Abstract
We reported thyroid hormone (TH) receptor expression in murine dendritic cells (DCs) and 3,5,3′-triiodothyronine (T3)-dependent stimulation of DC maturation and ability to develop a Th1-type adaptive response. Moreover, an increased DC capacity to promote antigen-specific cytotoxic T-cell activity, exploited in a DC-based antitumor vaccination protocol, was revealed. However, putative effects of the main circulating TH, l-thyroxine (T4) and the mechanisms of TH transport and metabolism at DC level, crucial events for TH action at target cell level, were not known. Herein, we show that T4 did not reproduce those registered T3-dependent effects, finding that may reflect a homoeostatic control to prevent unspecific systemic activation of DCs. Besides, DCs express MCT10 and LAT2 TH transporters, and these cells mainly transport T3 with a favored involvement of MCT10 as its inhibition almost prevented T3 saturable uptake mechanism and reduced T3-induced IL-12 production. In turn, DCs express iodothyronine deiodonases type 2 and 3 (D2, D3) and exhibit both enzymatic activities with a prevalence towards TH inactivation. Moreover, T3 increased MCT10 and LAT2 expression and T3 efflux from DCs but not T3 uptake, whereas it induced a robust induction of D3 with a parallel slight reduction in D2. These findings disclose pivotal events involved in the mechanism of action of THs on DCs, providing valuable tools for manipulating the immunogenic potential of these cells. Furthermore, they broaden the knowledge of the TH mechanism of action at the immune system network.
Introduction
Thyroid hormones (THs) are critical regulators of cellular differentiation, growth and metabolism. The thyroid secretes 100% of circulating thyroxine (T4). However, it provides a low percentage of serum levels of the most physiologically active TH: 3,5,3′-triiodothyronine (T3), the major part of which is derived from peripheral 5′ deiodination of T4 (Williams & Bassett 2011).
Cellular activity of THs is classified as genomic (nuclear) and nongenomic (initiated either in the cytoplasm or at the plasma membrane). However, the main mechanism of TH action requires the participation of T3 and its nuclear receptors (TRs): TRα1, TRβ1, TRβ2, and TRβ3, whereas other non-T3-binding isoforms are also expressed (Bernal et al. 2015). It is noteworthy that the action of TH requires the proper interplay among cellular TH transporters, TH deiodinases and TRs expression (Williams & Bassett 2011, Kwakkel et al. 2014).
The uptake–efflux of THs by target cells is facilitated by proteins with different specificities for iodothyronine transport. The main TH transporters include monocarboxylate transporters (MCT) 8 and 10, organic anion transporter polypeptides (OATP) 1C1 and large neutral amino acid transporters (LAT) 1 and 2. MCT8, MCT10 and LATs have higher affinity for T3 uptake than T4 (Bernal et al. 2015).
The concentrations of THs at cellular level are regulated by the activity of three selenoproteins termed type 1, 2 and 3 iodothyronine deiodinases (D1, 2 and 3 encoded by Dio 1, 2 and 3 genes). D1 and D2 catalyze the outer ring deiodination that converts T4 to T3, whereas D3 deiodinates the inner ring iodides, thus initiating the conversion of T4 and T3 in inactive metabolites. Therefore, D2 is considered an ‘activating’ enzyme, responsible for the peripheral production of 50–80% of the total body pool of T3. Conversely, D3 restrains T3 action in target cells. TH transporters and deiodinases exhibit a particular expression profile that is cellular and metabolic state specific, as well as characteristic in several pathological conditions (Williams & Bassett 2011, Kwakkel et al. 2014, Bernal et al. 2015).
The effects of THs on several immune cells and their functions have been reported (De Vito et al. 2011, 2012, Cremaschi et al. 2016). However, studies on the impact of THs on the initiation of adaptive immunity at the level of antigen-presenting cells (APCs) are just emerging. We provided the first evidence of the expression of TRs, mainly the β1 isoform, and demonstrated that T3 contributes to the maturation of the main APC: dendritic cells (DCs). A Th1-lymphocyte T adaptive response induced by physiologic levels of T3 was also revealed (Mascanfroni et al. 2008). Mechanistically, these effects involved the activation of Akt and NF-kB pathways (Mascanfroni et al. 2010) and were counteracted by glucocorticoids (Montesinos et al. 2012). Moreover, we recently revealed that T3 endows DCs with enhanced ability to stimulate cytotoxic T-cell responses with implications in DC-based immunotherapy (Alamino et al. 2015). However, the effect of T4 at DC level and the mechanisms of TH entrance and metabolization in DCs were unknown and disclosed in this work. The results obtained unravel new insights into TH action at the initiation of the immune response and provide tools for the manipulation of the potential immunogenicity of DCs, with profound impact on immunotherapy. To the best of our knowledge, this is the first systematic report of both mechanisms fully dissected in a cell from the immune system.
Materials and methods
Materials
[125I]T3 and [125I]T4 were from Perkin Elmer Life and Analytical Sciences (Boston, MA, USA). Nonradioactive iodothyronines and leucine were from Sigma. Materials were from cell culture and of molecular biology grade.
Mice
Female C57BL/6 mice (B6; H-2b) were obtained from Ezeiza Atomic Center (Argentina). Mice were maintained under specific pathogen-free conditions and used when they were aged 6–10 weeks. Animal protocols were in compliance with the Guide for the Care and Use of Laboratory Animals published by the NIH and the local institutional animal care committee.
DCs preparation and culture
Immature bone marrow DCs (iDCs) were obtained as described (Mascanfroni et al. 2008). Briefly, bone marrow progenitors were collected from the femurs of 6- to 10-week-old female C57BL/6 mice and cultured in RPMI-1640 10% fetal calf serum (FCS) depleted of THs by treatment with resin AG-1-X8 (Bio-Rad Laboratories) in the presence of granulocyte–macrophage colony-stimulating factor (GM-CSF) from supernatant of the J558 cell line and fed every 2 days. At day 10 of cell culture, >85% of the harvested cells expressed MHC class II, CD40, CD80 and CD11c, but not Gr-1. Immature DCs were cultured with T3 (5 nM) for 18 h (that induce DC maturation: mDCs) or with T4 at times and concentrations indicated. Parallel cultures were maintained without stimuli as controls. To rule out endotoxin contamination of T3 and T4 preparations, we checked the endotoxin content that raised levels lower than 0.03 IU/mL (limit of detection) by the Limulus amebocyte lysate assay.
