset of mice killed 1 week after AAV8-TBGp-Null or AAV8-TBGp-Cre injection, multiple tissues were collected to assess AAV8-TBGp-driven Cre expression. A group of 10- to 12-week-old C57Bl6/J mice was injected with 1.5 × 1011 genome copies of an AAV8-TBGp-EGFP (Cat #AV-8-PV0146, Penn Vector Core, GFP as a reporter gene) and killed 1 week after to collect multiple tissues to assess GFP expression. Also, a piece of liver was fixed in 10% formalin to assess hepatocyte-specific expression of GFP.

Assessment of hepatic lipids

To assess the hepatic TAG content, neutral hepatic lipids were extracted in isopropanol and TAG measured as previously published (Cordoba-Chacon et al. 2014a).

To assess hepatic FA composition in mice fed LF and HF diets, total lipids were extracted using the Bligh and Dyer Method (Bligh & Dyer 1959). An aliquot of extracted lipids was transmethylated to quantify specific methyl esters of FA using GC/MS, as we previously reported (Kineman et al. 2016).

LC/MS was used to assess the relative content of hepatic TAG, DAG and MAG. Briefly, hepatic homogenates were spiked with standards (50 µg trinonadecadienoin glyceride (TAG-(19:2/19:2/19:2)), 50 µg dipentadecanoin glyceride (DAG-(15:0/15:0)) and 50 µg monononadecanoin glyceride (MAG-(19:0)); Nu-Chek, Waterville, MN, USA) and extracted using the Bligh and Dyer Method (Bligh & Dyer 1959). Aliquots were dissolved in 80:19.5:0.5 parts of methanol/chloroform/water to dilute the standards to a concentration of 0.25 µg/mL. Samples (10 µL) were injected using an Agilent 2600 UPLC into the AB Sciex 6500 Qtrap mass spectrometer (Agilent Technologies) without chromatography separation. The flow rate of mobile phase (methanol/chloroform/water 80:19.5:0.5 v/v) containing 0.1% of NH4COOH was set to 200 µL/min. Electrospray ionization-mass spectrometry (ESI-MS) was performed in positive multiple reaction monitoring (MRM) mode for the quantitative and qualitative analysis. The spray voltage was 4.5 kV, the source temperature was set at 450°C. Mass spectra were acquired and recorded by Analyst software (AB Sciex, version 6.1). The major neutral lipids species known to be present in the liver tissues were analyzed in MRM mode, with the transition from its ammoniated ion (Q1) to the product ion derived from the loss of its ammoniated fatty acid (Q3) (Yang & Subbaiah 2015). Quantification of individual molecular species was performed from the relative intensities of the various species and the corresponding internal standards, respectively. Individual MRM of the internal standards was MAG-(19:0) Q1 390.4, Q3 75.1; DAG-(15:0/15:0) Q1 558.5, Q3 299.3; TAG-(19:2/19:2/19:2) Q1 938.8, Q3 625.5.

Gene expression analysis

Hepatic and adipose tissue RNA was extracted using TRIzol Reagent (Life Technologies) and treated with RQ1 RNase-free DNase (Promega). DNA-free RNA was transcribed, and qPCR was performed as previously published (Cordoba-Chacon et al. 2014a, Kineman et al. 2016). qPCR primer sequences for PPARγ, carnitine palmitoyltransferase 1α (Cpt1α), adipose triglyceride lipase (Atgl), hormone-sensitive lipase (Hsl), sterol response element-binding protein 1c (Srebp1c), acetyl-CoA carboxylase 1 (Acc1), fatty acid synthase (Fasn), fatty acid elongase (Elovl6), stearoyl–CoA desaturase 1 (Scd1), fatty acid translocase (Cd36), glycerol phosphate acyltransferase (Gpat1), monoacylglycerol acyltransferase 1 (Mogat1), Cre recombinase, GFP, cyclophilin A, β-actin and hypoxanthine-guanine phosphoribosyltransferase were previously published (Cordoba-Chacon et al. 2014a, 2015a, Kineman et al. 2016). Primer sequences for PPARα (NM_011144): Se: GGGAAAGACCAGCAACAACC, As: GCAGTGGAAGAATCGGACCT; acyl-CoA synthetase long-chain family member 1 (Acsl1, NM_007981): Se: GAGGGTGAGGTGTGTGTGAAA, As: CCGTGTGTAACCAGCCATCT; hepatic nuclear factor 4 α (Hnf4α, NM_008261.3): Se: ACATTCGGGCAAAGAAGATTG, As: ACCTGGTCATCCAGAAGGAGTT; PPARγ co-activator 1 α; (Pgc1α, NM_008904.2): Se: TTCCCGATCACCATATTCCA, As: TTCATCCCTCTTGAGCCTTTC; Cyp4a10 (NM_010011.3): Se: CCACTGATTCTGTTGTGGAGC, As: CATTAGAAGAGAGGGGATGAGGA; monoacylglycerol lipase (Mgll, NM_001166251.1): Se: GTGGAATGCAAAAGCCAAGA, As: AGCTCATCATAACGGCCACA; apolipoprotein B (ApoB, NM_009693.2): Se: AGCCCAGCACTGACTGACTT, As: GAAGCCTTGGGCACATTG; microsomal triglyceride transfer protein (Mttp, NM_001163457.1): Se: CAGTGGATGCCTCTTTTGTG, As: GTCTCGAATTGCCTGAGTGG; hepatic lipase (Hl, NM_008280.2): Se: TTTTCCTGGTGTTCTGCATCT, As: CAGGCGATCGTTTTCATCTT; low-density lipoprotein lipase receptor (Ldlr, NM_001252658.1): Se: TGTCACCTGTCAGTCCAATCAA, As: TCAGAGCCATCTAGGCAATCTC; very-low-density lipoprotein receptor (Vldlr, NM_013703.2): Se: GTGCAAGGCAGTAGGCAAAG, As: GCTGAGATCAGCCCAAAACA; lipoprotein-related protein 1 (Lrp1, NM_008512.2): Se: ACACACGCCAACTGTACCAA, As: TGACATTCGGGTCACAAACA; monoacylglycerol acyltransferase 2 (Mogat2, NM_146035.2): Se: TGTGAAAACTTGGAAATCGACA, As: CAGTCTCCAGCATGAAAAATCC; diacylglycerol acyltransferase 1 (Dgat1, NM_010046.2): Se: AGCTGTGGCCTTACTGGTTG, As: AGCAGCCCCACTGACCTT.

Western blot

Livers were homogenized in extraction buffer pH 7.5, 50 mM HEPES, 2 mM EGTA, 2 mM EDTA, 130 mM NaCl, 10 mM NaF, 20 mM β-glycerophosphate, 2 mM sodium pyrophosphate, 1 mM sodium vanadate, 0.5 mM PMSF, 0.1% nonidet P-40, 2 mM benzamidine, 1 mM TLCK, 10 µg/mL leupeptin, 10% glycerol, with protease inhibitors (Complete, Roche), followed by sonication for 10 s. Protein concentration was determined using Bradford reagent (Bio-Rad Laboratories). 100 µg of denatured proteins were separated by SDS-PAGE (Mini-PROTEAN TGX Gels 10%, Bio-Rad Laboratories) and transferred to nitrocellulose membranes. Membranes were blocked with 5% nonfat, dry milk in Tris-buffered saline with 0.05% Tween-20 for 1 h at 25°C, and then incubated with primary antibodies overnight at 4°C (Rabbit anti-human PPARγ mAb (C26H12), 1/500; Rabbit anti-human Histone H3 mAb (D1H2), 1/1000 (Cell Signaling Technology)), washed and incubated with secondary antibodies for 2 h at 25°C (Goat Anti-Rabbit IgG (H + L)-HRP Conjugate, 1/2000 (Bio-Rad Laboratories)). After washing, SuperSignal WestFemto Maximum Sensitivity Substrate (Thermo Scientific) was added and the light signal was detected and analyzed using a C-Digit Blot Scanner and Image Studio Lite Ver 3.1 (Li-Cor Biosciences, Lincoln, NE, USA).

Immunohistochemistry

Livers were fixed in formalin and paraffin embedded. 5 µm sections were deparaffinized, hydrated in graded-ethanol/water solutions and then treated with 10 mM citrate buffer at 125°C for 5′ (GFP, desmin and F4/80 staining) followed by 0.05% porcine trypsin in Tris-buffered solution (TBS) for 10 min at 37°C (F4/80 staining only). Samples were blocked in TBS-containing 1.5% goat serum and 0.01% Tween-20 for 20′, and sections were incubated (4°C overnight in TBS 0.01% Tween-20) with mouse anti-GFP, 1:100 Cell Signaling #2955; rabbit anti-desmin, 1:50 Cell Signaling #5332; rat anti-F4/80 1:50 eBiosciences (San Diego, CA, USA) #14-4801-82. Secondary antibodies (1:500 in blocking buffer): goat anti-rabbit IgG Alexa Fluor594 Cell Signaling #8889 (for desmin staining), goat anti-mouse IgG Alexa Fluor594 Cell Signaling #8890 and goat anti-mouse IgG Fluor488 Cell Signaling #4408 (for GFP stainings), goat anti-rat IgG Alexa Fluor488 Cell Signaling #4416 (for F4/80 staining). Sections were mounted with Fluoroshield with DAPI (Sigma-Aldrich) and immunofluorescence was detected using a Olympus BX43 microscope (Olympus). Images were recorded using Olympus CellSens software (Olympus) and processed using ImageJ (NIH) and CellSens (Olympus).

