Abstract
Preterm birth is associated with increased risk of type 2 diabetes (T2D) in adulthood; however, the underlying mechanisms are poorly understood. We therefore investigated the effect of preterm birth at ~0.9 of term after antenatal maternal betamethasone on insulin sensitivity, secretion and key determinants in adulthood, in a clinically relevant animal model. Glucose tolerance and insulin secretion (intravenous glucose tolerance test) and whole-body insulin sensitivity (hyperinsulinaemic euglycaemic clamp) were measured and tissue collected in young adult sheep (14 months old) after epostane-induced preterm (9M, 7F) or term delivery (11M, 6F). Glucose tolerance and disposition, insulin secretion, β-cell mass and insulin sensitivity did not differ between term and preterm sheep. Hepatic PRKAG2 expression was greater in preterm than in term males (P = 0.028), but did not differ between preterm and term females. In skeletal muscle, SLC2A4 (P = 0.019), PRKAA2 (P = 0.021) and PRKAG2 (P = 0.049) expression was greater in preterm than in term overall and in males, while INSR (P = 0.047) and AKT2 (P = 0.043) expression was greater in preterm than in term males only. Hepatic PRKAG2 expression correlated positively with whole-body insulin sensitivity in males only. Thus, preterm birth at 0.9 of term after betamethasone does not impair insulin sensitivity or secretion in adult sheep, and has sex-specific effects on gene expression of the insulin signalling pathway. Hence, the increased risk of T2D in preterm humans may be due to factors that initiate preterm delivery or in early neonatal exposures, rather than preterm birth per se.
Introduction
In developed countries the incidence of preterm birth, defined as delivery before 37 completed weeks’ gestational age (GA), is ~7–10% and is progressively increasing (Ananth et al. 2013, Li et al. 2013). Approximately 80% of preterm babies are born moderate to late preterm, at 32–36 completed weeks’ GA, or 0.8–0.9 of term (Li et al. 2013). In human epidemiological studies, preterm birth (including moderate and late preterm) is associated with increased risks of type 2 diabetes (T2D) in adult life (Lawlor et al. 2006, Kaijser et al. 2009, Kajantie et al. 2010, 2014, Pilgaard et al. 2010), with poorer insulin sensitivity implicated as an underlying mechanism (Tinnion et al. 2013). Direct measures of insulin sensitivity by hyperinsulinaemic euglycaemic clamp (HEC) are lower in young adult men born preterm than those born at term (Rotteveel et al. 2008, 2011, Mathai et al. 2012). Although there is evidence that insulin secretion increases to compensate and maintain insulin action in some preterm populations (Mathai et al. 2012, Kajantie et al. 2014), the overall increased risk of T2D after preterm birth implies that this is not always adequate and that insulin secretion is also impaired after preterm birth.
To explore the underlying mechanisms for effects of preterm birth on glucose metabolism, including on the pancreas and insulin-responsive tissues (skeletal muscle and liver), we have used a clinically relevant ovine model of preterm birth (De Matteo et al. 2009, 2010, Bensley et al. 2010). This also allows us to test causality for effects of preterm birth independent of confounding effects of other exposures. Importantly for studies of the effects of perinatal events on insulin action, the pancreas and β-cells develop at similar stages of gestation in sheep and humans (Gatford et al. 2010), and prenatal exposures therefore affect similar stages of pancreatic development in both species. Antenatal administration of the glucocorticoids, betamethasone or dexamethasone, to pregnant ewes improves lung maturation and survival of preterm-delivered lambs (Liggins 1969, De Matteo et al. 2010), consistent with clinical responses in humans (Liggins & Howie 1972, Roberts & Dalziel 2006, Brownfoot et al. 2013). It is therefore routine clinical practice to administer antenatal glucocorticoids to all women at risk of delivering preterm (Brownfoot et al. 2013), but there is some evidence for long-term effects on exposed progeny. Antenatal glucocorticoid exposure in sheep induces variable impairments in metabolic outcomes in progeny, which may be due to the different doses and compounds administered and/or timing of delivery. To date, however, there have been no reports in sheep of metabolic outcomes after combined exposure to preterm birth and antenatal betamethasone, which like dexamethasone is commonly administered to women in cases of threatened preterm labour (Brownfoot et al. 2013). We hypothesised that preterm birth after exposure to a clinical dose of betamethasone would impair glucose tolerance, insulin sensitivity and insulin secretion in adult ovine progeny. Furthermore, we hypothesised that this exposure would decrease expression of insulin signalling pathway genes in two key insulin-responsive tissues, skeletal muscle and liver, and would decrease β-cell mass in pancreas of these adult progeny. Because morbidity after preterm birth is worse in males than females (Liggins & Howie 1972, De Matteo et al. 2010), and other perinatal exposures have sex-specific effects on ovine progeny (Owens et al. 2007), we assessed outcomes in adult offspring of both sexes.
Materials and methods
Animal cohort
All studies were jointly approved by the Monash University Animal Ethics Committee (MMCA-2011/01) and University of Adelaide Animal Ethics Committee (M-2013-173), and conducted in accordance with Australian guidelines (National Health and Medical Research Council of Australia 2004). Animal management during pregnancy and neonatal life, induction of preterm delivery and antenatal glucocorticoid treatment were as described previously (Nguyen et al. 2016). Briefly, Border Leicester × White Suffolk ewes were time-mated to White Suffolk rams. Pregnant ewes carrying singleton foetuses were randomly allocated to deliver either preterm at 132 ± 1 days’ GA (~0.9 of term, term = 147 days) or delivered near term. As previously reported, 57% of preterm and 94% of control progeny survived to adulthood (Nguyen et al. 2016), and the present study reports outcomes in all adult progeny (16 preterm: 9M, 7F and 17 term: 11M, 6F). Ewes allocated to deliver preterm were treated with clinical doses of betamethasone (two doses of 11.4 mg i.m., Celestone Chrondose, Schering-Plough, North Ryde, Australia), at 130 ± 1 days’ and at 131 ± 1 days’ GA (Nguyen et al. 2016). Unlike dexamethasone (Bansal et al. 2015), clinical doses of betamethasone at 0.8–0.9 of gestation do not induce parturition in sheep. Preterm delivery at 132 ± 1 days was therefore induced by administration of epostane (50 mg in 2 mL 100% EtOH i.v.; Sanofi-Synthlabo, Winthrop, Guildford, UK) to pregnant ewes at 130 ± 1 days’ GA, ~5 h after the first betamethasone injection (De Matteo et al. 2008, 2009, 2010, Nguyen et al. 2016). By inhibiting 3β-hydroxysteroid dehydrogenase, epostane rapidly reduces circulating progesterone concentrations in the ewe, which is followed by rapid upregulation of uterine prostaglandin F2α production and induces parturition 30–40 h after administration in ewes near term at 137–142 days’ GA (Silver 1988). Neonatal support of preterm lambs is described elsewhere (Nguyen et al. 2016). Control ewes were induced to deliver lambs vaginally near term by administration of epostane (dose as above) at 145 ± 1 days’ GA (De Matteo et al. 2008, 2009, 2010, Nguyen et al. 2016).
Following birth, all lambs were housed in individual pens with their mothers for 4–6 weeks. After weaning at 12 weeks of age, male and female progeny were housed in separate paddocks (Nguyen et al. 2016); animals of both sexes were reproductively intact and oestrous cycles of females were not synchronised or manipulated during the study. The animals grazed natural pastures and were provided with 800–1000 g/sheep of lucerne/hay daily and 200 g/sheep of Rumevite pellets weekly (Ridley AgriProducts, Melbourne, Australia). At ~12 months of age, sheep were transported to an indoor animal facility where they were housed in individual metabolic cages on a 12 h light:12 h darkness cycle for the remainder of the experiment. During this period, sheep had ad libitum access to water and were fed 800–1000 g lucerne chaff twice daily, except when fasted before metabolic tests as described below.