Flow cytometric analysis
Intracellular IL-12 and CD11c detection by flow cytometry was performed as previously described (Alamino et al. 2015) using the following fluorochrome-conjugated monoclonal antibodies (mAbs): fluorescein isothiocyanate (FITC)-anti-CD11c and phycoerythrin (PE)-anti-IL-12 (BD Biosciences, San Jose, CA, USA).
Cytokine determination
IL-12p70 detection was performed in cell culture supernatants using standard capture enzyme-linked immunosorbent assays (ELISA), as reported (Montesinos et al. 2012). Briefly, coating antibody included a rat anti-mouse IL-12p70 mAb (clone C15.6, BD Biosciences). Detection antibody included biotinylated rat anti-mouse IL-12p70 mAb (clone C17.8, BD Biosciences). Streptavidin-horseradish peroxidase and 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt (Sigma) were used as enzyme and substrate, respectively.
Reverse transcription (RT) and polymerase chain reaction (PCR)
Cells were homogenized with TRIzol (Sigma), and RNA extraction was performed according to the manufacturer’s recommended protocol. mRNA was reverse transcribed and amplified by PCR essentially as described (Mascanfroni et al. 2008). Gene-specific primer sets to amplify TH transporters (Mct8, Mct10, Oatp1c1, Lat1 and Lat2) and iodothyronine deiodinases (Dio 1, 2 and 3) mRNAs were from Sigma (Buenos Aires, Argentina, Table 1). Mct8, Oatp1c1, Lat1, Lat2 and Dio1 primers were designed to distinguish cDNA and genomic DNA/pseudogenes linking the sequences of 2 exons and excluding an intron (Kreuzer & Neece 1999). For Dio 2 and 3 mRNA, as the primers were designed in an exon region, genomic DNA contamination was excluded by performing parallel no RT control reactions. The expressions of these mRNAs were normalized using β-actin mRNA. The PCR amplification was performed on an ICycler PCR System (Bio-Rad). The mass of total RNA for RT, the number of cycles and thermal profile for PCR, and MgCl2, primer and dNTP concentrations were selected experimentally (data not shown). RT-PCR products were resolved by electrophoresis in 2% agarose gels followed by ethidium bromide staining. Specific target amplification was confirmed by automatic sequencing (Macrogen, Seul, Korea).
Mouse primers for conventional RT-PCR and RT-qPCR (SYBR GREEN) analysis.
Name | Primer | Name | Primer |
---|---|---|---|
Mct8 | Forward: CCCATTGCATTTGAGCTGGTG | Lat2 | Forward: GATAGTCCTTCGCTGGAAGAAGC |
(NM_009197.2) | Reverse: TTGATGCATCAGAGGGACGAAG | (NM_016972.2) | Reverse: GGGTTTGTGTTGCCAGTAGACAC |
Mct10 | Forward: CTAGTTGGTCCTCAGGATGCTTC | Dio1 | Forward: GTGGTGGACACAATGCAGAAC |
(NM_001114332.1) | Reverse: GGGATTAAACAGAGCACAACACC | (NM_007860.3) | Reverse: GTGTCTAGGTGGAGTGCAAAGC |
Oatp1c1 | Forward: GTGGGGACAATGGGATTACC | Dio2 | Forward: GCCACCTGACCACCTTTCA |
(NM_013797.5) | Reverse: CTTTCTGACACCTGCCCATC | (NM_010050.2) | Reverse: CTTGGTTCCGGTGCTTCTTAA |
Lat1 | Forward: TCAGCTTCTTCAACTGGCTGTG | Dio3 | Forward: AACTCTAGCAGTTCCGCATATGG |
(NM_011404.3) | Reverse: GCTTGTTCTTCCACCAGACACC | (NM_172119.2) | Reverse: CCCACCAATTCAGTCACTTGTC |
Quantitative PCR (qPCR)
qPCR analysis was carried out using an ABI Prism 7500 detection system (Applied Biosystems) and SYBR green chemistry as described (Alamino et al. 2015). qPCR efficiency for each pair of primers was calculated using standard curves generated by serial dilutions of cDNA from DCs. All qPCR efficiencies ranged between 96% and 102% in different assays. mRNA levels are shown normalized against the housekeeping gene β-actin mRNA. We also used TATA box-binding protein and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) to normalize target mRNAs obtaining similar results (data not shown).
Preparation of total cell extracts
Cells were resuspended in RIPA buffer with protease inhibitors, disrupted by passages through a 25-G needle and incubated on ice followed by removal of DNA and debris by centrifugation. The supernatant was frozen at −80°C. Protein concentration was measured by the Bradford method (Bradford 1976).
Western blot analysis
Total cell lysates of DCs were used for immunodetection of MCT10 (55 kDa), LAT2 (58 kDa), D2 (31 kDa) and D3 (32 kDa) by Western blot analysis performed as described (Alamino et al. 2015). Abs against MCT10 (ab171649), LAT2 (ab75610), D2 (ab135711) and D3 (ab82041) (Abcam) were used. β-actin (Sigma) was used as loading control. To note, positive controls were selected in accordance to the data sheet provided by the supplier, but Western blots lacked a negative control. Signals were detected using the Odyssey Imaging System (LI-COR, Lincoln, NE, USA). Band intensities were evaluated using ImageJ software (NIH).
TH transport experiments
TH transport through DCs’ membranes was evaluated as described (Visser et al. 2009, Loubiere et al. 2012, Zevenbergen et al. 2015). In brief, cells were washed with incubation medium (Dulbecco’s PBS containing 0.1% d-glucose and 0.1% BSA). Uptake of THs was tested by incubation (3–90 min) of the cells at 37°C with 1 nM (100 × 105 cpm) [125I]T3 or [125I]T4 in 1.5 mL incubation medium. Thereafter, cells were thoroughly washed with TH-free medium, lysed with 0.1 M NaOH and radioactivity was measured in a γ-counter. The uptake of [125I]T3 or [125I]T4 through TH transporters was inhibited by nonradioactive iodothyronines, bromsulfophthalein (BSP, MCT10 inhibitor) and/or leucine (Leu, LAT2 inhibitor) at concentrations previously reported (Visser et al. 2009, Loubiere et al. 2012). The Michaelis–Menten constant (Km) and the half maximal inhibitory concentration (IC50) were calculated from the GraphPad Prism (GraphPad Software 5.01). Dose–response inhibition curve was obtained by plotting the uptake percentage vs unlabeled THs concentration (Feng et al. 2015).