Statistics

Student’s t-tests were performed to analyze the effect of AAV8-TBGp-Cre on PPARγ expression in liver, epididymal fat (eWAT) and inguinal fat (iWAT) (Fig. 1G). 2-Way ANOVA, followed by Bonferroni’s post hoc analysis, was used to determine the effect of aLivPPARγkd with age or the effect of aLivPPARkd with diet. P values less than 0.05 were considered significant. All statistical analyses were performed using GraphPad Prism 5 (GraphPad Software).

Figure 1
Figure 1

Hepatocyte specificity expression of AAV8-TBGp-driven transgene. Hepatocyte-specific expression of GFP in AAV8-TBGp-EGFP-injected wild-type mice (green, A and B). GFP expression was absent in non-hepatocyte cells (yellow arrows) in sinusoids (Sn), central vein (CV), portal vein (PV), bile duct (BD) or artery (HA). TBGp-GFP was not expressed in hepatic stellate cells (HSC, desmin +, red, C) or macrophages (Mac, F4/80+, red, D). Sections were counterstained with DAPI (blue nuclei, A, B, C and D). Hepatic GFP (E) and Cre (F) expression was detected only in liver extracts of AAV8-TBGp-EGFP- and AAV8-TBGp-Cre-injected mice, respectively. To confirm the hepatocyte-specific activity of Cre recombinase, PPARγfl/fl mice were injected with AAV8-TBGp-Cre and expression of PPARγ was reduced in hepatic extracts but not adipose tissue (G). Ctx, cortex; eWAT, epididymal fat; Int, intestine; iWAT, inguinal fat. Asterisks indicate the difference between AAV8-TBGp-Cre-injected mice as compared to AAV8-TBGp-Null mice. *P < 0.05; ***P < 0.0001. n = 3–6 mice/group.

Citation: Journal of Endocrinology 232, 1; 10.1530/JOE-16-0447

Results

Validation of hepatocyte-specific expression of TBGp-driven transgene after AAV8 injection

Hepatocyte specificity expression of transgenes delivered by AAV8 and driven by TBG was confirmed using an AAV8-TGBp-EGFP reporter (Fig. 1A, B, C, D and E) that led to GFP-positive staining only in hepatocytes and not in other cell types, including vascular endothelial cells, connective tissue surrounding vessels, cholangiocytes of bile ducts (Fig. 1A and B), hepatic stellate cells (HSC; stained positive (red) for desmin (Fig. 1C)) and macrophages, (stained positive (red) F4/80 (Fig. 1D)). AAV8-TBGp-driven GFP and Cre expression was detected in hepatic but not in extrahepatic tissues (Fig. 1E and F). Expression of PPARγ was reduced in liver but not in adipose tissue (Fig. 1G). Interestingly, a modest increase of PPARγ expression was detected in eWAT of aLivPPARγkd mice.

Effects of hepatocyte-specific PPARγ knockdown on metabolic endpoints in adult mice (aLivPPARγkd)

After 1 and 18 weeks of chow diet

AAV8-TBGp-Cre injection resulted in a clear knockdown of hepatocyte PPARγ mRNA and protein at 1 week after injection that persisted after 18 weeks of AAV8 injection (Fig. 2A, B and C). Mouse PPARγ gene produces two isoforms PPARγ1 and PPARγ2 (NM_001127330.2 and NM_0111463). Three mRNA variants are described for PPARγ1 (variant 1: NM_001127330.2; variant 3: NM_001308352.1; variant 4: NM_001308354.1), but all encode for the same protein (isoform 1). In PPARγfl/fl mice two exons, previously described as exons 1 and 2 (He et al. 2003), are flanked by loxP sites. These exons span 227 and 169 bp respectively are located within the CDS of each variant and the qPCR primers employed in this study are placed in these two exons. Therefore, the qPCR result of PPARγ gene expression accounts for all variants and thereby the western blot results account for both isoforms. Of note, hepatic PPARγ mRNA levels modestly, but significantly, increased with age in control but not aLivPPARγkd mice (Fig. 2B and C).

Figure 2
Figure 2

Adult-onset hepatocyte-specific PPARγ knockdown (aLivPPARγkd) in chow-fed mice (A, B and C) and diet-induced obese mice (D, E and F). (A) PPARγfl/fl mice were injected at 10 weeks of age with 1.5 * 1011 GC AAV8-TBGp-Null (C, open columns) or 1.5 * 1011 GC AAV8-TBGp-Cre (Kd, shaded columns) via lateral tail vein and killed 1 or 18 weeks after. (B) Hepatic PPARγ mRNA and (C) protein expression of 1 week and 18 weeks aLivPPARγkd and their littermate control mice. Representative image of the western blot for hepatic PPARγ and Histone (as loading control). Of note, nuclear protein variability within total hepatic extracts (assessed by Histone) alters the amount of PPARγ protein detected. n = 4–5 mice/group. (D) LF-fed PPARγfl/fl mice were injected at 10 weeks as described above and immediately half of the mice were fed a high-fat diet (HF, 60% kcal from fat) to induce liver steatosis, whereas the rest were maintained on a low-fat diet (LF, 10% kcal from fat). Mice were killed 14 weeks after. (E) Hepatic PPARγ mRNA and (F) protein expression of 14 weeks LF- and HF-fed aLivPPARγkd and their littermate controls. Representative images of the western blot for hepatic PPARγ and Histone (as loading control). Asterisks indicate the differences between C and Kd. *P < 0.05; ***P < 0.0001. Letters indicate the differences between 1 week and 18 weeks or LF- and HF-fed mice within group. bP < 0.01; cP < 0.0001. n = 5–6 mice/group.

Citation: Journal of Endocrinology 232, 1; 10.1530/JOE-16-0447

To assess if hepatic lipid metabolism was altered in chow-fed aLivPPARγkd mice, we measured whole body, liver and adipose tissue (unilateral epididymal, inguinal and retroperitoneal fat depots) weights, hepatic TAG levels, as well as circulating blood glucose, plasma insulin, ketones, TAG, NEFA and cholesterol (Table 1). For the majority of endpoints examined, aLivPPARγkd had no effect in either age group. However, there was an overall inhibitory effect of aLivPPARγkd on hepatic TAG levels (P = 0.0185), indicating hepatic PPARγ plays a role in hepatic lipid accumulation, even under standard feeding conditions.

Table 1

Impact of aLivPPARγkd on body, liver and fat depot (sum of the unilateral epididymal, inguinal and retroperitoneal fat depot) weight, hepatic TAG levels and circulating metabolic endpoints (blood glucose, plasma insulin, ketones, TAG, NEFA and NEFA), in chow-fed (top, 1 week and 18 weeks) and LF/HF-fed (bottom, 14 weeks) aLivPPARγkd mice and their littermate controls.

1 week aLivPPARγkd – chow diet 18 weeks aLivPPARγkd – chow diet
Control aLivPPARγkd Control aLivPPARγkd Overall effect (P value) of
Mean SEM Mean SEM Mean SEM Mean SEM Age aLivPPARγkd
Body weight g 25.36±0.84 24.6±0.64 31.81b±1.88 32.49c±0.6 <0.0001 0.9719
Liver g/g BW 0.045±0.0008 0.043±0.0022 0.038a±0.0011 0.038±0.0021 <0.0022 0.3959
Fat mass g/g BW 0.015±0.0015 0.013±0.0011 0.029a±0.0066 0.023±0.0031 0.0091 0.268
Hepatic TAG mg/g 47.63±6.987 38.63±3.027 50.36±4.611 34.72±3.653 0.9024 0.0185
Blood glucose mg/dL 187±14.77 176.8±18.87 190.4±15.7 199.7±8.92 0.3797 0.9748
Plasma insulin ng/μL 1.59±0.15 1.69±0.12 1.88±0.37 1.34±0.14 0.8925 0.3323
Plasma ketones µM 372.1±62.194 372.1±57.92 153.9a±40.907 226.1±33.635 0.0017 0.4704
Plasma TAG mg/dL 91.26±3.772 83.95±5.728 61.35±12.607 67.25±10.736 0.022 0.9396
Plasma NEFA mEq/L 1.05±0.038 1.12±0.063 1.06±0.095 1.07±0.064 0.7687 0.5581
Plasma cholesterol mg/dL 104.83±5.568 107.83±5.233 116.17±8.003 116.61±5.334 0.1177 0.7812
14 weeks aLivPPARγkd – LF diet 14 weeks aLivPPARγkd – HF diet
Control aLivPPARγkd Control aLivPPARγkd Overall effect (P value) of
Mean SEM Mean SEM Mean SEM Mean SEM Diet aLivPPARγkd
Body weight g 30.88±0.95 29.65±0.6 49.52c±0.55 48.52c±1.13 <0.0001 0.1827
Liver g/g BW 0.0376±0.0007 0.0373±0.0006 0.049c±0.001 0.032b***±0.002 0.0062 <0.0001
Fat mass g/g BW 0.0313±0.0035 0.0296±0.0032 0.055c±0.0024 0.065c±0.002 <0.0001 0.1564
Hepatic TAG mg/g 37.13±9.114 41.27±9.188 326.25c±16.654 111.37b***±18.11 <0.0001 <0.0001
Blood glucose mg/dL 182.6±20.78 187.2±9.14 218±15.12 231.2±12.31 0.0128 0.5449
Plasma insulin ng/μL 1.39±0.11 1.96±0.3 11.27c±0.85 9.39c±1.68 <0.0001 0.45
Plasma ketones µM 232.3±42.17 215.4±30.85 348.71±22.787 215.41*±31.53 0.0886 0.0323
Plasma TAG mg/dL 52.78±7.716 57.18±7.479 35.8±3.672 40.83±4.21 0.0138 0.4479
Plasma NEFA mEq/L 1.17±0.05 1.1±0.08 0.53b±0.07 1.15**±0.2 0.0221 0.034
Plasma cholesterol mg/dL 117.71±12.99 104.57±9.2 212.86b±37.85 110.29**±8.35 0.0177 0.0078

Superscript letters indicate differences between 1 week and 18 weeks or LF- and HF-fed mice within group. aP < 0.05; bP < 0.01; cP < 0.0001. Asterisks indicate the differences between control and aLivPPARγkd mice. *P < 0.05; **P < 0.01; ***P < 0.0001. n = 4–6 mice/group.