In vivo measures of insulin secretion, sensitivity and action
After 5–8 days acclimatisation, and at least 3 days prior to metabolic tests, catheters were surgically implanted into the left femoral vein and femoral artery under aseptic conditions. Analgesia was provided by a pre-operative s.c. injection of 0.5% bupivacaine with adrenaline (10–15 mL Marcaine; Astra Zeneca) at the inguinal incision site, and then by administration of a transdermal fentanyl patch (7.5 mg Durogesic, Ortho-McNeil-Janssen Pharmaceuticals, Inc, Titusville, NJ, USA) at surgery to provide 3 days post-operative analgesia. General anaesthesia was induced by i.v. injection of thiopentone sodium (20 mg/kg) and maintained by isoflurane inhalation (1.5–2.5% in 70/30 O2/N2O); antibiotics were injected daily for 3 days post-surgery (ampicillin 500 mg i.v.; Aspen Pharmcare Australia Pty Ltd, St Leonards, NSW, Australia). Catheters were maintained by daily flushing with heparinised saline (100 IU/mL). Glucose tolerance and glucose-stimulated insulin secretion were measured during an intravenous glucose tolerance test (IVGTT, 0.25 g glucose/kg body weight) at 432 ± 2 days of age, and glucose tolerance indices and insulin secretion were calculated as previously described (Gatford et al. 2004, De Blasio et al. 2007, Owens et al. 2007). Two days later, the whole-body insulin sensitivity of glucose metabolism was measured by HEC (2 U insulin.kg−1.min−1, 2 h, variable glucose infusion to restore/maintain euglycaemia) (Gatford et al. 2004). Insulin sensitivityglucose and basal and maximal insulin-stimulated glucose disposition indices (DI) were calculated as previously described (Gatford et al. 2004).
Post-mortem
At least two days after completion of the in vivo studies, sheep were fasted overnight and then humanely killed by venous administration of an overdose of Lethabarb (Virbac, Milperra, NSW, Australia), and the pancreas, liver, heart, lungs, brain, kidneys, spleen, skeletal muscles (M. semitendinosus, M. soleus, M. vastus lateralis) and a dissectible adipose depot (perirenal fat) were removed and weighed (Nguyen et al. 2016). Tissue samples were snap frozen in liquid nitrogen and stored frozen at −80°C for studies of gene expression. Representative mixed aliquots of each pancreas were fixed in 10% buffered formalin prior to processing, embedding and sectioning as previously described (Gatford et al. 2008).
Analysis of plasma insulin and glucose
Plasma insulin concentrations were measured in duplicate by a double antibody, solid-phase radioimmunoassay using a commercially available kit (human insulin-specific RIA, HI-14K, Linco Research). The intra- and inter-assay coefficients of variation for the insulin assay were 5.1% and 12%, respectively, for an ovine plasma sample containing 14 U.L−1 insulin (n = 15 assays). Intra-assay coefficients of variation were 6.8% and 7.1%, and inter-assay coefficients of variation were 13.0% and 13.8% for human insulin quality control samples containing 9.1 and 49.2 U.L−1 insulin, respectively. Plasma glucose concentrations were measured by colorimetric enzymatic analysis using a Hitachi 912 automated metabolic analyser and Roche/Hitachi Glucose/HK kits (Roche Diagnostics GmbH).
Immunostaining and morphometric analysis of pancreas
One pancreas section per block (5 μm) was immunostained to detect insulin-positive cells as described previously (Gatford et al. 2008). Stained slides were digitally captured at 40× magnification (NanoZoomer, Hamamatsu, Japan). β-Cell volume density (Vd) was quantified by point counting (209 points/field), and numbers of islets, small islets (<5 β-cells) and β-cells per islet were counted in 30 fields per section, selected by random-systematic sampling (each field 0.217 mm2) and analysed using ImageJ software (National Institutes of Health, Bethesda, MD, USA) (Gatford et al. 2008). β-Cell mass was calculated by multiplying Vd by pancreas mass (Gatford et al. 2008). The number of fields counted was based on β-cell volume density and variation between fields and was validated in our previous studies to give a SEM of <10% within individuals in sheep at this age (Gatford et al. 2008).
Gene expression
We measured gene expression of components of the insulin signalling pathway in liver and M. vastus lateralis, as skeletal muscle accounts for >80% of insulin-stimulated glucose uptake (DeFronzo & Tripathy 2009). The M. vastus lateralis is a mixed-fibre type muscle, and we have previously reported that intra-uterine growth restriction (IUGR) impairs gene expression of determinants of insulin signalling in this muscle in sheep (De Blasio et al. 2012), consistent with changes seen at gene and protein levels in IUGR or small for GA humans (Jaquet et al. 2001, Ozanne et al. 2005, Vaag et al. 2006, Jensen et al. 2008).
RNA extraction
Tissues were homogenised with 0.4–0.6 g of CB014 ceramic beads (Bertin-Technologies, Montigny le Bretonneux, France) using a PowerLyzer 24 (Mo Bio Laboratories, Carlsbad, CA, USA), and RNA extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The quantity and quality of total RNA was determined by spectrophotometry (NanoDrop spectrophotometer; Biolab, Mulgrave, Australia) and Experion RNA Analysis Kits (Bio-Rad).
cDNA synthesis
RNA was DNase treated using TURBO DNA-free kit (Life Technologies) in accordance with the manufacturer’s instructions and after DNase treatment, RNA was quantified with the NanoDrop. PCR was performed in a subset of treated RNA samples with genomic DNA-specific primers designed to cross an intron boundary (F: 5′CTGTCTGAGGTGCTGAATTG3′, R: 5′GGTACCCAACATCAACAGTT3′) to confirm successful DNase treatment before reverse transcription. Ovine genomic DNA was included as a positive control (12.5 ng/μL) and was extracted from liver samples homogenised in 500 μL of TES (10 mM Tris–HCl (pH 8), 1 mM EDTA (pH 8), 100 mM NaCl), followed by the addition of proteinase K and SDS (Miller et al. 1988). PCR specific for genomic DNA was performed on a Corbett RotorGene 6000 (QIAGEN) with the following cycling conditions: 95°C for 10 min, 95°C for 5 s and 55°C for 20 s for 40 cycles, with melt at 60–95°C, followed by agarose gel electrophoresis. DNase treated RNA from liver and muscle (500 ng/sample) was reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad). Controls consisted of samples without added reverse transcriptase and tubes with all reagents except RNA. All cDNA samples were diluted 1:5 before quantitative real-time PCR analysis.
Primer design
Primers were designed using PrimerBlast (National Center for Biotechnology Information, Bethesda, MD, USA), Primer3 (Koressaar & Remm 2007, Untergasser et al. 2012) and UCSC In-Silico PCR (Genome Bioinformatics Group, UC Santa Cruz, CA, USA). Primers were designed across an exon boundary to amplify cDNA with a predicted amplicon size of 100–200 base pairs (bp, Table 1). Reaction efficiencies for primer pairs were determined by 1/5 serially diluted standards and ranged from 90% to 103%. The presence of a single PCR product of the expected size was confirmed by the presence of a single peak on the melting curve and of a single product at the predicted size on an agarose gel.