For measurement of TH efflux of TH transport at DC level, we followed the methods previously described (Visser et al. 2009). Cells were loaded for 30 min with incubation medium containing 1 nM [125I]T3 or [125I]T4, briefly washed with incubation medium, and subsequently incubated (0–60 min) with efflux medium (Dulbecco’s PBS containing 0.1% d-glucose and 1% BSA). After incubation, cells were washed with incubation medium, lysed with 0.1 M NaOH and radioactivity was measured in a γ-counter. To allow evaluation of Na+ dependence of the [125I]T3 or [125I]T4 uptake, cells were incubated in a buffer containing 142.9 mM NaCl, 4.7 mM KCl, 1.2 mM MgSO4, 1.2 mM KH2PO4, 1.8 mM CaCl2, 20 mM HEPES and 0.1% BSA (pH 7.4) or in medium in which Na+ was replaced with an equimolar concentration of choline (Visser et al. 2009).
Cell death assays
Cell death by necrosis and/or apoptosis of BSP and Leu-treated DCs was measured by flow cytometry using the PE–Annexin V-binding assay and 7-aminoactinomycin D (7-AAD; BD Biosciences), as we previously described (Alamino et al. 2015).
D2 and D3 activity assays
The activities of D2 and D3 were evaluated as previously described for other cellular systems (Wajner et al. 2011, Louzada et al. 2014), respectively. For D2 activity determination, DCs’ samples (5 × 106 cells/each) were homogenized in 150 mM sodium phosphate buffer containing 1 mM EDTA, 250 mM sucrose and 10 mM DTT (pH 6.9). Forty micrograms of protein of total homogenates from DCs were incubated in duplicate for 3 h at 37°C with [125I]T4 previously purified with Sephadex LH-20, 1 mM propylthiouracil (PTU, to inhibit any D1 activity) and 20 mM DTT in 100 mM potassium phosphate buffer (pH 6.9) containing 1 mM EDTA and 1 nM of T4 in a final reaction volume of 300 μL. Specific D2 activity measurements were confirmed by the inhibition of deiodination reaction in the presence of T4 in excess (100 nM). Blank incubations were carried out in the absence of protein. The reaction was stopped at 4°C in an ice bath with the addition of 200 μL FCS (Gibco) and 100 μL trichloroacetic acid (50%, v/v) followed by vigorous agitation. The samples were centrifuged at 10,000 g for 3 min, and 360 μL of supernatant was collected for the measurement of 125I liberated during the deiodination reaction, using a γ-counter. D2 activity was expressed as deiodinated T4 in fmol/min/mg protein. Of note is that we used 3′-5′-[125I]T4 as substrate for D2 measurements, and thus, only the outer ring deiodination was detected. Regarding D3 activity measurement, cells were homogenized and sonicated with 10 mM Tris–HCl, 250 mM sucrose buffer (pH 7.5) and 10 mM DTT. The homogenates were incubated for 1 h with 200,000 cpm [125I]T3, 2 nM T3, 20 mM DTT, and 1 mM PTU. The addition of 200 nM of T3 completely abolished D3 activity in all samples (data not shown). The reaction was stopped by adding 200 μL ethanol 95%, 50 μL NaOH (0.04 M) and 5 mg PTU. Deiodination was determined based on the amount of [125I]T2 produced after reaction products separation by paper chromatography. Results were expressed as the fraction of T2 counts minus the nonspecific deiodination (always <1.5%), obtained with the saturating concentration of T3 (200 nM). D3 activity was expressed as [125I]T2 in fmol produced/min/mg protein. The quantity of protein assayed was adjusted to ensure that <30% of the substrate was consumed.
Statistical analysis
The analysis of intergroup differences (three or more groups) was conducted by one-way analysis of variance (ANOVA), followed by the Student–Newman–Keuls test. For the analysis of differences between two groups, the statistical significance was determined using the Student’s t test for unpaired observations. P values less than 0.05 were considered statistically significant. All experiments were performed at least in triplicate.
Results
T4 did not induce DC maturation and function, as T3 does
We demonstrated relevant findings regarding T3 action in the initiation of adaptive immunity (Mascanfroni et al. 2008, 2010, Montesinos et al. 2012, Alamino et al. 2015). However, T4 is the main TH secreted by the thyroid and the major TH in circulation, fourfold higher considering free hormone levels (Williams & Bassett 2011). Therefore, the effect of T4 on sensitive DC maturation/function parameters was assayed. For this purpose, murine bone marrow-derived immature DCs (iDCs) were treated with T4 (from sub- to supra-physiological levels, as found in mice circulation), and IL-12 production and secretion were measured following the experimental protocol carried out with T3 (Mascanfroni et al. 2008). As shown in Fig. 1, T4 at 10−8–10−6 M for 18 h did not induce any significant modification in IL-12 production by DCs (Fig. 1A) or IL-12 secreted to the medium (Fig. 1B), as T3 does. Time course studies (18–36 h) neither revealed any significant change (Fig. 1C) in IL-12 released. These results show that TH endowment of DCs with enhanced ability to simulate T-cell responses is depending on T3.
MCT10 and LAT2 transporters are expressed in DCs and transport THs, mainly T3
To further delve into TH action at DC level, the study of TH transport across the DC cell membrane became mandatory. At first, we examined the expression of MCT8, MCT10, OATP1C1, LAT1 and LAT2 in iDCs, at mRNA and protein levels, by conventional RT-PCR and Western blot, respectively. Figure 2A shows that iDCs express mRNAs for Mct10 and Lat2, but not for Mct8, Oatp1c1 or Lat1. These results are in agreement with MCT10 and LAT2 protein expression (Fig. 2B) at comparable levels, although at lesser extent than their positive controls (K562 and HeLa cells). Altogether, these findings highly suggest that MCT10 and/or LAT2 may be involved in TH transport into DCs.
