Abstract
Female transgenic mice that overexpress the human chorionic gonadotrophin β subunit (hCGβ+) develop prolactinomas, whereas hCGβ+ males do not. The high levels of circulating hCG induce massive luteinization in the ovary of hCGβ+ females, and progesterone becomes the primary steroid hormone produced, but estradiol remains at physiological level. The involvement of high levels of progesterone in lactotroph proliferation is not clearly understood; hence, the pathogenesis of prolactinomas in hCGβ+ females remains unclear. TGFβ1 is an inhibitor of lactotroph function, and the reduced TGFβ1 activity found in prolactinomas has been proposed to be involved in tumor development. The aim of the present work was to study the role of TGFβ1 in the gender-specific development of prolactinomas in hCGβ+ mice. We compared the expression of different components of the pituitary TGFβ1 system in males and females in this model. We found reduced TGFβ1 levels, reduced expression of TGFβ1 target genes, TGFβ1 receptors, Ltbp1, Smad4 and Smad7 in hCGβ+ female pituitaries. However, no differences were found between the transgenic and wild-type male pituitaries. We postulate that decreased pituitary TGFβ1 activity in hCGβ+ females is involved in the development of prolactinomas. In fact, we demonstrated that an in vivo treatment carried out for increasing pituitary TGFβ1 activity, was successful in reducing the prolactinoma development, and the hyperprolactinemia in hCGβ+ females. Moreover, the stronger TGFβ1 system found in males could protect them from excessive lactotroph proliferation. Sex differences in the regulation of the pituitary TGFβ1 system could explain gender differences in the incidence of prolactinoma.
Introduction
The human chorionic gonadotrophin (hCG), secreted normally by the placenta, is a member of the family of glycoprotein hormones (with the pituitary hormones LH, FSH and TSH) that share structural similarities. They are heterodimers of two non-covalently associated subunits: the common α- and the hormone-specific β-subunit. Individually, each subunit has not known biological activity (Gharib et al. 1990).
The hCGβ and the LHβ subunits have 83% homology, but hCGβ contains four additional O-linked glycosylation sites in a C-terminal extension of 24 amino acids, that confers to hCGβ a longer circulatory half-life and higher biopotency as compared to LH (Gharib et al. 1990). Both LH and hCG interact with the same LH/hCG receptor, which belongs to the large family of G-protein-coupled receptors, promoting ovarian steroidogenesis and ovulation in females and testicular androgen production in males.
Elevated gonadotrophin secretion can be observed in female or male infertility and upon ovarian tumorigenesis. Genetically modified mouse models have provided fundamental tools to study disorders arising from the loss- or the gain-of-function of gonadotrophins in reproductive pathologies (reviewed in Jonas et al. 2014).
Phenotypes of the transgenic mouse model overexpressing the hCGβ subunit (hCGβ+ mice) present gender differences. Although hCGβ+ males are fertile, with normal spermatogenesis and sperm quality despite reduced testis size and serum FSH (Rulli et al. 2003), females present precocious puberty, infertility, enhanced ovarian steroidogenesis and abnormal uterine structure (Rulli et al. 2002). Adult females develop mammary tumors with characteristics of adenocarcinoma at the age of 9–10 months. On the other hand, females, but not males, also develop prolactinomas. The pituitary enlargement becomes evident from the age of 2 months, and progress to adenoma by the age of 8–10 months, concomitant with severe hyperprolactinemia (Rulli et al. 2002).
Factors that trigger the prolactinoma development in hCGβ+ females are not fully elucidated. One of the most studied stimuli involved in prolactinoma development is the circulating estradiol level. In hCGβ+ females, the stimulation of the immature ovary by hCG induces transient high levels of estradiol with a 3- to 4-fold increase at one month of age. However, thereafter, the continuous high levels of circulating hCG induce massive luteinization, and progesterone becomes the predominant steroid hormone produced. Adult hCGβ+ female mice present with a 50- to 100-fold excess of progesterone, 3- to 6-fold-increase in testosterone but, interestingly, physiological levels of estradiol (Rulli et al. 2002). As the involvement of high levels of progesterone or testosterone in lactotroph proliferation is not clearly understood, new investigations are needed to clarify the pathogenesis of prolactinomas in hCGβ+ female mice.