After 14 weeks of LF or HF diet

To further explore if hepatic lipid accumulation induced by excess dietary fat intake is altered by aLivPPARγkd, we fed a HF- or a nutrient-matched LF control diet to aLivPPARγkd mice and their littermate controls. After 14 weeks of either LF or HF feeding (Fig. 2D) hepatic PPARγ mRNA/protein expression remained suppressed in aLivPPARγkd mice, compared to controls (Fig. 2E and F).

Consistent with previous reports (Inoue et al. 2005, Moran-Salvador et al. 2011, Yamazaki et al. 2011), HF feeding in control mice increased hepatic PPARγ expression, compared to those fed a LF diet (Fig. 2E and F). Also, in control mice, HF feeding increased body, liver and fat mass weight and elevated hepatic TAG content and plasma glucose, insulin and cholesterol levels, but plasma TAG and NEFA were reduced (Table 1). Although TAG and NEFA are reported to be elevated in HF-fed mice after an overnight fast, in the post-absorptive state (4-h fasted mice at 11:00 h), TAG and NEFA levels are reported to be reduced (Guo et al. 2009, Obrowsky et al. 2013, Cordoba-Chacon et al. 2014b, 2015b, Horakova et al. 2016), likely due to elevated insulin levels under these conditions.

aLivPPARγkd, in LF-fed mice, did not impact any of the metabolic endpoints examined (Table 1), including food intake (data not shown). However, HF-fed aLivPPARγkd mice showed reduced relative liver weight, and this was associated with a reduced hepatic TAG content (Table 1). Despite reduced hepatic TAG levels, there were no differences in post-absorptive blood glucose, plasma insulin and TAG levels in HF-fed aLivPPARγkd mice, compared to diet-matched controls (Table 1). However, normal glucose and insulin levels in the post-absorptive mouse may not be indicative of the whole-body glucose homeostasis, which requires dynamic evaluation by glucose and insulin tolerance tests. Of note, plasma ketones and cholesterol were reduced in HF-fed aLivPPARγkd mice, whereas plasma NEFAs were increased as compared to HF-fed control littermates (Table 1).

Association between aLivPPARγkd-mediated alterations in hepatic gene expression and metabolic endpoints

It has been previously reported that congenital liver-specific knockout of PPARγ alters the expression of a number of genes related to the regulation of hepatic TAG levels (Gavrilova et al. 2003, Matsusue et al. 2003, Moran-Salvador et al. 2011). However, from these studies, it is difficult to determine which changes may be due to the direct actions of hepatocyte PPARγ and which may be altered by secondary changes that occur overtime. Therefore, qPCR was used to screen changes in expression of key genes related to fatty acid oxidation, intrahepatic TAG hydrolysis, hepatic TAG export, DNL, hepatic lipid uptake and TAG synthesis, in liver samples from chow-fed (1 and 18 weeks after aLivPPARγkd, Fig. 3A) and LF- and HF-fed (14 weeks after aLivPPARγkd, Fig. 3B) mice. The data shown in Fig. 3 are expressed as fold-change in hepatic gene expression in aLivPPARγkd mice, compared to PPARγ-intact controls (set at 0), within age and diet, whereas Supplementary Table 1A and B (see section on supplementary data given at the end of this article) provides absolute values. There were small, but significant changes in the expression of a number of genes in aLivPPARγkd mice, compared to PPARγ-intact controls within specific groups. However, collective examination of this data set provides insight into which genes (pathways) are major targets of PPARγ, that could explain why aLivPPARγkd protects against hepatic fat accumulation.

Figure 3
Figure 3

Impact of aLivPPARγkd on hepatic gene expression of molecular mechanisms controlling hepatic TAG levels. (A) 1-week (top) and 18-week (bottom) chow-fed and (B) 14-week LF-fed (top) and HF-fed (bottom) aLivPPARγkd-induced regulation of hepatic gene expression. Graphs represent the natural logarithm of the relative change in the gene expression of aLivPPARγkd mice as compared to their littermates controls (set at 0, x-axis), within age (A) or diet (B). Absolute values are included in Supplementary Table 1A and B. Asterisks show significant changes between C and aLivPPARγkd within age (A) or diet (B). *P < 0.05; **P < 0.01; ***P < 0.0001. Livers were collected at 11:00 h (4 h after food removal). DNL, de novo lipogenesis; FAox, fatty acid oxidation; TAGhydr, TAG hydrolysis; VLDLsyn, VLDL synthesis; TAGsyn, TAG synthesis. Selected genes of these metabolic pathways represented in Fig. 3: peroxisome proliferator-activated receptor α (PPARα), acyl-CoA synthetase long-chain family member 1 (Acsl1), carnitine palmitoyltransferase 1α (Cpt1α), hepatic nuclear factor 4 α (Hnf4α), PPARγ co-activator 1 α (Pgc1α), Cyp4a10, adipose triglyceride lipase (Atgl), hormone-sensitive lipase (Hsl), monoacylglycerol lipase (Mgll), apolipoprotein B (ApoB), microsomal triglyceride transfer protein (Mttp), sterol response element-binding protein 1c (Srebp1c), acetyl-CoA carboxylase 1 (Acc1), fatty acid synthase (Fasn), fatty acid elongase (Elovl6), stearoyl–CoA desaturase 1 (Scd1), hepatic lipase (Hl), low-density lipoprotein lipase receptor (Ldlr), very-low-density lipoprotein receptor (Vldlr), lipoprotein-related protein 1 (Lrp1), fatty acid translocase (Cd36), glycerol phosphate acyltransferase (Gpat1), monoacylglycerol acyltransferase 1 or 2 (Mogat1/2), diacylglycerolacyltransferase 1/2 (Dgat1/2).

Citation: Journal of Endocrinology 232, 1; 10.1530/JOE-16-0447

De novo lipogenesis

Although experimental evidence suggests that hepatocyte PPARγ promotes liver fat accumulation by regulating the expression of genes important for DNL (Matsusue et al. 2003, 2014), aLivPPARγkd did not significantly reduce the expression of DNL genes (Srebp1c, Acc1, Fasn, Elovl6, Scd1) across age or diet. However, we could not exclude the fact aLivPPARγkd could indirectly mediate the activity of DNL enzymes, independent of changes in gene expression. Therefore, to estimate the impact of aLivPPARγkd on hepatic DNL, we used GC/MS to measure FA composition in livers of mice fed either a LF or HF diet. Supplementary Table 2 provides data for all FA detected, whereas Fig. 4A shows absolute levels of palmitic acid (16:0), palmitoleic acid (16:1(n-7)) and linoleic acid (18:2(n-6)). The absolute levels of these FAs were significantly reduced in HF-fed aLivPPARγkd mice as compared to HF-fed controls, consistent with the reduction in hepatic TAG content. Specific ratios of these FA (Fig. 4B) have been shown to be indicative of DNL (SCD-1 index 16:1/16:0) and DNL index, 16:0/18:2 (Sevastianova et al. 2012, Silbernagel et al. 2012, Lee et al. 2015, Kineman et al. 2016). As previously reported, HF diet reduces the rate of DNL (Duarte et al. 2014) and expression of DNL proteins (Benard et al. 2016), as reflected by significant reduction in both the SCD-1 and DNL index, as well as the reduction in DNL gene expression (Acc1, Fasn, Elovl6 and Scd1; Supplementary Table 1B). Independent of diet, loss of hepatocyte PPARγ did not influence these indices (Fig. 4B). Taken together, these results suggest that hepatic PPARγ plays a minimal role in directly regulating hepatic DNL.

Figure 4
Figure 4

aLivPPARγkd reduces HF diet-induced FA levels, but has little impact on FA indices of DNL. (A) Hepatic FA levels of 16:0, palmitate; 16:1, palmitoleate; and 18:2, linoleate levels and (B) hepatic FA ratios indicative of DNL include the SCD index (16:1/16:0) and the DNL index (16:0/18:2), where control (open columns, C) and aLivPPARγkd (closed columns, Kd) mice were fed a LF or a HF diet for 14 weeks. Asterisks indicate differences between C and Kd. ***P < 0.0001. Letters indicate differences between LF- and HF-fed mice within group. aP < 0.05; cP < 0.0001. n = 4–6 mice/group.