We next attempted to further characterize the process of TH transport at DC level. We assessed [125I]T3 and [125I]T4 (1 nM) uptake by iDCs, as previously reported (Visser et al. 2009). Time course analysis demonstrated that both THs were transported by these cells, although cellular uptake of [125I]T3 was significantly higher than that of [125I]T4 at all times evaluated, about 5.7 times at 90 min (Fig. 3A) and revealing that at equal concentrations, the main TH that gets into DCs is T3. Of note is that the rate of [125I]T3 uptake (%) increased linearly for 30 min and decreased thereafter, in a similar fashion to other TH-responsive cells (Visser et al. 2009). Afterwards, we evaluated the effects of increasing concentrations of unlabeled iodothyronines on [125I]T3 uptake. As depicted in Fig. 3B, a dose-dependent reduction of [125I]T3 uptake was observed after the addition of increasing concentrations of unlabeled iodothyronines, T3 or T4. As shown, there are two uptake processes, in agreement with other cellular systems (Visser et al. 2009, Loubiere et al. 2012). In this regard, one of them is not saturated for T3 or T4 concentrations up to 10 µM, whereas the saturable [125I]T3 uptake process shows a Km value for T3 inhibition of 0.76 µM and the IC50 value for T4 inhibition of T3 uptake of 7.78 µM. Considering that [125I]T4 uptake was much lower than [125I]T3 uptake (Fig. 3B), the proper determination of kinetic parameters for [125I]T4 uptake was not possible. As MCT10 and LAT2 are sodium-independent transporters (Halestrap & Wilson 2012, Kinne et al. 2015), we investigate the dependence of T3 uptake on sodium. Figure 3C shows that replacement of sodium by choline did not induce any significant reduction of [125I]T3 uptake, indicating that T3 transport system does not have any sodium dependence, providing further evidence for MCT10 and/or LAT2 involvement in T3 transport at DC level. Besides, the efflux of [125I]T3 from DCs has a significantly lower velocity than [125I]T4 (Fig. 3D) as about 63% of cellular [125I]T3 remains inside DCs at 60 min after its uptake vs 32% of [125I]T4.
To further characterize the T3 uptake system at DC level, it was measured in the presence of MCT10 and LAT2 inhibitors: BSP and Leu, respectively (Loubiere et al. 2012) (Fig. 4A). As shown, BSP significantly reduced 54% of total [125I]T3 uptake, whereas Leu decreased it just 15%, without significant difference from control cells. When BSP and Leu were added together, [125I]T3 uptake decreased 45%; however, the difference between BSP and BSP + Leu treatments failed to reach statistical significance. Altogether, these findings are in agreement with T3 inhibition of the saturable process (Fig. 3B), highly suggesting that MCT10 is the main TH transporter. To evaluate the biological significance of MCT10 and LAT2 for T3 action in DCs, IL-12 secretion induced by T3 (Mascanfroni et al. 2008) was measured after concomitant treatment for 18 h (or not) with both inhibitors. As shown in Fig. 4B, the addition of Leu in the presence of T3 did not induce any significant change on IL-12 secretion by DCs. However, BSP reduced the effect of T3 by 46%, whereas the presence of both inhibitors together did not diminish IL-12 levels below BSP alone. As treatment with T3 + BSP did not abolish the effect of T3 on IL-12 secretion by DCs, the amount of T3 that enters DCs by the non-saturable mechanism or by other unknown TH transporters is enough to induce, although to a lesser extent, the ability of DCs to secrete IL-12. To note, neither BSP nor Leu (at the concentrations assayed) induced any significant effect on DC viability over the experimental time (data not shown), measured by the cell death assay. These results highlight the involvement of MCT10 on T3 action at DC level and also disregard LAT2 participation.
Types 2 and 3 iodothyronine deiodinases are expressed in DCs and metabolize THs
Considering the pivotal role of TH metabolism in the action of THs in target cells (Williams & Bassett 2011), we explored this event in DCs. We first evaluated the expression of TH deiodinase mRNAs (Dio1, Dio2 and Dio3) in iDCs, by conventional RT-PCR. Figure 5A shows that iDCs express Dio2 and Dio3, but not Dio1. In turn, these cells also exhibit D2 and D3 protein expression, measured by Western blot (Fig. 5B) that revealed the monomer 31 kDa for D2 and the 65 kDa homodimer native state for D3 (Sagar et al. 2008). Monomeric D3 could not be obtained, even after urea (6 M) treatment of protein lysates. Of note is that D3 protein levels are significantly higher than those of D2 (6.5 fold, Fig. 5B).
To evaluate DC’s ability to control intracellular levels of THs, D2 and D3 activities were assessed in iDCs. The activities of D2 and D3 vs protein mass were determined, and results indicated that the increase of D2 activity is linear between 20 and 60 µg, whereas it is from 80 to 120 µg for D3 (data not shown). Therefore, 40 µg (for D2) and 100 µg (for D3) of total protein extracts were used thereafter. As depicted in Fig. 5C, D2 and D3 activities were revealed in iDCs, although [125I]T3 (black bar, D3 activity) was deiodinated at a higher extent than [125I]T4 (white bar, D2 activity). The higher D3 than D2 activity (6.6-fold) is quite similar to D3 vs D2 protein expression in iDCs. Altogether, these results suggest that D3 may be preponderant over D2 at least in control (immature) conditions, revealing a major role of iodothyronine inactivation in iDCs.
Regulation of TH transporters and iodothyronine deiodinases by T3
As T3 exhibits profound effects at DC level, inducing phenotypic and functional maturation of iDCs and regulating thereafter adaptive immunity (Mascanfroni et al. 2008, 2010, Montesinos et al. 2012, Alamino et al. 2015), the T3 effect (5 nM for 18 h) on TH transporters and iodothyronine deiodinases 2 and 3 were evaluated.
As depicted in Fig. 6A, RT-qPCR analysis shows that T3 significantly increased Mct10 and Lat2 mRNAs. These results are in accordance with protein levels of both TH transporters (Western blot, Fig. 6B). In turn, [125I]T3 and [125]T4 uptake by control iDCs and T3-treated cells revealed that although T3 uptake was not modified by T3 treatment of iDC, T4 uptake was significantly increased 2.1-fold (Fig. 6C). On the contrary, T3 efflux was significantly increased in T3-treated DCs when compared to control iDCs (Fig. 6D), whereas T4 efflux was not modified (Fig. 6D).