The main regulators of lactotroph functions are dopamine (DA) and estradiol. They interact in the regulation of cell proliferation and prolactin (PRL) secretion (Maurer 1982, Ben Jonathan & Hnasko 2001). DA inhibits lactotroph proliferation and PRL synthesis and release, acting through the dopamine D2 receptor (Drd2) expressed in lactotrophs (Ben-Jonathan 1985, Missale et al. 1998). Estradiol stimulates PRL gene transcription modifying lactotrophic responses to other stimulatory or inhibitory factors and indirectly decreases DA production from the hypothalamus (Freeman et al. 2000). In addition, other hypothalamic or pituitary factors contribute to the regulation of lactotroph function (reviewed in Freeman et al. 2000). Among them, the locally produced transforming growth factor beta 1 (TGFβ1) is known for inhibiting lactotroph proliferation and PRL secretion (Sarkar et al. 1992, 1998, Recouvreux et al. 2011).
The TGFβ biology is complex, and its activity is highly regulated due to its powerful effects on embryogenesis, development and tissue homeostasis (Heldin et al. 2009, Galvin-Burgess et al. 2013, Itoh et al. 2014).
In the pituitary, DA and estradiol, the main regulators of lactotroph function, regulate TGFβ1 synthesis and activation, and the expression of several components of the TGFβ1 system (Recouvreux et al. 2011, 2013). DA increases the TGFβ1 expression in lactotrophs (Sarkar et al. 2005), whereas estradiol decreases cytokine synthesis and release and type 2 TGFβ receptor (TβR2) expression (Sarkar et al. 1992, Pastorcic et al. 1995). Moreover, it was previously demonstrated that TGFβ1 mediates, at least in part, the DA and estradiol effect on lactotroph functions.
The importance of TGFβ1 in inhibiting lactotroph function is clearly demonstrated by the fact that in human prolactinomas, as well as in animal models of prolactinomas, the TGFβ1 expression and activity were found reduced, suggesting its involvement in the tumor development (Pastorcic et al. 1995, Recouvreux et al. 2011, 2012, 2016).
The aim of the present work was to study the involvement of TGFβ1 system in the development of prolactinoma in hCGβ+ mice, and in the gender differences observed in the appearance of this phenotype.
Materials and methods
Animals
All studies were performed in transgenic mice from both sexes, overexpressing the hCGβ subunit under the control of human ubiquitin C promoter (hCGβ+). In all cases, wild-type (WT) littermates were used as controls. These mice, with FVB/N background, were genotyped as previously described (Rulli et al. 2002). Animals were kept in a temperature-controlled room with lights on at 07:00 h and off at 19:00 h and were given free access to laboratory chow and tap water.
All experimental procedures were performed according to the NIH Guidelines for Care and Use of Experimental Animals (Division of Animal Welfare, Office for Protection of Research Risks, National Institutes of Health, A#5072-01) and were approved by the Institutional Animal Care and Use Committee of the Instituto de Biología y Medicina Experimental, Consejo Nacional de Investigaciones Científicas y Técnicas (IBYME-CONICET).
Animals were used at 6 months of age, at which age the pituitaries from hCGβ+ females were hyperplastic. Trunk blood was collected after decapitation, and anterior pituitaries were weighed after removal. Serum samples were separated by centrifugation and stored at −20°C for biochemical analyses. Anterior pituitaries of different experimental groups were stored in TRIzol (Invitrogen) or ice-cold buffer containing a mix of proteases inhibitors at −70°C for posterior RNA isolation and ELISA assays, respectively.
Radioimmunoassay (RIA)
Serum prolactin levels were measured by RIA using mouse-specific reagents provided by the National Institute of Diabetes and Digestive and Kidney Diseases and National Hormone and Pituitary Program (Dr A F Parlow, NHPP, Torrance, CA). Assays were performed using 10 μL serum in duplicate. Results are expressed in nanograms per milliliter. The inter- and intra-assay coefficients of variation were 6.9% and 11.6%, respectively.