Citation: Journal of Endocrinology 232, 1; 10.1530/JOE-16-0447

Hepatic TAG export, FA oxidation and lipid uptake

A reduction in hepatic fat content observed in aLivPPARγkd mice could be due to an increased rate of hepatic VLDL production or a decreased rate of TAG lipoprotein clearance. However, examination of genes critical for these processes were not consistently altered by aLivPPARγkd (Fig. 3) and circulating TAG in aLivPPARγkd did not differ from PPARγ-intact controls, within age and diet group (Table 1). It could also be possible that the reduced TAG content observed in livers of aLivPPARγkd mice is due to an increase in intrahepatic TAG hydrolysis and FA oxidation. However, the fact that the expressions of Atgl, Hsl, Mgll, PPARα, Acsl1, Cpt1α, Hnf4α, Pgc1α and Cyp4a10 were not increased across groups (Fig. 3), whereas HF-aLivPPARγkd mice exhibited a decrease in plasma ketones (Table 1), suggests that hepatic FA oxidation is actually reduced. It is possible that this reduction in FA oxidation/ketogenesis is secondary to a reduction in intrahepatic FA availability due to a reduction in FA uptake as aLivPPARγkd reduced the expression of hepatic Cd36 (FA translocase), where this was associated with an increase in circulating NEFA in HF-fed mice (Table 1). In fact, Cd36 has been previously shown to be a PPARγ target gene (Tontonoz et al. 1998). However, it should be noted that a significant reduction in Cd36 was not observed in aLivPPARγkd after 1 week of knockdown, or in LF-fed mice, suggesting that under these conditions, the low level of PPARγ is not sufficient to maintain Cd36 expression or that the full expression requires additional factors that are activated with age or diet, such as LXR and PXR (Zhou et al. 2008).

TAG synthesis

TAG, DAG and MAG are generated by esterification of newly synthetized FA or extrahepatic FA into acylglycerol backbones, as illustrated in Fig. 5A. In the liver, it is thought that the primary source of TAG is via the glycerol-3-phosphate (G3P) pathway, that generates DAG (Coleman & Mashek 2011, Mashek 2013), which serves as a substrate of DAG transferases 1 and 2 (Dgat1/2). However, it is becoming evident that the MAG pathway (i.e. generation of DAG from MAG via MAG transferases 1 and 2 (Mogat1/2 in mice)), may be a relevant pathway in NAFLD (Hall et al. 2012, Mashek 2013). Examination of the expression of the key genes involved in TAG synthesis revealed that there was an overall inhibitory effect of aLivPPARγkd on the expression of Mogat1 (Supplementary Table 1) that reached significance with age and HF feeding (Fig. 3B), without a reduction in Gpat, Mogat2, Dgat1 or Dgat2 expression (Fig. 3B). Of note, Mogat1 has been reported to be a direct target of PPARγ (Lee et al. 2012, Yu et al. 2015) and in fact, expression of Mogat1 increases with age and HF feeding, P value: 0.0063 and <0.0001, respectively, (Supplementary Table 1A and B), mirroring the relative changes observed in hepatic PPARγ expression (Fig. 2). To indirectly test if the reduction in Mogat1 gene expression translated into a reduction in MAG pathway activity, we used LC/MS to measure the relative levels of MAG, DAG and TAG in LF- and HF-fed mice with or without hepatic PPARγ. Overall, aLivPPARγkd increased MAG levels, which reached significance in LF-fed mice. In HF-fed aLivPPARγkd mice, this was associated with a decrease in DAG and TAG (Fig. 5B). Interestingly, in LF-fed aLivPPARγkd, the relative levels of DAG and TAG were not altered. Taken together, loss of hepatocyte PPARγ signaling preferentially reduces the esterification of FA by direct transcriptional regulation of the MAG pathway, where loss of this effect could contribute to the protection against excess TAG accumulation observed in aLivPPARγkd mice.

Figure 5
Figure 5

aLivPPARγkd reduces HF diet-induced hepatic TAG and DAG levels, whereas increasing MAG levels, independent of diet, indicative of impaired hepatic MAG pathway activity in aLivPPARγkd mice. (A) Schematic representation of acylglycerol synthesis by glycerol-3-phosphate (G3P) pathway that produces DAG by subsequent re-esterification of FA in G3P and lysophosphatidic acid (LPA) or by monoacylglycerol (MAG) pathway that produces DAG after re-esterification of FA in MAG. (B) Relative hepatic TAG, DAG and MAG levels assessed by liquid chromatography/mass spectrometry (LC/MS) in control (open columns) and aLivPPARγkd (close columns) mice. TAG, DAG and MAG are shown as relative values of LF-fed controls. Asterisks indicate differences between control and aLivPPARγkd. ***P < 0.0001. Letters indicate differences between LF- and HF-fed mice within group. bP < 0.01; cP < 0.0001. n = 5–6 mice/group.

Citation: Journal of Endocrinology 232, 1; 10.1530/JOE-16-0447

Discussion

Hepatocyte PPARγ has been defined as a steatogenic factor (Rahimian et al. 2001, Gavrilova et al. 2003, Matsusue et al. 2003, Inoue et al. 2005, Moran-Salvador et al. 2011, Pettinelli & Videla 2011), whereas others suggest that its activation decreases hepatic steatosis (Belfort et al. 2006, Ratziu et al. 2008, Sanyal et al. 2010). The fact that PPARγ is the target of TZDs that are used in the treatment of diabetes and NAFLD raises the question if the hepatic-specific agonism of PPARγ is well understood (Ahmadian et al. 2013). Therefore, we sought to determine which molecular processes are the primary targets for hepatocyte PPARγ that promotes TAG accumulation. We have taken advantage of the novel adult-onset, hepatocyte-specific PPARγ knockdown (aLivPPARγkd) model that allowed us to study the early events altered by aLivPPARγkd (1 week of knockdown), and how this deficit influences liver function overtime under different dietary conditions. Our approach has benefits over existing congenital knockout models because it avoids compensatory changes that could occur with embryonic knockout and therefore better models the consequence of manipulating PPARγ function in adults, where NAFLD/NASH typically develops. As discussed in detail below, our primary findings are that hepatic PPARγ has minimal direct effects on hepatic DNL, TAG uptake, TAG export or FA oxidation, but plays a major role in upregulating genes/pathways critical for hepatic FA uptake- and MAG pathway-mediated FA esterification.

Congenital hepatocyte-specific PPARγ knockout has been reported to be associated with a reduction of hepatic expression of genes critical for DNL (Gavrilova et al. 2003, Matsusue et al. 2003, Yu et al. 2003, Moran-Salvador et al. 2011). Also, use of antisense oligonucleotide strategy to suppress elevated hepatic PPARγ in apoB/BATless mice, reduced hepatic TAG accumulation, as well as the expression of DNL genes and DNL rate as assessed by 3H2O incorporation into TAG-associated FA (Zhang et al. 2006). In addition, overexpression of PPARγ in a hepatic cell line (AML-12; Schadinger et al. 2005) was shown to increase SREBP1c and Fasn expression that was associated with an increase in 14C-acetate incorporation into TAG. Finally, overexpression of PPARγ in some (Yu et al. 2003), but not all (Bai et al. 2011) in vivo models, increased the expression of genes associated with DNL. In contrast to these reports, in the aLivPPARγkd model system, expression of DNL genes were not suppressed in any conditions tested, consistent with the lack of an effect on DNL indices (16:1/16:0 and 16:0/18:2). In fact, we have recently reported that although PPARγ expression was associated with TAG accumulation in a model of DNL-generated steatosis (Kineman et al. 2016), adult-onset hepatic PPARγ knockdown in this steatotic model did not reduce hepatic TAG content or FA indices of DNL (Cordoba-Chacon et al. 2015a). The question arises, why are our current results counter to that previously reported by others? We might speculate that any changes observed in the expression of DNL genes in congenital liver-specific PPARγ-knockout models could be secondary to changes that occur due to compensation during development or systemic metabolic changes that occur overtime. Also, the use of antisense oligonucleotides (ASO) to acutely suppress enhanced PPARγ expression in vivo (Zhang et al. 2006) is not a hepatocyte-specific approach, and therefore, a reduction in PPARγ in other cell types could contribute to the phenotype observed. Finally in vivo (Zhang et al. 2006) or in vitro (Schadinger et al. 2005) overexpression of PPARγ may have off-target effects. Therefore, we can conclude that in the context of adult metabolic function, loss of hepatic PPARγ does not directly control hepatic DNL.