Regarding T3 effect on iodothyronine deiodinase expression in DCs, T3 significantly augmented Dio3 mRNA expression (1.81 fold increase vs control iDCs, Fig. 7A) and D3 protein levels (3.74 fold increase vs control iDCs, Fig. 7B). In addition, D3 activity was increased by T3 treatment (1.78 fold increase vs control iDCs, Fig. 7C). Conversely, Dio2 mRNA levels tended to decrease in T3-treated DCs, but this failed to reach statistical significance (Fig. 7A). In turn, D2 protein levels were not modified by T3 treatment (Fig. 7B) although D2 activity registered a slight but significant decrease (18%, Fig. 7C, upper panel).
Discussion
During the last decade, our findings underscore a novel unrecognized target that regulates DC maturation and function, T3, with outstanding effects at the initiation of adaptive immunity (Mascanfroni et al. 2008, 2010, Montesinos et al. 2012, Alamino et al. 2015). At present, the players involved in TH actions are well characterized. However, the interaction among them remains to be fully elucidated in a tissue-specific fashion (Brent 2012). As the action of THs may represent an attractive target for rational manipulation of the immunogenicity of DCs, either alone or in combination with other cancer immunotherapeutic strategies (Alamino et al. 2016), the effect of the main circulating TH (T4), as well as the mechanisms of TH transport and metabolism at DC levels, were disclosed in this work. Noteworthy, both mechanisms were scarcely and only partially studied in few cells from the immune system up to date (Boelen et al. 2008, 2009b, Stevenson et al. 2014), and therefore, this is the first systematic study in the field, conducted at DC level.
In many cellular systems, T4 acts mainly as a prohormone through intracellular T3 conversion to provide the major part of circulating T3 levels and to begin TH action inside target cells, although rapid nongenomic effects initiated mainly by T4 at the plasma membrane were also reported (Davis et al. 2016). The source of cellular T3, from plasma or from local T4 deiodination by D2, is extremely variable in different tissues, e.g. 80% is derived from plasma in cerebral cortex, whereas less than 20% is from this fraction in kidneys (Dayan & Panicker 2009). Our results showing that different from T3 (Mascanfroni et al. 2008), treatment of DCs with T4 has no effect on IL-12 production and secretion, gave us the first clue that DC response to TH may be due, at least in its major part, directly by T3 action. In some tissues, like the central nervous system, the T3 derived from T4 deiodination also acts in other cells, different from those where it was produced (St Germain et al. 2009). Therefore, although T4 is the major circulating TH, T3 may also be supplied to DCs from other neighbor cells in their sites of maturation, e.g. lymph nodes and spleen. Considering the crucial reported events induced by T3 on DC characteristics and function (Mascanfroni et al. 2008, Alamino et al. 2015), this postulate seems rational to restrain unspecific activation of DCs in circulation. Moreover, as the biological activity of THs is dependent on the intracellular T3 concentration, which is importantly controlled by TH transport across DCs’ membranes and TH metabolism inside target cells (Bernal et al. 2015), further results from this work shed light on both events at DC level, crucial for the fate of the immune system exposed to pathogens or damage signals.
Results show that both MCT10 and LAT2 TH transporters are expressed at mRNA and protein levels in DCs. It was reported that MCT10 is as active as MCT8 for TH transport (Friesema et al. 2008), the main TH transporter and most studied due to its brain expression leading to the severe Allan–Herndon–Dudley syndrome when its gene is mutated. Remarkably, although scarce information about TH transporter expression in immune cells is found, the macrophage cell line RAW264.7 also expresses Mct10 (at mRNA level) but not Mct8 or Oatp1c1 (Kwakkel et al. 2014), in consonance with our results. Noteworthy, macrophages are phylogenetically and functionally related to DCs and it was reported that mice macrophages also exert T3-dependent effects (Perrotta et al. 2013), although TH transport has not been evaluated in these cells yet.
Further analysis of TH transport mechanism revealed that DCs are more effective in transporting T3 than T4, in agreement with MCT10 and LAT2 expression and regarding their iodothyronine transport preference (Friesema et al. 2008, Loubiere et al. 2012, Schweizer et al. 2014). In accordance, our results show that T3 uptake in DCs is sodium independent (Halestrap & Wilson 2012, Kinne et al. 2015).
Regarding the kinetic characteristics of TH transport, we registered a saturable and a non-saturable component, in tight agreement to TH transport in other cells (Visser et al. 2009, Loubiere et al. 2012). It was suggested that the latter may reflect iodothyronine partitioning in the cell membrane and/or an unknown transporter system with Km values in the millimolar range (Visser et al. 2009). When unlabeled T3 is added, the saturable process shows a dose-dependent reduction in [125I]T3 uptake with an apparent Km 10 times below the concentration of T4 needed to inhibit 50% of this uptake (0.76 µM vs 7.78 µM). These kinetic results provide more evidence to the preferable transport of T3 over T4 at DC level, and give an additional support to the undetectable effect of T4 on DC function.
Results of the study of T3 transport in DCs in the presence of selective MCT10 and LAT2 inhibitors strengthen the main role of MCT10 in T3 transport in DCs. In agreement, it was reported that LATs exhibit lower affinity than MCTs to transport THs (Friesema et al. 2005) and a recent report revealed that LAT2 exhibits favored affinity for 3,3′-diiodothyronine (T2), less for T3 and no affinity for T4 (Kinne et al. 2015), reinforcing the evidence that LAT2 is not compelling for T3 crossing through DC’s membrane. Noteworthy, it was reported that MCT10 transports T3 and T4 in and out of cells (Friesema et al. 2008), but it was suggested that it plays a prominent role in T3 efflux (Muller et al. 2014). Considering MCT10 preference for T3 transport, the higher efflux of T4 than T3 out of DCs may be due to other modulators of TH mechanism of action inside the cell, like the cytoplasmic T3-binding protein or µ-crystallin: CRYM, which binds T3 with higher affinity than T4 and is a regulator of intracellular T3 bioavailability (Suzuki et al. 2007). Remarkably, the marked reduction of IL-12 secretion from DCs exposed to T3 + BSP over T3 alone reinforces and gives functional support for MCT10’s prominent role on T3 transport in DCs.