RNA isolation and analysis of gene expression
Anterior pituitaries and hypothalami were collected and processed in TRIzol Reagent (Invitrogen), and total RNA was isolated according to manufacturer’s protocol. One microgram of RNA was reverse-transcribed in a 20 μL reaction volume using MMLV-RT (Promega) and random primers (Biodynamics). The resulting cDNA was used for quantitative real-time PCR analysis (qPCR). qPCRs were performed using specific-designed primers and the Fast Start Universal SYBR Green Master Rox (Roche) on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Differences in the cDNA target gene expression were quantified by comparing the threshold cycle (CT) with that of CyclophilinB using the comparative CT method (ΔΔCT). The primer sequences used for qPCR are shown in Table 1.
Primer sequences for qPCR.
| Gene | Forward primer 5′–3′ | Reverse primer 5′–3′ |
|---|---|---|
| CyclophilinB | GACCCTCCGTGGCCAACGAT | ACGACTCGTCCTACAGATTCATCTC |
| TβR2 | AATTCCCAGCTTCTGGCTCA | GTGCTGTGAGAGACGCGGGCTTC |
| Tmepai | TGTCCTCGGAAGGATGCCTCTGG | CAGCGAGTCGGTCAGTGGGC |
| Klf14 | CAGCTCGTCTGGCTCCAA | AGGCACTCGGCAGCGAA |
| Alk5 | TCCAAACCACAGAGTAGGCAC | TCATGGATTCCACCAATAGAACA |
| Alk1 | GCGTTGACCAGCAGACACCC | CAGTGCGGTGAGGCGAGCAG |
| Smad4 | CACCCGCCAAGTAATCGCGCA | CTGGCCGGCTGACTTGTGGAAG |
| Smad7 | AACCCCGAGCTGGTGTGCTG | TGGACAGCCTGCAGTTGGTTTGA |
| Ltbp1 | AGCACCATCACCTCTGCTCT | CAGACACTGCTGCTCCAA |
| Th | CCAGAGAGGACAAGGTTCCC | ATACGCCTGGTCAGAGAAGC |
| Drd2 | ATCGTCTCGTTCTACGTGCC | GTTGCCCTTGAGTGGTGTC |
| Tgfβ3 | TGAGCTCTTCCAGATACTTCGAC | GGATGCTGATTTCCAGACCCA |
| Bmp4 | TTGCAGCTTTCTAGAGGTCCC | TCAGCATTCGGTTACCAGGAA |
Detection of total and active TGFβ1
ELISAs were performed to quantify total or active TGFβ1 concentration in pituitary homogenates using the TGFβ1 DuoSet ELISA development system (DY1679, R&D Systems), following the manufacturer’s instructions.
Anterior pituitaries of different groups were collected and homogenized in 100 μL of ice-cold buffer containing 100 mM Tris, 10 mM CaCl2, 1 mM MgCl2, 1% Triton X-100, pH 7.4 and a mix of proteases inhibitors (phenylmethylsulfonyl fluoride, tosyl phenylalanyl chloromethyl ketone, tert-Amyl methyl ether, N-carbobenzyloxy-l-phenylalanine chloromethyl ketone and tosyl-l-lysyl chloromethyl ketone), using a hand-held micro-tissue homogenizer. The homogenates were centrifuged at 8900 g for 10 min at 4°C. The supernatant was collected, and protein concentration was measured by Lowry method. Equal protein amounts were loaded per well. TGFβ1 concentration was expressed as picograms per milligrams of protein. To assay total TGFβ1, samples were previously acidified to pH 2.6 by adding 1 M HCl for 20 min at room temperature, followed by neutralization with 1 M NaOH to pH 7.6.
Determination of DA concentration in hypothalamic tissue by HPLC
Whole hypothalami, including the preoptic area, were excised considering an area limited anteriorly by the optic chiasma and laterally by the hypothalamic fissures. The posterior limit was a plane passing in the limit with the mammillary bodies, excluding them. The in-depth limit was the subthalamic sulcus. Tissues were kept at −70°C until used.
HPLC-coupled electrochemical detection of DA was performed using a Varian 5000 liquid chromatograph coupled to an electrochemical detector (BAS LC-4C). Hypothalamic tissues were weighed, homogenized and deproteinized in 0.2 N perchloric acid (1/20). Homogenates were centrifuged. The supernatants were injected (50 µL) onto a 12.5 cm × 4 mm Nova-Pak C18 (Waters) reverse phase column. Mobile phase for DA determinations contained NaH2PO4.H2O 0.076 M, EDTA 0.99 mM, PICB8 5.24 mL/L and 6% methanol. The electrode potential was fixed at 0.7 V. Peak heights were measured by Peak Simple Chromatography Data System (Model 302 Six Channel USB). Values were quantified based on standard curves using the same software. DA concentration was determined based on tissue wet weight.