Primer sequences, amplicon size and accession numbers for genes measured by quantitative real-time PCR.
| Gene | Gene name | Predicted amplicon size (bp) | Forward primer 5′–3′ | Reverse primer 5′–3′ | GenBank accession no. |
|---|---|---|---|---|---|
| Target genes | |||||
| INSR | Insulin receptor | 154 | CCTATGCCCTGGTGTCACTT | CCCTGAGTGATGGTGAGGTT | XM_004008550 |
| AKT2 | V-Akt murine thymoma viral oncogene homolog 2 | 136 | AGACTACAAGTGTGGCTCCC | CTTCATGGCATAGTAGCGGC | XM_004015692 |
| SLC2A2 | Solute carrier family 2 (facilitated glucose transporter), member 2 | 142 | CGAAATTGGGACCATCTCAC | TGAAGAGCACCGATAGCACC | XM_004003162 |
| SLC2A4 | Solute carrier family 2 (facilitated glucose transporter), member 4 | 143 | CCTCCTACGAGATGCTCATT | GATGGCCAGTTGATTGAGTG | XM_004012643 |
| PRKAA2 | Protein kinase, AMP-activated, alpha 2 catalytic subunit | 181 | GGCATCTTGGAATCCGAAGT | TTGTCAACCAGGTACAGCTG | NM_001112816 |
| PRKAG2 | Protein kinase, AMP-activated, gamma 2 non-catalytic subunit | 173 | GAATCCTCAAGTTCCTCCAG | CAAGGCCGACACTCGTCTTT | XM_004008179 |
| Reference genes | |||||
| GAPDH | Glyceraldehyde 3-phosphate dehydrogenase | 132 | GCTGAGTACGTGGTGGAGTC | CACGCCCATCACAAACATGG | NM_001190390 |
| SDHA | Succinate dehydrogenase complex, subunit A, flavoprotein (Fp) | 141 | CCGAAGCAGGTTTCAACACG | TCACGGTGTCGTAGAAGTGC | XM_004017097 |
| YWHAZ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta | 137 | GACTACTATCGCTACTTGGC | CCCAGTCTGATAGGATGTGT | NM_001267887 |
| RPL-P0 | Ribosomal protein, large, P0 | 179 | AATGGCAGCATCTACAACCC | TCCACAGACAAAGCCAGGAC | XM_004017413 |
qPCR analysis
Quantitative PCR (qPCR) analysis was carried out for insulin signalling and reference genes (Table 1) using 2 μL cDNA in a 10 μL PCR. The QIAgility automated PCR setup robot (QIAGEN) and Bio-Rad CFX384 well real-time qPCR machine (Bio-Rad) were used with SsoFast Evagreen Supermix (Bio-Rad) and with PCR cycling conditions as follows: 95°C for 30 s, 95°C for 5 s and 60°C for 5 s for 40 cycles, melt at 60–95°C. Data were quantified using Bio-Rad CFX Manager version 3.1 software (Bio-Rad). Gene expression of key signalling components in insulin-regulated glucose uptake was measured in liver (INSR, AKT2, SLC2A2, SLC2A4, PRKAA2, PRKAG2) and muscle (INSR, AKT2, SLC2A4, PRKAA2, PRKAG2). Reference genes GAPDH, SDHA, YWHAZ and RPL-P0 (Table 1) were measured in all samples. The stability of the four reference genes was assessed using the CFX Manager v3.1 software (Bio-Rad), with the two most stable reference genes (YWHAZ (CV = 0.2354, M = 0.7034) and RPL-P0 (CV = 0.2354, M = 0.7034)) used for normalisation (Vandesompele et al. 2002). Gene expression of INSR, AKT2, SLC2A2, SLC2A4, PRKAA2, PRKAG2 (liver) and INSR, AKT2, SLC2A4, PRKAA2, PRKAG2 (muscle) was normalised to the geometric mean of the most stable reference genes YWAHZ and RPL-P0 using the CFX Manager v3.1 software (Bio-Rad).
Statistical analysis
For single measures made on each animal, effects of group (preterm vs term), sex and their interaction were analysed by two-way ANOVA. For measures made repeatedly on the same animals, the effects of group, sex, time and their interactions were analysed using a repeated-measures ANOVA. Insulin data were log-transformed before statistical analysis. Data for relative gene expression were not normally distributed and were therefore analysed overall and separately in males and females by Mann–Whitney U-test. Relationships between whole-body insulin sensitivity and gene expression of individual insulin signalling components were analysed by Pearson’s correlation. Statistical analyses were carried out using SPSS software version 21.0 (SPSS). Unless otherwise stated, data are expressed as mean ± s.e.m. P < 0.05 was accepted as statistically significant.
Results
The preterm lambs studied as adults were born at earlier GA (term: 145.9 ± 0.2 days, preterm: 131.7 ± 0.1 days; P < 0.001), and had 35% lower birth weights than term lambs (term: 6.45 ± 0.28 kg, preterm: 4.19 ± 0.14 kg; P < 0.001). These outcomes did not differ between sexes and were similar to those reported for all lambs born in this study, which included animals that did not survive to adulthood (Nguyen et al. 2016).
Preterm birth did not impair glucose tolerance or insulin secretion in adulthood
Adult body weight at metabolic testing did not differ between groups (P = 0.076, Table 2). Effects of group on fasting blood glucose concentration measured prior to the IVGTT differed between sexes (interaction P = 0.004, Table 2). Blood glucose concentration did not differ between preterm and term males (P = 0.130) but was greater in preterm than in term females (P = 0.020, Table 2). Fasting insulin concentration prior to the IVGTT did not differ between groups (P = 0.290) and was higher in females than in males (P < 0.001, Table 2). Glucose tolerance did not differ between groups overall or during the first or second phases of insulin secretion (Table 2). Males had better glucose tolerance during the first phase of insulin secretion than females (lower AUCglucose, P = 0.016, Table 2). Absolute and relative insulin secretion did not differ between groups or sexes (Table 2). Insulin sensitivity did not differ significantly between groups (P = 0.082) or sexes (Table 2); neither group nor sex affected insulin sensitivity (each P > 0.2) when current body weight was added as a covariate in statistical analyses. Measures of insulin action (basal and maximal indices of insulin-stimulated glucose disposition) did not differ between groups or sexes (Table 2).