Although both Mct10 and Lat2 mRNA and protein levels were increased by T3 treatment of DCs, T3 efflux velocity (but not T3 uptake) was augmented. These findings may respond to the preferable role of MCT10 on T3 efflux (Muller et al. 2014). Conversely, T4 uptake was increased by T3-treated DCs. Although under this circumstance, T4 entry to DCs may be favored as a compensatory mechanism to counteract the fall in T3 intracellular level, the amount of T4 uptake is significantly lesser than that of T3. Overall, these findings would be involved in T3 clearance from DCs and sustain a homeostatic mechanism to restrain TH action after DC activation.
Although TH cellular concentrations are variable depending on the specific metabolic state, this situation does not impact at plasma view point as TH serum levels hardly fluctuate. Therefore, by a particular modulation of deiodinase expression and activity at cellular level, TH action is finely controlled (Bianco 2013). Although this mechanism should also operate at TH-responsive immune-type cells, just the expressions of deiodinases were reported in some cell types. These include D3 protein expression in granulocytes and macrophages from a rat model of experimental allergic encephalomyelitis (Boelen et al. 2009a), D3 immunoreactivity in inflammatory cells surrounding a local abscess induced by turpentine injection to mice (Boelen et al. 2008), Dio2 mRNA expression at baseline levels in the macrophage cell line RAW264.7 with Dio1 and Dio3 mRNAs under the limit of detection (Kwakkel et al. 2014), and Dio2 and Dio3 mRNA expression in hamster leukocytes (Stevenson et al. 2014). However, as far as we know, the activities of deiodinases were not reported in any immune-type cell. As for TH transport, our results provide the first report of TH metabolism in murine DCs, covering the whole metabolic process from the expressions and the activities of iodothyronine deiodinases, to the regulation by T3.
Our results showing iodothyronine deiodinase expression in DCs for types 2 and 3 but not for type 1 is not surprising as it resembles the profile of many TH-responsive cells since both D2 and D3 are mainly involved in the control of TH action at cellular level (Bianco 2013). Conversely, D1, a high Km enzyme (10−7–10−6 M), mainly contributes to circulating T3 levels and acts as a scavenging enzyme (Williams & Bassett 2011, Maia et al. 2011, Darras et al. 2015). Moreover, as D1 is anchored at the plasma membrane and exhibits low affinity for T4, T3 generated at this level diffuses rapidly from the cell to the plasma without significant modifications of intracellular levels of T3 (Gereben et al. 2015). Noteworthy, D3 protein levels and enzyme activity are greater than D2 in DCs. Considering both enzymes share the same low Km in the nM range (Williams & Bassett 2011) but D3 has a longer half-life than D2 (Bianco & Kim 2006), a higher role of T3 inactivation by D3 than T3 intracellular generation by D2 activity on T4 is suggested. These results seem expectable due to the scarce T4 uptake by the cell and point out another step of cellular control of the active TH (T3) in DCs, favoring its inactivation. As D3 also catalyzes T4 inactivation rendering the inactive iodothyronine metabolite: rT3, the little amount of T4 entering DCs may be sensitive to inactivation. This mechanism together with the little T4 uptake by DCs may collaborate to render the lack of T4 effect at DC level. These results are of relevance since these mechanisms may be involved in the control of T3 action at DCs to avoid the perpetuation of the proinflammatory response induced through the Th1 profile and cytotoxic T-cell activity triggered by T3 (Mascanfroni et al. 2008, Alamino et al. 2015). Besides, taking together the results showing low T4 uptake by DCs and reduced TH activation by D2 inside the cell, suggest that T3 may be supplied to DCs by the extracellular medium and/or by D2 activity on T4 at neighboring cells in their activation sites (St Germain et al. 2009). The disclosure of this issue exceeds the objective of this work, but since DCs are expected to be in an immature state in circulation, it may be hypothesized that this second source of T3 is of enough magnitude to modulate DC functioning and plays an important role to control the precise place of DC maturation.
Results showing that the expected effect of T3 on the increased expression and activity of D3 was more evident than the reduction of D2 in DCs, indicate that the cellular activity of T3 must be finely tuned in these cells. These results are in agreement with many authors (Bianco et al. 2002, Darras et al. 2015) that reported that fluctuations in T4 and T3 concentrations lead to homeostatic, reciprocal changes in the activity of D2 and D3. In fact, as T3 concentrations increase, expression of Dio3 is upregulated, increasing T3 clearance, whereas the expression of Dio2 is just modestly downregulated, decreasing T3 production.
Worthy to be discussed, T3 regulation of TH transporter and deiodinase expressions and activities may be the result of its known regulatory action on TH economy in target cells, depending on the physiological or pathological condition (Bianco 2013). However, an action of T3 due to its role on DCs’ maturation and function is also expected. Therefore, the results obtained in this work may be the result of both mechanisms. As different stimuli exert specific actions on DCs’ characteristics and functioning, as well as particular effects on the ability of these cells to develop adaptive responses (Walsh & Mills 2013, Kudo et al. 2013), the disclosure of effects of many other DCs’ stimulators on TH transporter and deiodinase expressions and activities, exceeds the goal of this manuscript and is being addressed in ongoing research.
Previously, we reported that T3 increased TRβ1 expression in DCs through NFκB-positive action on the transcription of its gene (Mascanfroni et al. 2010) and that TRβ1 is essential for T3 action in vitro (Mascanfroni et al. 2010) and in vivo (Alamino et al. 2015). Altogether, T3 action on TH transport (uptake–efflux), iodothyronine deiodinases and TRβ1, may act coordinately to regulate TH action within the cell in a balanced fashion and depending on the functional requirements of DCs during different physiopathological conditions.
In conclusion, our results underscore in more detail the action of THs at DC level, revealing the pivotal role of T3 over T4 and disclosing the mechanisms of TH transport and iodothyronine deiodination in these cells. They also broaden the knowledge of the effect of THs at the initiation of the immune response and their role directing adaptive immunity through T3 actions on DCs, with profound implications in immunopathology, including cancer and autoimmune manifestations of the thyroid gland at the crossroads of the immune and endocrine systems. Noteworthy, these results are relevant regarding the recorded effects of T3 on DC functioning as the knowledge of TH transport and metabolism in DCs provides valuable tools for manipulating the immunogenic potential of DCs to positively regulate the development of protective immunity or negatively control the generation of autoimmune thyroid inflammation.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was supported by grants from Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT, PICT-2008-0890 and PICT-2013-0638), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET, PIP 2014-2012GI), Secretaría de Ciencia y Tecnología de la Universidad Nacional de Córdoba (SeCyT, 2012–2013 and 2014–2015), and Fundación Sales (2014–2015), from Argentina, Conselho Nacional de Pesquisa from Brazil (CNPq, 2014) and The World Academy of Sciences (TWAS, 2014).