Experimental protocol for ABT-898 treatment
Four-month-old hCGβ+ female mice were divided into two groups and treated with 100 mg/kg ABT-898 (i.p.) or vehicle (5% dextrose, control group). The drugs were injected three times per week during three weeks. Twenty-four hours after the last injection, animals were killed, and trunk blood was collected for serum PRL determination by RIA. Pituitaries were carefully excised and weighed after removing the neurohypophysis. Anterior pituitaries were used for TGFβ1 ELISA assay and for pituitary PRL concentration measurement by RIA. Female WT siblings were used as control.
Drug
ABT-898 peptide was generously supplied by Abbott Laboratories.
Statistical analysis
Results are expressed as mean ± s.e.m. Two-way ANOVA was performed, as the effects of two factors (genotype and gender) were evaluated, followed by Bonferroni’s post hoc test. Dopamine concentration measurements were evaluated by Student’s t test. The in vivo treatment results were evaluated by one-way ANOVA followed by Tukey’s honestly significant difference test. P < 0.05 was considered significant. Data were transformed when required.
Results
Sex differences in pituitary weight and prolactin secretion in WT and hCGβ+ mice
As it was previously shown (Rulli et al. 2002, Ahtiainen et al. 2010, Ratner et al. 2012), hCGβ+ female mice developed prolactinomas, presenting a markedly increase in pituitary weight compared to their WT counterparts at 6 months of age (Fig. 1A, P < 0.0001). Nevertheless, no differences among genotypes were found in the pituitary weight in males, instead of both sexes hCGβ+ mice presenting with elevated levels of bioactive LH/hCG (males 21 ± 4, females 99 ± 20 IU/L; Rulli et al. 2002, 2003).
Sex differences in pituitary weight and prolactin secretion in WT and hCGβ+ mice. (A) Pituitary weight (mg) of 6-month-old mice (n = 11–12/group). Two-way ANOVA: genotype × sex interaction (P = 0.0002). Bonferroni’s post hoc test: Differences among genotypes were observed only in females (*P < 0.0001 vs wt female). (B) Serum prolactin levels were measured by RIA (n = 11–12/group). Genotype × sex interaction (P < 0.0001). Significant differences among genotypes were observed only in females (*P < 0.0001 vs wt female).
Citation: Journal of Endocrinology 232, 3; 10.1530/JOE-16-0371
In correlation to the pituitary weight, serum prolactin levels were also found significantly increased in hCGβ+ female mice compared to their WT counterparts (Fig. 1B, P < 0.0001), whereas no differences were found among genotypes in males.
Sex differences in active and total TGFβ1 concentration in pituitaries from WT and hCGβ+ mice
We next evaluated whether sex differences found in pituitary weight and prolactin secretion from hCGβ+ mice could be related to alterations in the local TGFβ1 system.
When we measured pituitary TGFβ1 concentration by ELISA, we found higher levels of both total and active TGFβ1 in male pituitaries compared to female mice (Fig. 2A, P < 0.0001; Fig. 2B, P < 0.0001). A lower concentration of both total (Fig. 2A, P < 0.001) and active (Fig. 2B, P < 0.01) TGFβ1 was found in hCGβ+ female mice when compared to their WT siblings. On the other hand, no differences among genotypes were found in cytokine content in pituitaries from males.
Active and total TGFβ1 concentration in pituitaries from WT and hCGβ+ mice. Active and total TGFβ1 content was measured by ELISA in pituitary homogenates (n = 8–9/group). (A) Total TGFβ1: Two-way ANOVA, genotype × sex interaction (P = 0.0054). Bonferroni’s post hoc test was conducted as the interaction between effects was significant. Differences among gender: a, P < 0.0001. Differences among genotypes were observed only in females (*P < 0.001 vs wt female). (B) Active TGFβ1 concentration: Two-way ANOVA, genotype × sex interaction (P = 0.0274). Bonferroni’s post hoc test: Sex differences: a, P < 0.0001. Significant differences among genotypes were observed only in females (*P < 0.01).