Early work by Gavrilova and coworkers and Matsusue and coworkers who crossbred the congenital liver-specific PPARγ model with a lipodystrophic model (AZIP; Gavrilova et al. 2003), and ob/ob mice (Matsusue et al. 2003), respectively, observed a reduction in hepatic TAG content associated with elevated plasma TAG and thus concluded that hepatic PPARγ was critical to maintain hepatic TAG uptake. However, in chow-fed WT mice (Matsusue et al. 2003, Moran-Salvador et al. 2011) and HF-fed (Moran-Salvador et al. 2011) mice with congenital liver-specific PPARγ knockout, as well as in our HF-fed aLivPPARγkd model, circulating TAG did not differ from PPARγ-intact controls, despite the dramatic reduction in hepatic TAG content. Also, there were no decreases in the expression of genes known to be critical in hepatic TAG uptake in mouse livers, including low-density lipoprotein receptor (Ldlr; Ishibashi et al. 1994, Havel & Hamilton 2004) and hepatic lipase (HL; Havel & Hamilton 2004, Freeman et al. 2007). However, it should be noted that the expression of very low-density lipoprotein receptor (Vldr), a known PPARγ target in adipocytes (Tao et al. 2010), was significantly reduced in HF-fed aLivPPARγkd mice. The expression of hepatic Vldlr is normally low, but is increased in mouse models of fatty liver (also observed with HF feeding in this study, see Supplementary Table 1), and whole-body knockout of Vldlr reduces ER stress and HF diet-induced hepatic steatosis (Jo et al. 2013). However, a liver-specific role of Vldlr in hepatic TAG uptake remains to be determined. Although the role of PPARγ in regulating hepatic TAG uptake remains to be further explored, our current results coupled with previous reports, do provide compelling evidence that hepatic PPARγ promotes hepatic FA uptake by regulating the expression of Cd36. Specifically, in both aged and HF-fed aLivPPARγkd mice, expression of Cd36 was reduced. Cd36 has been shown to be a direct target of PPARγ (Tontonoz et al. 1998) and its expression is increased in steatotic livers. In the current study, a reduction in Cd36 levels in aLivPPARγkd mice was only observed with age or HF feeding, consistent with the fact that in addition to PPARγ, LXR and PXR are also required for the full expression of Cd36 (Zhou et al. 2008). Although global Cd36 knockout does not protect against high fructose-induced hepatic steatosis (Hajri et al. 2002) or prevent fatty liver in ob/ob mice (Nassir et al. 2013), a more recent report supports a liver-specific role of Cd36 in FA uptake. Specifically, congenital liver-specific Cd36 knockout reduced steatosis in liver-specific Jak2 knockout mice that led to an increase in plasma NEFA (Wilson et al. 2015). Also in that same study, liver-specific Cd36-knockout mice with intact hepatic Jak2, dramatically reduced HF diet-induced steatosis that was associated with a reduction in hepatic FA uptake as measured by hepatic accumulation of BODIPY-FA in vivo (Wilson et al. 2015). However, loss of hepatic Cd36 did not entirely prevent hepatic FA uptake, which could be mediated by other facilitated transport mechanisms or passive diffusion (Glatz et al. 2010), indicating the reduction in CD36 after aLivPPARγkd is only in part responsible for the reduction in hepatic TAG content.

Of the selected genes examined in this study, the expression of Mogat1 was the most sensitive to PPARγ loss. As previously reported, the expression of Mogat1 in the lean mouse liver is low, but increases in association with TAG accumulation, similar to that observed for PPARγ (Lee et al. 2012, Hall et al. 2014, Soufi et al. 2014, Yu et al. 2016), as we also observed in the current study. In addition, hepatic expression of Mogat1, as well as PPARγ, is elevated in humans with NAFLD (Hall et al. 2012, Yu et al. 2015). There is an ongoing debate regarding the physiologic role hepatic Mogat1 plays in TAG synthesis as it was originally thought that the glycerol-3-phosphate pathway, not the MAG pathway, is the dominant route to form TAG in the liver (Coleman & Mashek 2011, Mashek 2013). In fact, one laboratory could not detect hepatic MOGAT activity (Cortes et al. 2009) and recently reported that global Mogat1 knockout in the ob/ob or Agpat2KO mice did not impact steatosis (Agarwal et al. 2016). However, hepatic MOGAT activity has been detected by other laboratories (Yen et al. 2002, Hall et al. 2012). Importantly, the increase in Mogat1 expression observed in HF-fed and ob/ob mice is associated with an elevation of hepatic MOGAT activity, which is reduced by Mogat1 ASO ip treatment (Hall et al. 2014, Soufi et al. 2014). The Mogat1-ASO injections reduced hepatic TAG accumulation in one study (Soufi et al. 2014), but not the other (Hall et al. 2014). However, it was acknowledged that the knockdown of Mogat1 was not hepatocyte specific, and actually led to a reduction in Mogat1 expression in the adipose tissue that could offset any hepatocyte-specific effect (Soufi et al. 2014). In strong support of a physiologic role of hepatic Mogat1 in maintaining hepatic TAG levels, adenoviral shRNA-Mogat1 delivery (that is preferentially taken up by the liver) (Lee et al. 2012), and nonviral siRNA-Mogat1 delivery (Hayashi et al. 2014), reduced Mogat1 expression and hepatic TAG levels in HF-fed mice. The results of the present study indicate that PPARγ is necessary to maintain Mogat1 activity, as well as Mogat1 expression, based on the increase in hepatic MAG levels in aLivPPARγkd mice. Interestingly, it has been postulated that Mogat1 may prefer extrahepatic (dietary FA) over those produced by hepatic DNL, to synthesize DAG (Steneberg et al. 2015). This would be consistent with our observation that although MAG levels were increased in LF-fed aLivPPARγkd mice, DAG and TAG levels were normal, where in this context, hepatic DAG and TAG are mainly derived from DNL. However, in HF-fed aLivPPARγkd mice (where the bulk of FA is coming from the diet), a reduction in DAG and TAG levels was observed.

Taken together, results suggest that hepatocyte PPARγ expression in adult livers is not essential to maintain the expression of DNL genes, but it is essential to induce the expression of genes important in hepatic FA uptake (Cd36) and re-esterification (Mogat1). Certainly, other pathways may be mediated by hepatic PPARγ that were not revealed by our targeted approach. Nonetheless, our current data, coupled with previous reports suggest that impairment of the Cd36-mediated FA uptake and FA esterification by MAG pathway could explain in part the protection against steatosis observed in aLivPPARγkd mice.

Supplementary data

This is linked to the online version of the paper at http://dx.doi.org/10.1530/JOE-16-0447.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by Department of Veterans Affairs, Office of Research and Development Merit Award (BX001090, BX001114), National Institutes of Health (R21Abib8457, S10OD010660, R01DK088133), Chicago Biomedical Consortium with support from the Searle Funds at The Chicago Community Trust (PDR-033), Pilot Grant through UIC CCTS (NIH-UL1TR000050), West Side Institute for Science and Education (WISE), and 2014 Endocrine Scholar Award in Growth Hormone Research (Endocrine Society).

References

  • Agarwal AK, Tunison K, Dalal JS, Yen CL, Farese RV Jr, Horton JD & Garg A 2016 Mogat1 deletion does not ameliorate hepatic steatosis in lipodystrophic (Agpat2−/−) or obese (ob/ob) mice. Journal of Lipid Research 57 616630. (doi:10.1194/jlr.M065896)

    • Search Google Scholar
    • Export Citation
  • Ahmadian M, Suh JM, Hah N, Liddle C, Atkins AR, Downes M & Evans RM 2013 PPARgamma signaling and metabolism: the good, the bad and the future. Nature Medicine 19 557566. (doi:10.1038/nm.3159)

    • Search Google Scholar
    • Export Citation
  • Ashpole NM, Herron JC, Mitschelen MC, Farley JA, Logan S, Yan H, Ungvari Z, Hodges EL, Csiszar A & Ikeno Y et al. 2016 IGF-1 regulates vertebral bone aging through sex-specific and time-dependent mechanisms. Journal of Bone and Mineral Research 31 443454. (doi:10.1002/jbmr.2689)

    • Search Google Scholar
    • Export Citation
  • Bai L, Jia Y, Viswakarma N, Huang J, Vluggens A, Wolins NE, Jafari N, Rao MS, Borensztajn J & Yang G et al. 2011 Transcription coactivator mediator subunit MED1 is required for the development of fatty liver in the mouse. Hepatology 53 11641174. (doi:10.1002/hep.24155)

    • Search Google Scholar
    • Export Citation
  • Belfort R, Harrison SA, Brown K, Darland C, Finch J, Hardies J, Balas B, Gastaldelli A, Tio F & Pulcini J et al. 2006 A placebo-controlled trial of pioglitazone in subjects with nonalcoholic steatohepatitis. New England Journal of Medicine 355 22972307. (doi:10.1056/NEJMoa060326)

    • Search Google Scholar
    • Export Citation
  • Benard O, Lim J, Apontes P, Jing X, Angeletti RH & Chi Y 2016 Impact of high-fat diet on the proteome of mouse liver. Journal of Nutritional Biochemistry 31 1019. (doi:10.1016/j.jnutbio.2015.12.012)

    • Search Google Scholar
    • Export Citation
  • Beysen C, Murphy EJ, Nagaraja H, Decaris M, Riiff T, Fong A, Hellerstein MK & Boyle PJ 2008 A pilot study of the effects of pioglitazone and rosiglitazone on de novo lipogenesis in type 2 diabetes. Journal of Lipid Research 49 26572663. (doi:10.1194/jlr.M800165-JLR200)

    • Search Google Scholar
    • Export Citation
  • Bligh EG & Dyer WJ 1959 A rapid method of total lipid extraction and purification. Canadian Journal of Biochemistry and Physiology 37 911917. (doi:10.1139/o59-099)

    • Search Google Scholar
    • Export Citation
  • Browning JD & Horton JD 2004 Molecular mediators of hepatic steatosis and liver injury. Journal of Clinical Investigation 114 147152. (doi:10.1172/JCI200422422)

    • Search Google Scholar
    • Export Citation
  • Coleman RA & Mashek DG 2011 Mammalian triacylglycerol metabolism: synthesis, lipolysis, and signaling. Chemical Reviews 111 63596386. (doi:10.1021/cr100404w)

    • Search Google Scholar
    • Export Citation
  • Cordoba-Chacon J, Gahete MD, McGuinness OP & Kineman RD 2014a Differential impact of selective GH deficiency and endogenous GH excess on insulin-mediated actions in muscle and liver of male mice. American Journal of Physiology: Endocrinology and Metabolism 307 E928E934. (doi:10.1152/ajpendo.00420.2014)

    • Search Google Scholar
    • Export Citation
  • Cordoba-Chacon J, Gahete MD, Pokala NK, Geldermann D, Alba M, Salvatori R, Luque RM & Kineman RD 2014b Long- but not short-term adult-onset, isolated GH deficiency in male mice leads to deterioration of beta-cell function, which cannot be accounted for by changes in beta-cell mass. Endocrinology 155 726735. (doi:10.1210/en.2013-1825)