Adult metabolic outcomesa
| Term | Preterm | P-Values | |||||
|---|---|---|---|---|---|---|---|
| Male | Female | Male | Female | Group | Sex | Group × sex | |
| Number of animals | 11 | 6 | 9 | 7 | |||
| Body weight (kg) | 60.3 ± 2.1 | 55.8 ± 1.4 | 53.1 ± 2.9 | 54.4 ± 1.2 | 0.076 | 0.5 | 0.2 |
| Fasting plasma concentrations | |||||||
| Glucose (mmol/L) | 4.08 ± 0.08 | 3.88 ± 0.12 | 3.89 ± 0.09 | 4.31 ± 0.10 | 0.246 | 0.3 | 0.004b |
| Insulin (U/L) | 6.14 ± 0.28 | 7.41 ± 0.37 | 5.49 ± 0.36 | 7.38 ± 0.53 | 0.29 | <0.001 | 0.3 |
| Glucose tolerance (mmol.min.L−1) | |||||||
| First phase | 116 ± 3 | 131 ± 3 | 114 ± 5 | 119 ± 3 | 0.077 | 0 | 0.2 |
| Second phase | 202 ± 15 | 266 ± 20 | 189 ± 27 | 209 ± 31 | 0.145 | 0.1 | 0.4 |
| Total | 318 ± 16 | 398 ± 19 | 303 ± 30 | 328 ± 32 | 0.104 | 0.1 | 0.3 |
| Absolute insulin secretion (U.min.L−1) | |||||||
| First phase | 264 ± 52 | 263 ± 43 | 278 ± 48 | 302 ± 61 | 0.731 | 0.7 | 0.9 |
| Second phase | 507 ± 81 | 638 ± 62 | 582 ± 96 | 502 ± 42 | 0.781 | 0.4 | 0.3 |
| Total | 771 ± 111 | 902 ± 86 | 860 ± 131 | 804 ± 79 | 0.961 | 0.4 | 0.5 |
| Relative insulin secretion (U/mmol) | |||||||
| First phase | 2.2 ± 0.4 | 2.0 ± 0.3 | 2.5 ± 0.4 | 2.5 ± 0.5 | 0.53 | 1 | 0.7 |
| Second phase | 2.5 ± 0.4 | 2.4 ± 0.2 | 3.3 ± 0.6 | 2.9 ± 0.6 | 0.384 | 0.9 | 0.6 |
| Total | 2.4 ± 0.3 | 2.3 ± 0.2 | 3.0 ± 0.5 | 2.7 ± 0.3 | 0.428 | 0.9 | 0.8 |
| Insulin sensitivityglucose (mg.L.U−1.kg−1.min−1) | 0.051 ± 0.004 | 0.043 ± 0.005 | 0.055 ± 0.005 | 0.055 ± 0.005 | 0.082 | 0.4 | 0.3 |
| Insulin-stimulated glucose disposition indices (mg.mL.kg−2.min−2) | |||||||
| Basal DIglucose | 10.4 ± 1.5 | 9.68 ± 1.25 | 10.5 ± 1.6 | 13.5 ± 2.4 | 0.379 | 0.5 | 0.4 |
| Max DIglucose | 41.1 ± 6.3 | 36.5 ± 6.6 | 50.5 ± 11.7 | 52.8 ± 10.5 | 0.229 | 1 | 0.6 |
Data are expressed as mean ± s.e.m. Insulin data were log-transformed before statistical analysis. DI, insulin-stimulated glucose disposition index.
Fasting blood glucose concentration did not differ between term and preterm males (P = 0.130) but was greater in preterm than in term females (P = 0.020).
Pancreas morphology and β-cell function were normal in preterm-born sheep
Absolute pancreas weight did not differ between groups and was greater in males than that in females (P = 0.019, Table 3), and relative pancreas weights did not differ significantly between groups or sexes (Table 3) as reported previously (Nguyen et al. 2016). β-cell volume density, absolute and relative β-cell mass, average number of β-cells per islet and islet density, and measures of β-cell function did not differ between groups or sexes (Table 3).
Pancreas morphology and β-cell functiona.
| Term | Preterm | P-Values | |||||
|---|---|---|---|---|---|---|---|
| Male | Female | Male | Female | Group | Sex | Group × sex | |
| Number of animals | 11 | 6 | 9 | 7 | |||
| Pancreas morphology | |||||||
| Pancreas mass (g) | 62.3 ± 4.1 | 49.7 ± 5.0 | 63.2 ± 3.3 | 56.1 ± 2.0 | 0.4 | 0 | 0.5 |
| Pancreas (%) | 1.04 ± 0.08 | 0.90 ± 0.09 | 1.21 ± 0.08 | 1.03 ± 0.03 | 0.1 | 0.1 | 0.8 |
| β-Cell volume density | 0.0061 ± 0.0007 | 0.0048 ± 0.0008 | 0.0049 ± 0.0008 | 0.0052 ± 0.0010 | 0.7 | 0.5 | 0.4 |
| β-Cell mass (g) | 0.383 ± 0.054 | 0.233 ± 0.038 | 0.322 ± 0.062 | 0.294 ± 0.058 | 1 | 0.1 | 0.3 |
| β-Cell mass (%) | 0.0065 ± 0.0010 | 0.0041 ± 0.0007 | 0.0062 ± 0.0013 | 0.0054 ± 0.0011 | 0.7 | 0.2 | 0.5 |
| Islet density (no.mm−2) | 7.62 ± 0.90 | 5.87 ± 1.03 | 5.64 ± 0.69 | 6.14 ± 0.92 | 0.4 | 0.5 | 0.2 |
| β-Cells/islet (no) | 7.62 ± 0.39 | 8.93 ± 0.96 | 8.63 ± 0.83 | 8.99 ± 1.58 | 0.6 | 0.4 | 0.6 |
| % of islets with <5 β-cells | 53.5 ± 3.1 | 51.1 ± 5.6 | 42.7 ± 4.4 | 45.3 ± 5.6 | 0.1 | 1 | 0.6 |
| β-Cell function | |||||||
| Absolute insulin secretion per β-cell mass (U.min.L−1.g−1) | 2690 ± 657 | 5922 ± 2632 | 4304 ± 1308 | 3415 ± 675 | 1 | 0.2 | 0.3 |
| Basal DI per β-cell mass (mg.mL.kg−2.min−2.g−1) | 33 ± 5 | 68 ± 34 | 44 ± 13 | 54 ± 11 | 0.6 | 0.1 | 0.7 |
| Maximal DI per β-cell mass (mg.mL.kg−2.min−2.g−1) | 151 ± 42 | 277 ± 158 | 273 ± 133 | 192 ± 25 | 0.4 | 0.4 | 0.7 |
Data are expressed as mean ± s.e.m. Pancreas and β-cell weights are shown in absolute terms and as a percentage of body weight. Measures of β-cell function calculated from insulin data were log-transformed before statistical analysis. DI, insulin-stimulated glucose disposition index.
Preterm birth had little effect on hepatic expression of genes important for insulin signalling
INSR, AKT2, SLC2A2, SLC2A4 and PRKAA2 gene expression in liver did not differ between groups or sexes (Fig. 1). Expression of these genes in liver was also similar in preterm and term animals within each sex when analysed separately (Fig. 1). Hepatic PRKAG2 expression was greater in preterm than in term males (P = 0.028), but was similar in preterm and term females, and did not differ between sexes (Fig. 1).
Preterm birth had few effects on gene expression of key insulin signalling components in liver of 14-month-old sheep. Expression of target genes is normalised to reference genes. Each data point represents an individual animal; horizontal lines indicate means within that group and sex. Term-born are shown in solid symbols, preterm-born in open symbols, males by circles and females by squares. *P < 0.05.
Citation: Journal of Endocrinology 232, 2; 10.1530/JOE-16-0300
Skeletal muscle expression of several genes important for insulin signalling was increased by preterm birth, particularly in males
INSR gene expression in skeletal muscle did not differ between groups overall or in females, but was greater in preterm males than in term males (P = 0.047, Fig. 2). Muscle AKT2 expression did not differ between preterm and term groups overall (P = 0.074) or in females (P > 0.1), but was greater in preterm than in term males (P = 0.043, Fig. 2). Muscle SLC2A4 expression was greater in preterm than in term overall (64% higher, P = 0.019) and in preterm compared to term males (P = 0.019), but was similar in preterm compared to term females (P > 0.1, Fig. 2). Muscle PRKAA2 expression was greater in preterm than in term overall (63% higher, P = 0.021) and in males (P = 0.009), but was similar in preterm compared to term females (P > 0.1, Fig. 2). Expression of INS, AKT2, SLC2A4 and PRKAA2 in muscle did not differ between sexes (Fig. 2). Muscle PRKAG2 expression was greater in preterm than in term sheep overall (51% higher, P = 0.049) and in males (P = 0.015), but was similar in preterm compared to term females (P > 0.1, Fig. 2), and was greater in males than in females (P = 0.031).