Acknowledgments
The authors thank Paula Abadie, Pilar Crespo, Alejandra Romero and Laura Gatica for technical assistance in flow cytometry analysis and cell culture and Fabricio Navarro, Diego Luti, Victoria Blanco and Carolina Florit for helping in animal care and management.
References
Alamino VA, Mascanfroni ID, Montesinos MM, Gigena N, Donadio AC, Blidner AG, Milotich SI, Cheng SY, Masini-Repiso AM & Rabinovich GA et al. 2015 Antitumor responses stimulated by dendritic cells are improved by triiodothyronine binding to the thyroid hormone receptor beta. Cancer Research 75 1265–1274. (doi:10.1158/0008-5472.CAN-14-1875)
Alamino VA, Montesinos MM, Rabinovich GA & Pellizas CG 2016 The thyroid hormone triiodothyronine reinvigorates dendritic cells and potentiates anti-tumor immunity. Oncoimmunology 5 e1064579. (doi:10.1080/2162402X.2015.1064579)
Bernal J, Guadano-Ferraz A & Morte B 2015 Thyroid hormone transporters-functions and clinical implications. Nature Reviews Endocrinology 11 690. (doi:10.1038/nrendo.2015.186)
Bianco AC 2013 Cracking the code for thyroid hormone signaling. Transactions of the American Clinical and Climatological Association 124 26–35.
Bianco AC & Kim BW 2006 Deiodinases: implications of the local control of thyroid hormone action. Journal of Clinical Investigation 116 2571–2579. (doi:10.1172/JCI29812)
Bianco AC, Salvatore D, Gereben B, Berry MJ & Larsen PR 2002 Biochemistry, cellular and molecular biology, and physiological roles of the iodothyronine selenodeiodinases. Endocrine Reviews 23 38–89. (doi:10.1210/edrv.23.1.0455)
Boelen A, Boorsma J, Kwakkel J, Wieland CW, Renckens R, Visser TJ, Fliers E & Wiersinga WM 2008 Type 3 deiodinase is highly expressed in infiltrating neutrophilic granulocytes in response to acute bacterial infection. Thyroid 18 1095–1103. (doi:10.1089/thy.2008.0090)
Boelen A, Kwakkel J, Chassande O & Fliers E 2009a Thyroid hormone receptor beta mediates acute illness-induced alterations in central thyroid hormone metabolism. Journal of Neuroendocrinology 21 465–472. (doi:10.1111/j.1365-2826.2009.01863.x)
Boelen A, Mikita J, Boiziau C, Chassande O, Fliers E & Petry KG 2009b Type 3 deiodinase expression in inflammatory spinal cord lesions in rat experimental autoimmune encephalomyelitis. Thyroid 19 1401–1406. (doi:10.1089/thy.2009.0228)
Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72 248–254. (doi:10.1016/0003-2697(76)90527-3)
Brent GA 2012 Mechanisms of thyroid hormone action. Journal of Clinical Investigation 122 3035–3043. (doi:10.1172/JCI60047)
Cremaschi GA, Cayrol F, Sterle HA, Diaz Flaque MC & Barreiro Arcos ML 2016 Thyroid hormones and their membrane receptors as therapeutic targets for T cell lymphomas. Pharmacological Research 109 55–63. (doi:10.1016/j.phrs.2016.02.001)
Darras VM, Houbrechts AM & Van Herck SL 2015 Intracellular thyroid hormone metabolism as a local regulator of nuclear thyroid hormone receptor-mediated impact on vertebrate development. Biochimica et Biophysica Acta 1849 130–141. (doi:10.1016/j.bbagrm.2014.05.004)
Davis PJ, Goglia F & Leonard JL 2016 Nongenomic actions of thyroid hormone. Nature Reviews Endocrinology 12 111–121. (doi:10.1038/nrendo.2015.205)
Dayan CM & Panicker V 2009 Novel insights into thyroid hormones from the study of common genetic variation. Nature Reviews Endocrinology 5 211–218. (doi:10.1038/nrendo.2009.19)
De Vito P, Incerpi S, Pedersen JZ, Luly P, Davis FB & Davis PJ 2011 Thyroid hormones as modulators of immune activities at the cellular level. Thyroid 21 879–890. (doi:10.1089/thy.2010.0429)
De Vito P, Balducci V, Leone S, Percario Z, Mangino G, Davis PJ, Davis FB, Affabris E, Luly P & Pedersen JZ et al. 2012 Nongenomic effects of thyroid hormones on the immune system cells: New targets, old players. Steroids 77 988–995. (doi:10.1016/j.steroids.2012.02.018)
Feng X, Wang X, Liu Y & Di X 2015 Linarin inhibits the acetylcholinesterase activity in-vitro and ex-vivo. Iranian Journal of Pharmaceutical Research 14 949–954.