Citation: Journal of Endocrinology 232, 3; 10.1530/JOE-16-0371
TGFβ1 biological activity
To evaluate whether the lower levels of active TGFβ1 found in pituitaries from hCGβ+ female mice affect the biological activity of the cytokine, we measured the expression of two known TGFβ1 target genes: the Krüppel-like factor 14 (Klf14) (Truty et al. 2009) and the transmembrane androgen-induced protein (Tmepai) (Brunschwig et al. 2003, Levy & Hill 2005). Klf14 and Tmepai mRNA expression were found higher in male mice compared to that in females (Fig. 3A and B, respectively, P < 0.0001), according to the sex differences observed in pituitary-active TGFβ1 content. Both Klf14 and Tmepai mRNA expression were found decreased in female hCGβ+ compared to their WT counterparts (Fig. 3A and B, P < 0.001). This finding is in agreement with the marked decrease in total and active TGFβ1 content observed in hCGβ+ female pituitaries (Fig. 2).
Sex and genotype differences in TGFβ1 biological activity. mRNA transcripts were amplified with specific primers by qPCR and normalized to CyclophilinB. Results are expressed relative to those for WT females (n = 7–11/group) and analyzed by two-way ANOVA. Bonferroni’s post hoc test was conducted as the interaction between effects was significant. (A) Klf14 mRNA expression: genotype × sex interaction (P = 0.0036). Sex differences: a, P < 0.0001. Differences among genotypes were observed only in females (*P < 0.001 vs wt female). (B) Tmepai mRNA expression. Genotype × sex interaction: P = 0.0003. Sex differences: a, P < 0.0001. Differences among genotypes were observed only in females (*P < 0.001 vs wt females).
Citation: Journal of Endocrinology 232, 3; 10.1530/JOE-16-0371
TGFβ1 receptors
The expression of the type 1 (Alk1 and Alk5) and type 2 (TβR2) TGFβ receptors was found increased in male pituitaries compared to that in females (Fig. 4, P < 0.0001). No genotype differences were found in males, but in females, the mRNA expression of TβR2 (Fig. 4A, P < 0.001) and Alk5 (Fig. 4B, P < 0.001) was found reduced in hCGβ+ compared to their WT counterparts. On the other hand, no differences among genotypes were found in Alk1 expression in female pituitaries (Fig. 4C).
Sex differences in TGFβ1 receptors expression. mRNA transcripts were amplified with specific primers by qPCR and normalized to CyclophilinB. Results are expressed relative to those WT females (n = 7–12/group) and analyzed by two-way ANOVA. Bonferroni’s post hoc test was conducted as the interaction between effects was significant. (A) TβR2 mRNA expression: genotype × sex interaction (P = 0.0003). Sex differences: a, P < 0.0001. Differences among genotypes were observed only in females (*P < 0.001 vs wt female). (B) Alk5 mRNA expression: genotype × sex interaction P = 0.0004. Sex differences: a, P < 0.0001. Differences among genotypes were observed only in females (*P < 0.001 vs wt female). (C) Alk1 mRNA expression. Genotype × sex interaction was no significant. Sex differences: a, P < 0.0001.
Citation: Journal of Endocrinology 232, 3; 10.1530/JOE-16-0371
Other components of TGFβ1 system
When we measured the mRNA expression of Smad4 and Smad7, we also observed gender and sex differences. Both Smads presented higher expression in male pituitaries compared to females (P < 0.05), but without differences among genotypes. On the other hand, Smad4 and Smad7 mRNA expression were found decreased in pituitaries from female hCGβ+ compared to their WT counterparts (Smad4 Fig. 5A; Smad7 Fig. 5B; P < 0.001).
Sex and genotype differences in other components of TGFβ1 system. mRNA transcripts were amplified with specific primers by qPCR and normalized to CyclophilinB. Results are expressed relative to those WT females (n = 5–12/group) and analyzed by two-way ANOVA. Bonferroni’s post hoc test was conducted when the interaction between effects was significant. (A) Smad4 mRNA expression: genotype × sex interaction (P = 0.0027). Sex differences: a, P < 0.0001. Differences among genotypes were found only in females (*P < 0.05 vs wt female). (B) Smad7 mRNA expression. Genotype × sex interaction: P = 0.0137. Sex differences: a, P < 0.0001. Differences among genotypes were found only in females (*P < 0.001 vs wt female). (C) Ltbp1 mRNA expression: genotype × sex interaction (P = 0.01). Sex differences: a, P < 0.0001. Differences among genotypes were found only in females (*P < 0.01 vs wt female).