Preterm birth increased gene expression of key insulin signalling components in skeletal muscle, particularly in males. Expression of target genes in M. vastus lateralis is normalised to reference genes. Each data point represents an individual animal; horizontal lines indicate means within that group and sex. Term-born are shown in solid symbols, preterm-born in open symbols, males by circles and females by squares. *P < 0.05.
Citation: Journal of Endocrinology 232, 2; 10.1530/JOE-16-0300
Hepatic expression of PRKAG2 correlated positively with insulin sensitivity, in males only
Hepatic PRKAG2 expression correlated positively with whole-body insulin sensitivity in males (R = 0.573, P = 0.025, n = 15) but not in females (R = 0.135, P > 0.6, n = 11). Expression of the other individual genes studied in liver (INSR, AKT2, SLC2A2, SLC2A4, PRKAA2) and muscle (INSR, AKT2, SLC2A4, PRKAA2, PRKAG2) did not correlate with whole-body insulin sensitivity within either sex (each P > 0.1).
Discussion
In this study, we investigated the effect of preterm birth at 0.9 of gestation after antenatal betamethasone treatment on glucose homeostasis and its key determinants, insulin sensitivity and secretion, in young adult sheep. We found that preterm birth induced by maternal epostane treatment did not impair glucose homeostasis, insulin sensitivity, insulin secretion or β-cell mass at adulthood, compared to a term-born group also exposed to epostane. Unexpectedly, skeletal muscle gene expression of determinants of insulin signalling was greater in the preterm sheep, particularly in males, demonstrating sex-specific programming by this exposure, but these findings require confirmation in subsequent studies. Our findings differ from the impaired insulin secretion observed in adult sheep after preterm birth induced by antenatal dexamethasone treatment (Bansal et al. 2015), and impaired metabolic outcomes in adult sheep after antenatal exposure to either betamethasone or dexamethasone when followed by spontaneous term birth (Moss et al. 2001, Long et al. 2012). Lambs delivered at ~0.9 of term without prior antenatal glucocorticoids have poor survival (Liggins 1969, De Matteo et al. 2010), and ethical reasons therefore prevented inclusion of a non-betamethasone-exposed preterm group. Clinical practice is to treat women at risk of preterm birth with glucocorticoids (Brownfoot et al. 2013), but the majority of women delivering at term will not have received glucocorticoids. The two groups in our study, therefore, also reflect the main groups in human populations. It is, however, not possible to separate effects of preterm birth from those of antenatal glucocorticoids within the present cohort. An additional potential impact of our experimental design is that labour in both groups was induced by epostane. This is unlikely to alter glucocorticoid exposure in our preterm group, where epostane exposure occurs before the normal developmental increases in adrenal cortisol production and circulating cortisol at ~132 days’ GA or 10–15 days before delivery in the foetal sheep (Magyar et al. 1980, Phillips et al. 1996), and exogenous betamethasone was given to our preterm group. Maternal epostane treatment is likely to have perturbed cortisol profiles in the term group, albeit probably transiently. This inhibitor of 3β-hydroxysteroid dehydrogenase crosses the placenta and suppresses foetal cortisol concentrations by ~50% within 1 h in late gestation foetuses, followed by a rapid rebound with elevated circulating cortisol concentrations from 24 h post-epostane persisting to at least delivery (Silver 1988). Inclusion of a spontaneously delivering term group in future studies is recommended to remove this potential confounder. Nevertheless, our findings together with those of previous studies suggest that the developmental programming of metabolic outcomes by glucocorticoids may differ between betamethasone and dexamethasone, and may also be dependent on the timing of exposure relative to delivery. The lack of impairment of glucose tolerance and its determinants after preterm birth and antenatal betamethasone exposure in the present study lead us to further suggest, in contrast to previous conclusions (Bansal et al. 2015), that increased rates of diabetes and impaired insulin sensitivity seen in epidemiological studies of preterm-born humans are not a consequence of preterm birth itself.
Glucose tolerance
Glucose tolerance did not differ between preterm-born adult sheep at 0.9 of gestation after antenatal glucocorticoid exposure and those born at term. This was observed both in the present cohort in which preterm sheep were exposed to antenatal betamethasone and induced to deliver at 132 days’ GA by maternal epostane or in a slightly less preterm cohort where delivery at 137 days’ GA was induced by maternal antenatal dexamethasone (Bansal et al. 2015). Sheep are ruminants and like other adult ruminants produce most of their circulating glucose via gluconeogenesis rather than direct absorption from the diet (Larsen & Kristensen 2013). Nevertheless, they exhibit similar glucose profiles and biphasic insulin secretion responses following a bolus of intravenous glucose (Gatford et al. 2004, 2012, Owens et al. 2007) as seen in humans (e.g. Kjems et al. 2001). Interestingly, fasting glucose was higher in preterm than term progeny in the present study, but only in females, suggesting a mild disturbance of glucose metabolism in this cohort. The present results together with previous outcomes in studies of sheep (Bansal et al. 2015) and humans (Dalziel et al. 2005) therefore suggest that moderate preterm birth after antenatal glucocorticoid exposure at clinical doses does not induce a clinically significant impairment of glucose tolerance in early adulthood. The increase in diabetes risk after preterm birth in human cohorts appears to be worse in those born at early GA (<28 weeks) than in those born moderately preterm, and effect sizes are also generally larger in older adults than in young adults (Lawlor et al. 2006, Kaijser et al. 2009, Kajantie et al. 2010, Pilgaard et al. 2010). It is, therefore, possible that earlier preterm birth might impair glucose tolerance or that this might become more evident with ageing in the sheep.
Insulin sensitivity
Surprisingly, when we investigated insulin sensitivity using the ‘gold standard’ method (HEC) there was no detectable impairment in this cohort of preterm-born adult sheep. Animal numbers may have limited our capacity to detect differences in in vivo insulin sensitivity; although not significant (P = 0.082), mean insulin sensitivity was 12% higher in preterm than in term overall, possibly also reflecting increased insulin sensitivity with lower body size. These findings are in contrast with the reported elevated risk of T2D (Lawlor et al. 2006, Kaijser et al. 2009, Kajantie et al. 2010, 2014, Pilgaard et al. 2010) and impaired insulin sensitivity (Rotteveel et al. 2008, 2011, Mathai et al. 2012, Tinnion et al. 2013) in preterm-born adult humans. In three studies from two cohorts of young adults, where the HEC was used to measure insulin sensitivity, insulin sensitivity was lower in those born preterm compared to those born at term (Rotteveel et al. 2008, 2011, Mathai et al. 2012). Insulin sensitivity calculated by minimal modelling did not differ between preterm and term-born young adult men and women, however (Willemsen et al. 2009). Based on our findings, we hypothesise that the reduced insulin sensitivity in adult humans born preterm might be induced by factors associated with preterm birth, rather than the exposure to preterm birth itself. One candidate factor that might contribute to the association in human cohorts is foetal exposure to chorioamnionitis, or other states of maternal and placental inflammation. Chorioamnionitis is clinically associated with 25–40% of preterm births and in utero exposure impairs cardiorespiratory, neurological and renal outcomes in human babies (Galinsky et al. 2013), although metabolic consequences have not been studied in humans. In rats, however, systemic maternal inflammation during pregnancy programmed multiple symptoms of the metabolic syndrome, including decreased insulin sensitivity measured by HEC, in male but not female young adult progeny (Hao et al. 2014), consistent with this hypothesis.