    • Search Google Scholar
    • Export Citation
  • Cordoba-Chacon J, Majumdar N, List EO, Diaz-Ruiz A, Frank SJ, Manzano A, Bartrons R, Puchowicz M, Kopchick JJ & Kineman RD 2015a Growth hormone inhibits hepatic de novo lipogenesis in adult mice. Diabetes 64 30933103. (doi:10.2337/db15-0370)

    • Search Google Scholar
    • Export Citation
  • Cordoba-Chacon J, Majumdar N, Pokala NK, Gahete MD & Kineman RD 2015b Islet insulin content and release are increased in male mice with elevated endogenous GH and IGF-I, without evidence of systemic insulin resistance or alterations in beta-cell mass. Growth Hormone and IGF Research 25 189195. (doi:10.1016/j.ghir.2015.04.002)

    • Search Google Scholar
    • Export Citation
  • Cortes VA, Curtis DE, Sukumaran S, Shao X, Parameswara V, Rashid S, Smith AR, Ren J, Esser V & Hammer RE et al. 2009 Molecular mechanisms of hepatic steatosis and insulin resistance in the AGPAT2-deficient mouse model of congenital generalized lipodystrophy. Cell Metabolism 9 165176. (doi:10.1016/j.cmet.2009.01.002)

    • Search Google Scholar
    • Export Citation
  • Duarte JA, Carvalho F, Pearson M, Horton JD, Browning JD, Jones JG & Burgess SC 2014 A high-fat diet suppresses de novo lipogenesis and desaturation but not elongation and triglyceride synthesis in mice. Journal of Lipid Research 55 25412553. (doi:10.1194/jlr.M052308)

    • Search Google Scholar
    • Export Citation
  • Freeman L, Amar MJ, Shamburek R, Paigen B, Brewer HB Jr, Santamarina-Fojo S & Gonzalez-Navarro H 2007 Lipolytic and ligand-binding functions of hepatic lipase protect against atherosclerosis in LDL receptor-deficient mice. Journal of Lipid Research 48 104113. (doi:10.1194/jlr.M600321-JLR200)

    • Search Google Scholar
    • Export Citation
  • Furnsinn C & Waldhausl W 2002 Thiazolidinediones: metabolic actions in vitro. Diabetologia 45 12111223. (doi:10.1007/s00125-002-0899-1)

    • Search Google Scholar
    • Export Citation
  • Gavrilova O, Haluzik M, Matsusue K, Cutson JJ, Johnson L, Dietz KR, Nicol CJ, Vinson C, Gonzalez FJ & Reitman ML 2003 Liver peroxisome proliferator-activated receptor gamma contributes to hepatic steatosis, triglyceride clearance, and regulation of body fat mass. Journal of Biological Chemistry 278 3426834276. (doi:10.1074/jbc.M300043200)

    • Search Google Scholar
    • Export Citation
  • Glatz JF, Luiken JJ & Bonen A 2010 Membrane fatty acid transporters as regulators of lipid metabolism: implications for metabolic disease. Physiological Reviews 90 367417. (doi:10.1152/physrev.00003.2009)

    • Search Google Scholar
    • Export Citation
  • Guo J, Jou W, Gavrilova O & Hall KD 2009 Persistent diet-induced obesity in male C57BL/6 mice resulting from temporary obesigenic diets. PLoS ONE 4 e5370. (doi:10.1371/journal.pone.0005370)

    • Search Google Scholar
    • Export Citation
  • Gupte AA, Liu JZ, Ren Y, Minze LJ, Wiles JR, Collins AR, Lyon CJ, Pratico D, Finegold MJ & Wong ST et al. 2010 Rosiglitazone attenuates age- and diet-associated nonalcoholic steatohepatitis in male low-density lipoprotein receptor knockout mice. Hepatology 52 20012011. (doi:10.1002/hep.23941)

    • Search Google Scholar
    • Export Citation
  • Hajri T, Han XX, Bonen A & Abumrad NA 2002 Defective fatty acid uptake modulates insulin responsiveness and metabolic responses to diet in CD36-null mice. Journal of Clinical Investigation 109 13811389. (doi:10.1172/Jbib214596)

    • Search Google Scholar
    • Export Citation
  • Hall AM, Kou K, Chen Z, Pietka TA, Kumar M, Korenblat KM, Lee K, Ahn K, Fabbrini E & Klein S et al. 2012 Evidence for regulated monoacylglycerol acyltransferase expression and activity in human liver. Journal of Lipid Research 53 990999. (doi:10.1194/jlr.P025536)

    • Search Google Scholar
    • Export Citation
  • Hall AM, Soufi N, Chambers KT, Chen Z, Schweitzer GG, McCommis KS, Erion DM, Graham MJ, Su X & Finck BN 2014 Abrogating monoacylglycerol acyltransferase activity in liver improves glucose tolerance and hepatic insulin signaling in obese mice. Diabetes 63 22842296. (doi:10.2337/db13-1502)

    • Search Google Scholar
    • Export Citation
  • Havel RJ & Hamilton RL 2004 Hepatic catabolism of remnant lipoproteins: where the action is. Arteriosclerosis Thrombosis and Vascular Biology 24 213215. (doi:10.1161/01.ATV.0000115382.53810.24)

    • Search Google Scholar
    • Export Citation
  • Hayashi Y, Suemitsu E, Kajimoto K, Sato Y, Akhter A, Sakurai Y, Hatakeyama H, Hyodo M, Kaji N & Baba Y et al. 2014 Hepatic monoacylglycerol O-acyltransferase 1 as a promising therapeutic target for steatosis, obesity, and type 2 diabetes. Molecular Therapy: Nucleic Acids 3 e154. (doi:10.1038/mtna.2014.4)

    • Search Google Scholar
    • Export Citation
  • He W, Barak Y, Hevener A, Olson P, Liao D, Le J, Nelson M, Ong E, Olefsky JM & Evans RM 2003 Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle. PNAS 100 1571215717. (doi:10.1073/pnas.2536828100)

    • Search Google Scholar
    • Export Citation
  • Horakova O, Hansikova J, Bardova K, Gardlo A, Rombaldova M, Kuda O, Rossmeisl M & Kopecky J 2016 Plasma acylcarnitines and amino acid levels as an early complex biomarker of propensity to high-fat diet-induced obesity in mice. PLoS ONE 11 e0155776. (doi:10.1371/journal.pone.0155776)

    • Search Google Scholar
    • Export Citation
  • Inoue M, Ohtake T, Motomura W, Takahashi N, Hosoki Y, Miyoshi S, Suzuki Y, Saito H, Kohgo Y & Okumura T 2005 Increased expression of PPARgamma in high fat diet-induced liver steatosis in mice. Biochemical and Biophysical Research Communications 336 215222. (doi:10.1016/j.bbrc.2005.08.070)

    • Search Google Scholar
    • Export Citation
  • Ishibashi S, Herz J, Maeda N, Goldstein JL & Brown MS 1994 The two-receptor model of lipoprotein clearance: tests of the hypothesis in ‘knockout’ mice lacking the low density lipoprotein receptor, apolipoprotein E, or both proteins. PNAS 91 44314435. (doi:10.1073/pnas.91.10.4431)

    • Search Google Scholar
    • Export Citation
  • Jo H, Choe SS, Shin KC, Jang H, Lee JH, Seong JK, Back SH & Kim JB 2013 Endoplasmic reticulum stress induces hepatic steatosis via increased expression of the hepatic very low-density lipoprotein receptor. Hepatology 57 13661377. (doi:10.1002/hep.26126)

    • Search Google Scholar
    • Export Citation
  • Kineman R, Majumdar N, Subbaiah PV & Cordoba-Chacon J 2016 Hepatic PPARγ is not essential for the rapid development of steatosis following loss of hepatic GH signaling, in adult male mice. Endocrinology 157 17281735. (doi:10.1210/en.2015-2077)

    • Search Google Scholar
    • Export Citation
  • Lade A, Noon LA & Friedman SL 2014 Contributions of metabolic dysregulation and inflammation to nonalcoholic steatohepatitis, hepatic fibrosis, and cancer. Current Opinion in Oncology 26 100107. (doi:10.1097/CCO.0000000000000042)

    • Search Google Scholar
    • Export Citation
  • Lee YJ, Ko EH, Kim JE, Kim E, Lee H, Choi H, Yu JH, Kim HJ, Seong JK & Kim KS et al. 2012 Nuclear receptor PPARgamma-regulated monoacylglycerol O-acyltransferase 1 (MGAT1) expression is responsible for the lipid accumulation in diet-induced hepatic steatosis. PNAS 109 1365613661. (doi:10.1073/pnas.1203218109)

    • Search Google Scholar
    • Export Citation
  • Lee JJ, Lambert JE, Hovhannisyan Y, Ramos-Roman MA, Trombold JR, Wagner DA & Parks EJ 2015 Palmitoleic acid is elevated in fatty liver disease and reflects hepatic lipogenesis. American Journal of Clinical Nutrition 101 3443. (doi:10.3945/ajcn.114.092262)

    • Search Google Scholar
    • Export Citation
  • Mashek DG 2013 Hepatic fatty acid trafficking: multiple forks in the road. Advances in Nutrition 4 697710. (doi:10.3945/an.113.004648)

    • Search Google Scholar
    • Export Citation
  • Matsusue K, Haluzik M, Lambert G, Yim SH, Gavrilova O, Ward JM, Brewer B Jr, Reitman ML & Gonzalez FJ 2003 Liver-specific disruption of PPARgamma in leptin-deficient mice improves fatty liver but aggravates diabetic phenotypes. Journal of Clinical Investigation 111 737747. (doi:10.1172/JCI200317223)