Friesema EC, Jansen J & Visser TJ 2005 Thyroid hormone transporters. Biochemical Society Transactions 33 228–232. (doi:10.1042/BSbib330228)
Friesema EC, Jansen J, Jachtenberg JW, Visser WE, Kester MH & Visser TJ 2008 Effective cellular uptake and efflux of thyroid hormone by human monocarboxylate transporter 10. Molecular Endocrinology 22 1357–1369. (doi:10.1210/me.2007-0112)
Gereben B, McAninch EA, Ribeiro MO & Bianco AC 2015 Scope and limitations of iodothyronine deiodinases in hypothyroidism. Nature Reviews Endocrinology 11 642–652. (doi:10.1038/nrendo.2015.155)
Halestrap AP & Wilson MC 2012 The monocarboxylate transporter family – role and regulation. IUBMB Life 64 109–119. (doi:10.1002/iub.572)
Kinne A, Wittner M, Wirth EK, Hinz KM, Schulein R, Kohrle J & Krause G 2015 Involvement of the L-type amino acid transporter Lat2 in the transport of 3,3′-diiodothyronine across the plasma membrane. European Thyroid Journal 4 42–50. (doi:10.1159/000381542)
Kreuzer KN & Neece SH 1999 Purification of the bacteriophage T4 type II DNA topoisomerase. Methods in Molecular Biology 94 171–177. (doi:10.1385/1-59259-259-7:171)
Kudo M, Ishigatsubo Y & Aoki I 2013 Pathology of asthma. Frontiers in Microbiology 4 263. (doi:10.3389/fmicb.2013.00263)
Kwakkel J, Surovtseva OV, de Vries EM, Stap J, Fliers E & Boelen A 2014 A novel role for the thyroid hormone-activating enzyme type 2 deiodinase in the inflammatory response of macrophages. Endocrinology 155 2725–2734. (doi:10.1210/en.2013-2066)
Loubiere LS, Vasilopoulou E, Glazier JD, Taylor PM, Franklyn JA, Kilby MD & Chan SY 2012 Expression and function of thyroid hormone transporters in the microvillous plasma membrane of human term placental syncytiotrophoblast. Endocrinology 153 6126–6135. (doi:10.1210/en.2012-1753)
Louzada RA, Santos MC, Cavalcanti-de-Albuquerque JP, Rangel IF, Ferreira AC, Galina A, Werneck-de-Castro JP & Carvalho DP 2014 Type 2 iodothyronine deiodinase is upregulated in rat slow- and fast-twitch skeletal muscle during cold exposure. American Journal of Physiology: Endocrinology and Metabolism 307 E1020–E1029. (doi:10.1152/ajpendo.00637.2013)
Maia AL, Goemann IM, Meyer EL & Wajner SM 2011 Deiodinases: the balance of thyroid hormone: type 1 iodothyronine deiodinase in human physiology and disease. Journal of Endocrinology 209 283–297. (doi:10.1530/JOE-10-0481)
Mascanfroni I, Montesinos Mdel M, Susperreguy S, Cervi L, Ilarregui JM, Ramseyer VD, Masini-Repiso AM, Targovnik HM, Rabinovich GA & Pellizas CG 2008 Control of dendritic cell maturation and function by triiodothyronine. FASEB Journal 22 1032–1042. (doi:10.1096/fj.07-8652com)
Mascanfroni ID, Montesinos Mdel M, Alamino VA, Susperreguy S, Nicola JP, Ilarregui JM, Masini-Repiso AM, Rabinovich GA & Pellizas CG 2010 Nuclear factor (NF)-kappaB-dependent thyroid hormone receptor beta1 expression controls dendritic cell function via Akt signaling. Journal of Biological Chemistry 285 9569–9582. (doi:10.1074/jbc.M109.071241)
Montesinos MM, Alamino VA, Mascanfroni ID, Susperreguy S, Gigena N, Masini-Repiso AM, Rabinovich GA & Pellizas CG 2012 Dexamethasone counteracts the immunostimulatory effects of triiodothyronine (T3) on dendritic cells. Steroids 77 67–76. (doi:10.1016/j.steroids.2011.10.006)
Muller J, Mayerl S, Visser TJ, Darras VM, Boelen A, Frappart L, Mariotta L, Verrey F & Heuer H 2014 Tissue-specific alterations in thyroid hormone homeostasis in combined Mct10 and Mct8 deficiency. Endocrinology 155 315–325. (doi:10.1210/en.2013-1800)
Perrotta C, Buldorini M, Assi E, Cazzato D, De Palma C, Clementi E & Cervia D 2013 The thyroid hormone triiodothyronine controls macrophage maturation and functions: protective role during inflammation. American Journal of Pathology 184 230–247. (doi:10.1016/j.ajpath.2013.10.006)
Sagar GD, Gereben B, Callebaut I, Mornon JP, Zeold A, Curcio-Morelli C, Harney JW, Luongo C, Mulcahey MA & Larsen PR et al. 2008 The thyroid hormone-inactivating deiodinase functions as a homodimer. Molecular Endocrinology 22 1382–1393. (doi:10.1210/me.2007-0490)
Schweizer U, Johannes J, Bayer D & Braun D 2014 Structure and function of thyroid hormone plasma membrane transporters. European Thyroid Journal 3 143–153. (doi:10.1159/000367858)
St Germain DL, Galton VA & Hernandez A 2009 Minireview: defining the roles of the iodothyronine deiodinases: current concepts and challenges. Endocrinology 150 1097–1107. (doi:10.1210/en.2008-1588)
Stevenson TJ, Onishi KG, Bradley SP & Prendergast BJ 2014 Cell-autonomous iodothyronine deiodinase expression mediates seasonal plasticity in immune function. Brain, Behavior, and Immunity 36 61–70. (doi:10.1016/j.bbi.2013.10.008)
Suzuki S, Suzuki N, Mori J, Oshima A, Usami S & Hashizume K 2007 micro-Crystallin as an intracellular 3,5,3′-triiodothyronine holder in vivo. Molecular Endocrinology 21 885–894. (doi:10.1210/me.2006-0403)
Visser WE, Friesema EC & Visser TJ 2009 Transport of thyroxine and 3,3′,5-triiodothyronine in human umbilical vein endothelial cells. Endocrinology 150 1552–1557. (doi:10.1210/en.2008-0627)
Wajner SM, Goemann IM, Bueno AL, Larsen PR & Maia AL 2011 IL-6 promotes nonthyroidal illness syndrome by blocking thyroxine activation while promoting thyroid hormone inactivation in human cells. Journal of Clinical Investigation 121 1834–1845. (doi:10.1172/JCI44678)
Walsh KP & Mills KH 2013 Dendritic cells and other innate determinants of T helper cell polarisation. Trends in Immunology 34 521–530. (doi:10.1016/j.it.2013.07.006)
Williams GR & Bassett JH 2011 Deiodinases: the balance of thyroid hormone: local control of thyroid hormone action: role of type 2 deiodinase. Journal of Endocrinology 209 261–272. (doi:10.1530/JOE-10-0448)
Zevenbergen C, Meima ME, Lima de Souza EC, Peeters RP, Kinne A, Krause G, Visser WE & Visser TJ 2015 Transport of iodothyronines by human L-type amino acid transporters. Endocrinology 156 4345–4355. (doi:10.1210/en.2015-1140)