Outcomes may differ between glucocorticoids and depend on timing of delivery
Differences in metabolic consequences of antenatal glucocorticoid exposure, with and without preterm birth, between this and previous ovine studies (Moss et al. 2001, Long et al. 2012, Bansal et al. 2015) suggest that the metabolic programming effects of glucocorticoids differ between betamethasone and dexamethasone, and also depend on the relative timing of glucocorticoid exposure and birth. The glucocorticoid diastereoisomers betamethasone and dexamethasone have similar binding affinities for the human and rat glucocorticoid receptors (Ponec et al. 1986, Tanigawa et al. 2002), induce similar downstream transactivation and transrepression glucocorticoid receptor signalling in vitro (Tanigawa et al. 2002), and undergo similar transfer and metabolism in perfused human placenta (Levitz et al. 1978), but differ in kinetics. The half-life of betamethasone after intravenous administration is approximately twice that of dexamethasone in non-pregnant and pregnant humans (Petersen et al. 1983a,b). The kinetics, placental transfer and receptor activation of these glucocorticoids have not been directly compared in the sheep. When foetally administered at the same dose, however, betamethasone is a more potent inducer of parturition than dexamethasone in sheep (Derks et al. 1996), suggesting similar differences in kinetics. Exposure to antenatal maternal courses of either dexamethasone at sub-clinical doses or betamethasone at clinical doses at preterm ages each induce adverse metabolic consequences in ovine progeny born at term, although the specific outcomes differ. Four doses of dexamethasone (each injection 2 mg, ~60 μg.kg–1.d–1) given 12 h apart at d103 and d104 GA reduced postnatal body weight and induced glucose intolerance with decreased insulin secretion in term-born female ovine progeny across two generations, although their insulin sensitivity has not yet been reported (Long et al. 2012). Glucose tolerance of term-born adult progeny was unchanged by a single maternal course of 0.5 mg/kg betamethasone given to pregnant sheep at d104 GA (~0.7 of term), similar to the dose used clinically in humans (Brownfoot et al. 2013), although the increased glucose-stimulated insulin secretion is suggestive of insulin resistance (Moss et al. 2001). The latter is similar to the findings of the follow-up study of 30-year-old men (Dalziel et al. 2005) born in the first human RCT of antenatal betamethasone for the prevention of neonatal respiratory distress syndrome (Auckland Steroid Trial, Liggins & Howie 1972). In that cohort, antenatal exposure to betamethasone increased early plasma insulin concentrations during an oral glucose tolerance test by 16%, suggesting development of insulin resistance, although these individuals had normal glucose tolerance (Dalziel et al. 2005). Interestingly, although ~30% of the cohort went on to be born at term, correcting for GA did not remove the effect of prior betamethasone exposure on glucose-stimulated insulin concentration (Dalziel et al. 2005). In contrast to the effects of betamethasone on insulin sensitivity, clinical doses of dexamethasone that induced preterm delivery at 137 days’ GA did not impair glucose tolerance or insulin secretion during IVGTT in adult ovine progeny (Bansal et al. 2015). These did, however, the capacity for sustained in vivo insulin secretion and induced profound reduction in β-cell mass in juvenile and adult progeny (Bansal et al. 2015). In the present study, we found similar insulin secretion in preterm-born adult sheep at 0.9 of gestation after antenatal betamethasone treatment compared to controls born at term. Consistent with this, we also did not see differences in β-cell mass or function between preterm and term sheep in the present cohort. The available evidence in humans also suggests little effect of preterm birth on insulin secretion. This includes a lack of relationship between GA and basal and first-phase insulin release in children at 5–7 years of age (Bazaes et al. 2004), similar disposition index in adults born moderate–late preterm or at term (Mathai et al. 2012), and increases in insulin secretion that compensated for insulin resistance in young adults born preterm at very low birth weight (Kajantie et al. 2014). Overall, these results suggest that antenatal glucocorticoid exposure before preterm birth adversely affects metabolic outcomes in progeny, although betamethasone may programme insulin resistance while dexamethasone impairs insulin secretion. Direct comparisons of metabolic outcomes after antenatal exposure to clinical doses of these two widely used glucocorticoids are needed to directly test whether there are long-term differences in the effects of betamethasone and dexamethasone, and whether these effects depend on the timing of delivery relative to exposure.
Sex-specific effects
In the present study, we also investigated the molecular mechanisms underlying effects of preterm birth on insulin sensitivity by assessing insulin signalling and glucose transporter genes. Consistent with the trend for increased, rather than decreased insulin sensitivity in preterm sheep, we found greater gene expression of SLC2A4, PRKAA2 and PRKAG2 in skeletal muscle in preterm than in term sheep. Furthermore, this effect was sex-specific, with greater effects observed in males, although whole-body insulin sensitivity measured by HEC did not vary between sexes, consistent with variable or no sex differences in this outcome reported in previous studies of adult sheep (Gatford et al. 2004, Owens et al. 2007, Liu et al. 2015, Donovan et al. 2016).
The sex-specific effects of preterm birth on gene expression of the insulin signalling pathway in the present study is consistent with the concept that preterm birth induces greater long-term impacts in males than females. Males are also more susceptible to the short-term adverse effects of preterm birth, with higher rates of morbidity than females after preterm birth in sheep after sub-clinical glucocorticoid doses (De Matteo et al. 2010) and clinically in humans (Liggins & Howie 1972). Nevertheless, neonatal outcomes did not differ between sexes in the present cohort of sheep following clinical doses of betamethasone (Nguyen et al. 2016).
Conclusions
Contrary to results of human epidemiological studies, our study showed that induced preterm birth at 0.9 of gestation after antenatal betamethasone exposure did not impair insulin sensitivity or secretion in young adult sheep, compared to induced term-born progeny. Surprisingly, gene expression of insulin signalling pathway components were increased in skeletal muscle and particularly in males. These results suggest that preterm birth with antenatal glucocorticoids does not impair glucose control and insulin action at least in young adults. Whether defects might be exposed with ageing or with additional challenges such as obesity is unknown. Together with findings of previous studies of young adult progeny in sheep (Moss et al. 2001, Long et al. 2012, Bansal et al. 2015), our results suggest that effects of antenatal exposure may differ between betamethasone and dexamethasone, and also depend on timing of delivery. Direct comparisons of metabolic outcomes of antenatal treatment with betamethasone and dexamethasone, the two glucocorticoids in widespread clinical use (Brownfoot et al. 2013), in both preterm and spontaneously term-delivered progeny are required in preclinical models to test this hypothesis and allow detailed mechanistic investigations that are not possible within current clinical RCTs.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Health and Medical Research Council of Australia (project grant APP1011354).
Author contribution statement
R De M, G P, M J B and K L G were responsible for study design. R De M, D J H, T B-M, V N, B J A, G P and K L G were responsible for data acquisition. R De M, D J H, T B-M and K L G contributed to data analysis. K L G wrote and all the authors revised and approved the final manuscript.
Acknowledgements
Preliminary data from this study was presented at the Fetal and Neonatal Physiology Workshop, Perth, Australia in 2014 and the Perinatal Society of Australia and New Zealand Annual Conference, Melbourne, Australia in 2015.