    • Search Google Scholar
    • Export Citation
  • Matsusue K, Aibara D, Hayafuchi R, Matsuo K, Takiguchi S, Gonzalez FJ & Yamano S 2014 Hepatic PPARgamma and LXRalpha independently regulate lipid accumulation in the livers of genetically obese mice. FEBS Letters 588 22772281. (doi:10.1016/j.febslet.2014.05.012)

    • Search Google Scholar
    • Export Citation
  • Michelotti GA, Machado MV & Diehl AM 2013 NAFLD, NASH and liver cancer. Nature Reviews Gastroenterology and Hepatology 10 656665. (doi:10.1038/nrgastro.2013.183)

    • Search Google Scholar
    • Export Citation
  • Moran-Salvador E, Lopez-Parra M, Garcia-Alonso V, Titos E, Martinez-Clemente M, Gonzalez-Periz A, Lopez-Vicario C, Barak Y, Arroyo V & Claria J 2011 Role for PPARgamma in obesity-induced hepatic steatosis as determined by hepatocyte- and macrophage-specific conditional knockouts. FASEB Journal 25 25382550. (doi:10.1096/fj.10-173716)

    • Search Google Scholar
    • Export Citation
  • Nan YM, Fu N, Wu WJ, Liang BL, Wang RQ, Zhao SX, Zhao JM & Yu J 2009 Rosiglitazone prevents nutritional fibrosis and steatohepatitis in mice. Scandinavian Journal of Gastroenterology 44 358365. (doi:10.1080/00365520802530861)

    • Search Google Scholar
    • Export Citation
  • Nassir F, Adewole OL, Brunt EM & Abumrad NA 2013 CD36 deletion reduces VLDL secretion, modulates liver prostaglandins, and exacerbates hepatic steatosis in ob/ob mice. Journal of Lipid Research 54 29882997. (doi:10.1194/jlr.M037812)

    • Search Google Scholar
    • Export Citation
  • Obrowsky S, Chandak PG, Patankar JV, Povoden S, Schlager S, Kershaw EE, Bogner-Strauss JG, Hoefler G, Levak-Frank S & Kratky D 2013 Adipose triglyceride lipase is a TG hydrolase of the small intestine and regulates intestinal PPARalpha signaling. Journal of Lipid Research 54 425435. (doi:10.1194/jlr.M031716)

    • Search Google Scholar
    • Export Citation
  • Pettinelli P & Videla LA 2011 Up-regulation of PPAR-gamma mRNA expression in the liver of obese patients: an additional reinforcing lipogenic mechanism to SREBP-1c induction. Journal of Clinical Endocrinology and Metabolism 96 14241430. (doi:10.1210/jc.2010-2129)

    • Search Google Scholar
    • Export Citation
  • Rahimian R, Masih-Khan E, Lo M, van Breemen C, McManus BM & Dube GP 2001 Hepatic over-expression of peroxisome proliferator activated receptor gamma2 in the ob/ob mouse model of non-insulin dependent diabetes mellitus. Molecular and Cellular Biochemistry 224 2937. (doi:10.1023/A:1011927113563)

    • Search Google Scholar
    • Export Citation
  • Ratziu V, Giral P, Jacqueminet S, Charlotte F, Hartemann-Heurtier A, Serfaty L, Podevin P, Lacorte JM, Bernhardt C & Bruckert E et al. 2008 Rosiglitazone for nonalcoholic steatohepatitis: one-year results of the randomized placebo-controlled Fatty Liver Improvement with Rosiglitazone Therapy (FLIRT) Trial. Gastroenterology 135 100110. (doi:10.1053/j.gastro.2008.03.078)

    • Search Google Scholar
    • Export Citation
  • Sanyal AJ, Chalasani N, Kowdley KV, McCullough A, Diehl AM, Bass NM, Neuschwander-Tetri BA, Lavine JE, Tonascia J & Unalp A et al. 2010 Pioglitazone, vitamin E, or placebo for nonalcoholic steatohepatitis. New England Journal of Medicine 362 16751685. (doi:10.1056/NEJMoa0907929)

    • Search Google Scholar
    • Export Citation
  • Schadinger SE, Bucher NL, Schreiber BM & Farmer SR 2005 PPARgamma2 regulates lipogenesis and lipid accumulation in steatotic hepatocytes. American Journal of Physiology: Endocrinology and Metabolism 288 E1195E1205. (doi:10.1152/ajpendo.00513.2004)

    • Search Google Scholar
    • Export Citation
  • Sevastianova K, Santos A, Kotronen A, Hakkarainen A, Makkonen J, Silander K, Peltonen M, Romeo S, Lundbom J & Lundbom N et al. 2012 Effect of short-term carbohydrate overfeeding and long-term weight loss on liver fat in overweight humans. American Journal of Clinical Nutrition 96 727734. (doi:10.3945/ajcn.112.038695)

    • Search Google Scholar
    • Export Citation
  • Shin S, Wangensteen KJ, Teta-Bissett M, Wang YJ, Mosleh-Shirazi E, Buza EL, Greenbaum LE & Kaestner KH 2016 Genetic lineage tracing analysis of the cell of origin of hepatotoxin-induced liver tumors in mice. Hepatology 64 11631177. (doi:10.1002/hep.28602)

    • Search Google Scholar
    • Export Citation
  • Silbernagel G, Kovarova M, Cegan A, Machann J, Schick F, Lehmann R, Haring HU, Stefan N, Schleicher E & Fritsche A et al. 2012 High hepatic SCD1 activity is associated with low liver fat content in healthy subjects under a lipogenic diet. Journal of Clinical Endocrinology and Metabolism 97 E2288E2292. (doi:10.1210/jc.2012-2152)

    • Search Google Scholar
    • Export Citation
  • Soufi N, Hall AM, Chen Z, Yoshino J, Collier SL, Mathews JC, Brunt EM, Albert CJ, Graham MJ & Ford DA et al. 2014 Inhibiting monoacylglycerol acyltransferase 1 ameliorates hepatic metabolic abnormalities but not inflammation and injury in mice. Journal of Biological Chemistry 289 3017730188. (doi:10.1074/jbc.M114.595850)

    • Search Google Scholar
    • Export Citation
  • Steneberg P, Sykaras AG, Backlund F, Straseviciene J, Soderstrom I & Edlund H 2015 Hyperinsulinemia enhances hepatic expression of the fatty acid transporter Cd36 and provokes hepatosteatosis and hepatic insulin resistance. Journal of Biological Chemistry 290 1903419043. (doi:10.1074/jbc.M115.640292)

    • Search Google Scholar
    • Export Citation
  • Tao H, Aakula S, Abumrad NN & Hajri T 2010 Peroxisome proliferator-activated receptor-gamma regulates the expression and function of very-low-density lipoprotein receptor. American Journal of Physiology: Endocrinology and Metabolism 298 E68E79. (doi:10.1152/ajpendo.00367.2009)

    • Search Google Scholar
    • Export Citation
  • Tontonoz P, Nagy L, Alvarez JG, Thomazy VA & Evans RM 1998 PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93 241252. (doi:10.1016/S0092-8674(00)81575-5)

    • Search Google Scholar
    • Export Citation
  • Wilson CG, Tran JL, Erion DM, Vera NB, Febbraio M & Weiss EJ 2015 Hepatocyte-specific disruption of CD36 attenuates fatty liver and improves insulin sensitivity in HFD fed mice. Endocrinology 157 570585. (doi:10.1210/en.2015-1866)

    • Search Google Scholar
    • Export Citation
  • Xu A, Wang Y, Keshaw H, Xu LY, Lam KS & Cooper GJ 2003 The fat-derived hormone adiponectin alleviates alcoholic and nonalcoholic fatty liver diseases in mice. Journal of Clinical Investigation 112 91100. (doi:10.1172/JCI200317797)

    • Search Google Scholar
    • Export Citation
  • Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S & Ueki K et al. 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nature Medicine 8 12881295. (doi:10.1038/nm788)

    • Search Google Scholar
    • Export Citation
  • Yamazaki T, Shiraishi S, Kishimoto K, Miura S & Ezaki O 2011 An increase in liver PPARgamma2 is an initial event to induce fatty liver in response to a diet high in butter: PPARgamma2 knockdown improves fatty liver induced by high-saturated fat. Journal of Nutritional Biochemistry 22 543553. (doi:10.1016/j.jnutbio.2010.04.009)

    • Search Google Scholar
    • Export Citation
  • Yang P & Subbaiah PV 2015 Regulation of hepatic lipase activity by sphingomyelin in plasma lipoproteins. Biochimica et Biophysica Acta 1851 13271336. (doi:10.1016/j.bbalip.2015.07.003)

    • Search Google Scholar
    • Export Citation
  • Yanger K, Knigin D, Zong Y, Maggs L, Gu G, Akiyama H, Pikarsky E & Stanger BZ 2014 Adult hepatocytes are generated by self-duplication rather than stem cell differentiation. Cell Stem Cell 15 340349. (doi:10.1016/j.stem.2014.06.003)

    • Search Google Scholar
    • Export Citation
  • Yen CL, Stone SJ, Cases S, Zhou P & Farese RV Jr 2002 Identification of a gene encoding MGAT1, a monoacylglycerol acyltransferase. PNAS 99 85128517. (doi:10.1073/pnas.132274899)