References
Ananth CV, Friedman AM & Gyamfi-Bannerman C 2013 Epidemiology of moderate preterm, late preterm and early term delivery. Clinics in Perinatology 40 601–610. (doi:10.1016/j.clp.2013.07.001)
Bansal A, Bloomfield FH, Connor KL, Dragunow M, Thorstensen EB, Oliver MH, Sloboda DM, Harding JE & Alsweiler JM 2015 Glucocorticoid-induced preterm birth and neonatal hyperglycemia alter ovine β-cell development. Endocrinology 156 3763–3776. (doi:10.1210/en.2015-1095)
Bazaes RA, Alegría A, Pittaluga E, Ávila A, Íñiguez G & Mericq V 2004 Determinants of insulin sensitivity and secretion in very-low-birth-weight children. Journal of Clinical Endocrinology and Metabolism 89 1267–1272. (doi:10.1210/jc.2003-031239)
Bensley JG, Stacy VK, De Matteo R, Harding R & Black MJ 2010 Cardiac remodelling as a result of pre-term birth: implications for future cardiovascular disease. European Heart Journal 31 2058–2066. (doi:10.1093/eurheartj/ehq104)
Brownfoot FC, Gagliardi DI, Bain E, Middleton P & Crowther CA 2013 Different corticosteroids and regimens for accelerating fetal lung maturation for women at risk of preterm birth. Cochrane Database of Systematic Reviews 8 Art. No.: CD006764. (doi:10.1002/14651858.CD006764.pub3)
Dalziel SR, Walker NK, Parag V, Mantell C, Rea HH, Rodgers A & Harding JE 2005 Cardiovascular risk factors after antenatal exposure to betamethasone: 30-year follow-up of a randomised controlled trial. Lancet 365 1856–1862. (doi:10.1016/S0140-6736(05)66617-2)
De Blasio MJ, Gatford KL, McMillen IC, Robinson JS & Owens JA 2007 Placental restriction of fetal growth increases insulin action, growth and adiposity in the young lamb. Endocrinology 148 1350–1358. (doi:10.1210/en.2006-0653)
De Blasio MJ, Gatford KL, Harland ML, Robinson JS & Owens JA 2012 Placental restriction reduces insulin sensitivity and expression of insulin signaling and glucose transporter genes in skeletal muscle, but not liver, in young sheep. Endocrinology 153 2142–2151. (doi:10.1210/en.2011-1955)
De Matteo R, Stacy V, Probyn ME, Brew N, Blasch N & Harding R 2008 Does moderate preterm birth lead to altered arterial pressure? Studies in sheep. Clinical and Experimental Pharmacology and Physiology 35 1426–1432. (doi:10.1111/j.1440-1681.2008.05014.x)
De Matteo R, Snibson K, Thompson B, Koumoundouros E & Harding R 2009 Lung function in developing lambs: is it affected by preterm birth? Journal of Applied Physiology 107 1083–1088. (doi:10.1152/japplphysiol.00129.2009)
De Matteo R, Blasch N, Stokes V, Davis P & Harding R 2010 Induced preterm birth in sheep: a suitable model for studying the developmental effects of moderately preterm birth. Reproductive Sciences 17 724–733. (doi:10.1177/1933719110369182)
DeFronzo RA & Tripathy D 2009 Skeletal muscle insulin resistance is the primary defect in type 2 diabetes. Diabetes Care 32 S157–S163. (doi:10.2337/dbib9-S302)
Derks JB, Giussani DA, Van Dam LM, Jenkins SL, Winter JA, Zhao XF, Hammond GL & Nathanielsz PW 1996 Differential effects of betamethasone and dexamethasone fetal administration of parturition in sheep. Journal of the Society for Gynecologic Investigation 3 336–341. (doi:10.1016/S1071-5576(96)00024-X)
Donovan EL, Buckels EJ, Hancock S, Smeitink D, Oliver MH, Bloomfield FH & Jaquiery AL 2016 Twin conception in sheep leads to impaired insulin sensitivity and sexually dimorphic adipose tissue and skeletal muscle phenotypes in adulthood. Reproductive Sciences [in press]. (doi:10.1177/1933719116670516)
Galinsky R, Polglase GR, Hooper SB, Black MJ & Moss TJ 2013 The consequences of chorioamnionitis: preterm birth and effects on development. Journal of Pregnancy 2013 412831. (doi:10.1155/2013/412831)
Gatford KL, De Blasio MJ, Thavaneswaran P, Robinson JS, McMillen IC & Owens JA 2004 Postnatal ontogeny of glucose homeostasis and insulin action in sheep. American Journal of Physiology 286 E1050–E1059. (doi:10.1152/ajpendo.00340.2003)
Gatford KL, Mohammad SNB, Harland ML, De Blasio MJ, Fowden AL, Robinson JS & Owens JA 2008 Impaired β-cell function and inadequate compensatory increases in β-cell mass following intrauterine growth restriction in sheep. Endocrinology 149 5118–5127. (doi:10.1210/en.2008-0233)
Gatford KL, Simmons RA, De Blasio MJ, Robinson JS & Owens JA 2010 Review: placental programming of postnatal diabetes and impaired insulin action after IUGR. Placenta 31 S60–S65. (doi:10.1016/j.placenta.2009.12.015)
Gatford KL, De Blasio MJ, How TA, Harland ML, Summers-Pearce BL & Owens JA 2012 Testing the plasticity of insulin secretion and β-cell function in vivo: responses to chronic hyperglycaemia in the sheep. Experimental Physiology 97 663–675. (doi:10.1113/expphysiol.2011.063560)
Hao XQ, Du JX, Li Y, Li M & Zhang SY 2014 Prenatal exposure to lipopolysaccharide combined with pre- and postnatal high-fat diet result in lowered blood pressure and insulin resistance in offspring rats. PLoS ONE 9 e88127. (doi:10.1371/journal.pone.0088127)
Jaquet D, Vidal H, Hankard R, Czernichow P & Levy-Marchal C 2001 Impaired regulation of glucose transporter 4 gene expression in insulin resistance associated with in utero undernutrition. Journal of Clinical Endocrinology and Metabolism 86 3266–3271. (doi:10.1210/jc.86.7.3266)
Jensen CB, Martin-Gronert MS, Storgaard H, Madsbad S, Vaag A & Ozanne SE 2008 Altered PI3-Kinase/Akt signalling in skeletal muscle of young men with low birth weight. PLoS ONE 3 e3738. (doi:10.1371/journal.pone.0003738)
Kaijser M, Edstedt Bonamy A-K, Akre O, Cnattingius S, Granath F, Norman M & Ekbom A 2009 Perinatal risk factors for diabetes in later life. Diabetes 58 523–526. (doi:10.2337/db08-0558)
Kajantie E, Osmond C, Barker DJP & Eriksson JG 2010 Preterm birth—a risk factor for Type 2 diabetes? Diabetes Care 33 2623–2625. (doi:10.2337/dc10-0912)
Kajantie E, Strang-Karlsson S, Hovi P, Wehkalampi K, Lahti J, Kaseva N, Järvenpää A-L, Räikkönen K, Eriksson JG & Andersson S 2014 Insulin sensitivity and secretory response in adults born preterm: the Helsinki study of very low birth weight adults. Journal of Clinical Endocrinology and Metabolism 100 244–250. (doi:10.1210/jc.2014-3184)
Kjems LL, Volund A & Madsbad S 2001 Quantification of beta-cell function during IVGTT in Type II and non-diabetic subjects: assessment of insulin secretion by mathematical methods. Diabetologia 44 1339–1348. (doi:10.1007/s001250100639)
Koressaar T & Remm M 2007 Enhancements and modifications of primer design program Primer3. Bioinformatics 23 1289–1291. (doi:10.1093/bioinformatics/btm091)
Larsen M & Kristensen NB 2013 Precursors for liver gluconeogenesis in periparturient dairy cows. Animal 7 1640–1650. (doi:10.1017/S1751731113001171)
Lawlor D, Davey Smith G, Clark H & Leon D 2006 The associations of birthweight, gestational age and childhood BMI with type 2 diabetes: findings from the Aberdeen Children of the 1950s cohort. Diabetologia 49 2614–2617. (doi:10.1007/s00125-006-0408-z)
Levitz M, Jansen V & Dancis J 1978 The transfer and metabolism of corticosteroids in the perfused human placenta. American Journal of Obstetrics and Gynecology 132 363–366. (doi:10.1016/0002-9378(78)90768-8)
Li Z, Zeki R, Hilder L & Sullivan EA 2013 Australia’s Mothers and Babies 2011. Canberra, Australia: AIHW National Perinatal Epidemiology and Statistics Unit.