    • Search Google Scholar
    • Export Citation
  • Younossi ZM, Stepanova M, Afendy M, Fang Y, Younossi Y, Mir H & Srishord M 2011 Changes in the prevalence of the most common causes of chronic liver diseases in the United States from 1988 to 2008. Clinical Gastroenterology and Hepatology 9 524530.e521; quiz e560. (doi:10.1016/j.cgh.2011.03.020)

    • Search Google Scholar
    • Export Citation
  • Yu S, Matsusue K, Kashireddy P, Cao WQ, Yeldandi V, Yeldandi AV, Rao MS, Gonzalez FJ & Reddy JK 2003 Adipocyte-specific gene expression and adipogenic steatosis in the mouse liver due to peroxisome proliferator-activated receptor gamma1 (PPARgamma1) overexpression. Journal of Biological Chemistry 278 498505. (doi:10.1074/jbc.M210062200)

    • Search Google Scholar
    • Export Citation
  • Yu JH, Lee YJ, Kim HJ, Choi H, Choi Y, Seok JW & Kim JW 2015 Monoacylglycerol O-acyltransferase 1 is regulated by peroxisome proliferator-activated receptor gamma in human hepatocytes and increases lipid accumulation. Biochemical and Biophysical Research Communications 460 715720. (doi:10.1016/j.bbrc.2015.03.095)

    • Search Google Scholar
    • Export Citation
  • Yu JH, Song SJ, Kim A, Choi Y, Seok JW, Kim HJ, Lee YJ, Lee KS & Kim JW 2016 Suppression of PPARgamma-mediated monoacylglycerol O-acyltransferase 1 expression ameliorates alcoholic hepatic steatosis. Scientific Reports 6 29352. (doi:10.1038/srep29352)

    • Search Google Scholar
    • Export Citation
  • Zezos P & Renner EL 2014 Liver transplantation and non-alcoholic fatty liver disease. World Journal of Gastroenterology 20 1553215538. (doi:10.3748/wjg.v20.i42.15532)

    • Search Google Scholar
    • Export Citation
  • Zhang YL, Hernandez-Ono A, Siri P, Weisberg S, Conlon D, Graham MJ, Crooke RM, Huang LS & Ginsberg HN 2006 Aberrant hepatic expression of PPARgamma2 stimulates hepatic lipogenesis in a mouse model of obesity, insulin resistance, dyslipidemia, and hepatic steatosis. Journal of Biological Chemistry 281 3760337615. (doi:10.1074/jbc.M604709200)

    • Search Google Scholar
    • Export Citation
  • Zhou J, Febbraio M, Wada T, Zhai Y, Kuruba R, He J, Lee JH, Khadem S, Ren S & Li S et al. 2008 Hepatic fatty acid transporter Cd36 is a common target of LXR, PXR, and PPARgamma in promoting steatosis. Gastroenterology 134 556567. (doi:10.1053/j.gastro.2007.11.037)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • View in gallery

    Hepatocyte specificity expression of AAV8-TBGp-driven transgene. Hepatocyte-specific expression of GFP in AAV8-TBGp-EGFP-injected wild-type mice (green, A and B). GFP expression was absent in non-hepatocyte cells (yellow arrows) in sinusoids (Sn), central vein (CV), portal vein (PV), bile duct (BD) or artery (HA). TBGp-GFP was not expressed in hepatic stellate cells (HSC, desmin +, red, C) or macrophages (Mac, F4/80+, red, D). Sections were counterstained with DAPI (blue nuclei, A, B, C and D). Hepatic GFP (E) and Cre (F) expression was detected only in liver extracts of AAV8-TBGp-EGFP- and AAV8-TBGp-Cre-injected mice, respectively. To confirm the hepatocyte-specific activity of Cre recombinase, PPARγfl/fl mice were injected with AAV8-TBGp-Cre and expression of PPARγ was reduced in hepatic extracts but not adipose tissue (G). Ctx, cortex; eWAT, epididymal fat; Int, intestine; iWAT, inguinal fat. Asterisks indicate the difference between AAV8-TBGp-Cre-injected mice as compared to AAV8-TBGp-Null mice. *P < 0.05; ***P < 0.0001. n = 3–6 mice/group.

  • View in gallery

    Adult-onset hepatocyte-specific PPARγ knockdown (aLivPPARγkd) in chow-fed mice (A, B and C) and diet-induced obese mice (D, E and F). (A) PPARγfl/fl mice were injected at 10 weeks of age with 1.5 * 1011 GC AAV8-TBGp-Null (C, open columns) or 1.5 * 1011 GC AAV8-TBGp-Cre (Kd, shaded columns) via lateral tail vein and killed 1 or 18 weeks after. (B) Hepatic PPARγ mRNA and (C) protein expression of 1 week and 18 weeks aLivPPARγkd and their littermate control mice. Representative image of the western blot for hepatic PPARγ and Histone (as loading control). Of note, nuclear protein variability within total hepatic extracts (assessed by Histone) alters the amount of PPARγ protein detected. n = 4–5 mice/group. (D) LF-fed PPARγfl/fl mice were injected at 10 weeks as described above and immediately half of the mice were fed a high-fat diet (HF, 60% kcal from fat) to induce liver steatosis, whereas the rest were maintained on a low-fat diet (LF, 10% kcal from fat). Mice were killed 14 weeks after. (E) Hepatic PPARγ mRNA and (F) protein expression of 14 weeks LF- and HF-fed aLivPPARγkd and their littermate controls. Representative images of the western blot for hepatic PPARγ and Histone (as loading control). Asterisks indicate the differences between C and Kd. *P < 0.05; ***P < 0.0001. Letters indicate the differences between 1 week and 18 weeks or LF- and HF-fed mice within group. bP < 0.01; cP < 0.0001. n = 5–6 mice/group.

  • View in gallery

    Impact of aLivPPARγkd on hepatic gene expression of molecular mechanisms controlling hepatic TAG levels. (A) 1-week (top) and 18-week (bottom) chow-fed and (B) 14-week LF-fed (top) and HF-fed (bottom) aLivPPARγkd-induced regulation of hepatic gene expression. Graphs represent the natural logarithm of the relative change in the gene expression of aLivPPARγkd mice as compared to their littermates controls (set at 0, x-axis), within age (A) or diet (B). Absolute values are included in Supplementary Table 1A and B. Asterisks show significant changes between C and aLivPPARγkd within age (A) or diet (B). *P < 0.05; **P < 0.01; ***P < 0.0001. Livers were collected at 11:00 h (4 h after food removal). DNL, de novo lipogenesis; FAox, fatty acid oxidation; TAGhydr, TAG hydrolysis; VLDLsyn, VLDL synthesis; TAGsyn, TAG synthesis. Selected genes of these metabolic pathways represented in Fig. 3: peroxisome proliferator-activated receptor α (PPARα), acyl-CoA synthetase long-chain family member 1 (Acsl1), carnitine palmitoyltransferase 1α (Cpt1α), hepatic nuclear factor 4 α (Hnf4α), PPARγ co-activator 1 α (Pgc1α), Cyp4a10, adipose triglyceride lipase (Atgl), hormone-sensitive lipase (Hsl), monoacylglycerol lipase (Mgll), apolipoprotein B (ApoB), microsomal triglyceride transfer protein (Mttp), sterol response element-binding protein 1c (Srebp1c), acetyl-CoA carboxylase 1 (Acc1), fatty acid synthase (Fasn), fatty acid elongase (Elovl6), stearoyl–CoA desaturase 1 (Scd1), hepatic lipase (Hl), low-density lipoprotein lipase receptor (Ldlr), very-low-density lipoprotein receptor (Vldlr), lipoprotein-related protein 1 (Lrp1), fatty acid translocase (Cd36), glycerol phosphate acyltransferase (Gpat1), monoacylglycerol acyltransferase 1 or 2 (Mogat1/2), diacylglycerolacyltransferase 1/2 (Dgat1/2).

  • View in gallery

    aLivPPARγkd reduces HF diet-induced FA levels, but has little impact on FA indices of DNL. (A) Hepatic FA levels of 16:0, palmitate; 16:1, palmitoleate; and 18:2, linoleate levels and (B) hepatic FA ratios indicative of DNL include the SCD index (16:1/16:0) and the DNL index (16:0/18:2), where control (open columns, C) and aLivPPARγkd (closed columns, Kd) mice were fed a LF or a HF diet for 14 weeks. Asterisks indicate differences between C and Kd. ***P < 0.0001. Letters indicate differences between LF- and HF-fed mice within group. aP < 0.05; cP < 0.0001. n = 4–6 mice/group.

  • View in gallery

    aLivPPARγkd reduces HF diet-induced hepatic TAG and DAG levels, whereas increasing MAG levels, independent of diet, indicative of impaired hepatic MAG pathway activity in aLivPPARγkd mice. (A) Schematic representation of acylglycerol synthesis by glycerol-3-phosphate (G3P) pathway that produces DAG by subsequent re-esterification of FA in G3P and lysophosphatidic acid (LPA) or by monoacylglycerol (MAG) pathway that produces DAG after re-esterification of FA in MAG. (B) Relative hepatic TAG, DAG and MAG levels assessed by liquid chromatography/mass spectrometry (LC/MS) in control (open columns) and aLivPPARγkd (close columns) mice. TAG, DAG and MAG are shown as relative values of LF-fed controls. Asterisks indicate differences between control and aLivPPARγkd. ***P < 0.0001. Letters indicate differences between LF- and HF-fed mice within group. bP < 0.01; cP < 0.0001. n = 5–6 mice/group.