Liggins GC 1969 Premature delivery of foetal lambs infused with glucocorticoids. Journal of Endocrinology 45 515–523. (doi:10.1677/joe.0.0450515)
Liggins GC & Howie RN 1972 A controlled trial of antepartum glucocorticoid treatment for prevention of the respiratory distress syndrome in premature infants. Pediatrics 50 515–525.
Liu H, Schultz CG, De Blasio MJ, Peura AM, Heinemann GK, Harryanto H, Hunter DS, Wooldridge AL, Kind KL & Giles LC et al. 2015 Effect of placental restriction and neonatal exendin-4 treatment on postnatal growth, adult body composition and in vivo glucose metabolism in the sheep. American Journal of Physiology: Endocrinology and Metabolism 309 E589–E600. (doi:10.1152/ajpcell.00028.2015)
Long NM, Shasa DR, Ford SP & Nathanielsz PW 2012 Growth and insulin dynamics in two generations of female offspring of mothers receiving a single course of synthetic glucocorticoids. American Journal of Obstetrics and Gynecology 207 203.e201–203.e208. (doi:10.1016/j.ajog.2012.06.024)
Magyar DM, Fridshal D, Elsner CW, Glatz T, Eliot J, Klein AH, Lowe KC, Buster JE & Nathanielsz PW 1980 Time-trend analysis of plasma cortisol concentrations in the fetal sheep in relation to parturition. Endocrinology 107 155–159. (doi:10.1210/endo-107-1-155)
Mathai S, Cutfield WS, Derraik JGB, Dalziel SR, Harding JE, Robinson E, Biggs J, Jefferies C & Hofman PL 2012 Insulin sensitivity and β-cell function in adults born preterm and their children. Diabetes 61 2479–2483. (doi:10.2337/db11-1672)
Miller SA, Dykes DD & Polesky HF 1988 A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research 16 1215. (doi:10.1093/nar/16.3.1215)
Moss TJM, Sloboda DM, Gurrin LC, Harding R, Challis JRG & Newnham JP 2001 Programming effects in sheep of prenatal growth restriction and glucocorticoid exposure. American Journal of Physiology 281 R960–R970.
National Health and Medical Research Council of Australia 2004 Australian Code of Practice for the Care and Use of Animals for Scientific Purposes, 7th edition. Canberra, Australia: Australian Government Publishing Service.
Nguyen VB, De Matteo R, Harding R, Stefanidis A, Polglase GR & Black MJ 2016 Experimentally induced preterm birth in sheep following a clinical course of antenatal betamethasone: effects on growth and long-term survival. Reproductive Sciences [in press].
Owens JA, Thavaneswaran P, De Blasio MJ, McMillen IC, Robinson JS & Gatford KL 2007 Sex-specific effects of placental restriction on components of the metabolic syndrome in young adult sheep. American Journal of Physiology 292 E1879–E1889. (doi:10.1152/ajpendo.00706.2006)
Ozanne SE, Jensen CB, Tingey KJ, Storgaard H, Madsbad S & Vaag AA 2005 Low birthweight is associated with specific changes in muscle insulin-signalling protein expression. Diabetologia 48 547–552. (doi:10.1007/s00125-005-1669-7)
Petersen MC, Collier CB, Ashley JJ, McBride WG & Nation RL 1983a Disposition of betamethasone in parturient women after intravenous administration. European Journal of Clinical Pharmacology 25 803–810. (doi:10.1007/BF00542524)
Petersen MC, Nation RL, McBride WG, Ashley JJ & Moore RG 1983b Pharmacokinetics of betamethasone in healthy adults after intravenous administration. European Journal of Clinical Pharmacology 25 643–650. (doi:10.1007/BF00542353)
Phillips ID, Simonetta G, Owens JA, Robinson JS, Clarke IJ & McMillen C 1996 Placental restriction alters the functional development of the pituitary-adrenal axis in the sheep fetus during late gestation. Pediatric Research 40 861–866. (doi:10.1203/00006450-199612000-00014)
Pilgaard K, Færch K, Carstensen B, Poulsen P, Pisinger C, Pedersen O, Witte D, Hansen T, Jørgensen T & Vaag A 2010 Low birthweight and premature birth are both associated with type 2 diabetes in a random sample of middle-aged Danes. Diabetologia 53 2526–2530. (doi:10.1007/s00125-010-1917-3)
Ponec M, Kempenaar J, Shroot B & Caron JC 1986 Glucocorticoids: binding affinity and lipophilicity. Journal of Pharmaceutical Sciences 75 973–975. (doi:10.1002/jps.2600751013)
Roberts D & Dalziel S 2006 Antenatal corticosteroids for accelerating fetal lung maturation for women at risk of preterm birth. Cochrane Database of Systematic Reviews 3 Art. No.: CD004454. (doi:10.1002/14651858.CD004454.pub2)
Rotteveel J, van Weissenbruch MM, Twisk JWR & Delemarre-Van de Waal HA 2008 Infant and childhood growth patterns, insulin sensitivity, and blood pressure in prematurely born young adults. Pediatrics 122 313–321. (doi:10.1542/peds.2007-2012)
Rotteveel J, van Weissenbruch MM, Twisk JWR & Delemarre-van de Waal HA 2011 Insulin sensitivity in prematurely born adults: relation to preterm growth restraint. Hormone Research in Paediatrics 75 252–257. (doi:10.1159/000322257)
Silver M 1988 Effects on maternal and fetal steroid concentrations of induction of parturition in the sheep by inhibition of 3 beta-hydroxysteroid dehydrogenase. Journal of Reproduction and Fertility 82 457–465. (doi:10.1530/jrf.0.0820457)
Tanigawa K, Nagase H, Ohmori K, Tanaka K, Miyake H, Kiniwa M & Ikizawa K 2002 Species-specific differences in the glucocorticoid receptor transactivation function upon binding with betamethasone-esters. International Immunopharmacology 2 941–950. (doi:10.1016/S1567-5769(02)00036-X)
Tinnion R, Gillone J, Cheetham T & Embleton N 2013 Preterm birth and subsequent insulin sensitivity: a systematic review. Archives of Disease in Childhood 99 362–368. (doi:10.1136/archdischild-2013-304615)
Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M & Rozen SG 2012 Primer3 – new capabilities and interfaces. Nucleic Acids Research 40 e115. (doi:10.1093/nar/gks596)
Vaag A, Jensen CB, Poulsen P, Brøns C, Pilgaard K, Grunnet L, Vielwerth S & Alibegovic A 2006 Metabolic aspects of insulin resistance in individuals born small for gestational age. Hormone Research 65 (Supplement 3) 137–143. (doi:10.1159/000091519)
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A & Speleman F 2002 Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3 research0034.1. (doi:10.1186/gb-2002-3-7-research0034)
Willemsen RH, Leunissen RWJ, Stijnen T & Hokken-Koelega ACS 2009 Prematurity is not associated with reduced insulin sensitivity in adulthood. Journal of Clinical Endocrinology and Metabolism 94 1695–1700. (doi:10.1210/jc.2008-1769)