Citation: Journal of Endocrinology 232, 3; 10.1530/JOE-16-0371
On the other hand, latent TGFβ-binding protein 1 (Ltbp1) expression was also found increased in male pituitaries when compared to females (Fig. 5C, P < 0.0001). Reduced Ltbp1 expression was found in hCGβ+ female pituitaries compared to their WT counterparts (P < 0.01), whereas no differences among genotypes were found in males.
Dopaminergic system
As it was demonstrated that DA increases TGFβ1 expression in lactotrophs (Sarkar et al. 2005), as well as the pituitary TGFβ1 activity (Recouvreux et al. 2011), we were interested in evaluating whether a decreased dopaminergic tone could be involved in the decreased pituitary TGFβ1 activity. For this purpose, we measured the tyrosine hydroxylase (TH) expression in hypothalamic homogenates. We found decreased Th mRNA in males compared to females (Fig. 6A, P < 0.0001), but without genotype differences. On the other hand, Th expression was found reduced in hCGβ+ females compared to their WT siblings (P < 0.001). This result could imply a lower dopaminergic tone reaching the pituitary in this group. We next measured the pituitary expression of Drd2 in all groups. As shown in Fig. 6B, the Drd2 expression was found higher in male pituitaries compared to females, in accordance with lower dopaminergic tone in this sex (P < 0.0001), without differences among genotypes. But in females, the Drd2 expression was found significantly increased in hCGβ+ group compared to their WT siblings (P < 0.001), as expected when the dopaminergic tone is reduced. Finally, to know whether genotype differences found in hypothalamic Th expression in females were reflected in DA concentration, we evaluated the hypothalamic DA concentration by HPLC in WT and hCGβ+ females. As it could be observed in Fig. 6C, we did not find differences among groups.
Sex and genotype differences in dopaminergic system. (A and B) mRNA transcripts were amplified with specific primers by qPCR and normalized to CyclophilinB. Results are expressed relative to those WT females (n = 5–7/group) and analyzed by two-way ANOVA. Bonferroni’s post hoc test was conducted when the interaction between effects was significant. (A) Th mRNA expression: genotype × sex interaction (P = 0.0021). Sex differences: a, P < 0.0001. Differences among genotypes were found only in females (*P < 0.001 vs wt female). (B) Dopamine D2 receptor gene (Drd2) mRNA expression. Genotype × sex interaction (P = 0.0021). Sex differences: a, P < 0.0001. Differences among genotypes were found only in females (*P < 0.001 vs wt female). (C) DA concentration in female hypothalami performed by HPLC. Results are expressed relative to WT females (n = 6/group). Student’s t test was performed (P = 0.6334), no differences were found between groups.
Citation: Journal of Endocrinology 232, 3; 10.1530/JOE-16-0371
Thrombospondin 1 (TSP-1) synthetic analogue ABT-898 normalizes pituitary-active TGFβ1 levels in hCGβ+ females
TSP-1 is a large multifunctional glycoprotein, component of the extracellular matrix, involved in multiple biological processes such as angiogenesis, apoptosis and activation of TGFβ1 (Lawler 2002). ABT-898 (Abbott Laboratories) is a TSP-1 synthetic analogue that mimics TSP-1 antiangiogenic action (Haviv et al. 2005). We have previously studied the effect of ABT-898 on experimental prolactinomas induced by chronic diethylstilbestrol (DES) treatment in female rats (Recouvreux et al. 2012). We demonstrated that an in vivo ABT-898 treatment markedly enhanced pituitary-active TGFβ1 concentration in the tumors, counteracted the increase in pituitary size and reduced the serum prolactin levels, as well as pituitary proliferation rate induced by DES.
To demonstrate the involvement of the reduced pituitary TGFβ1 activity in prolactinoma development in hCGβ+ female mice, we next conducted the ABT− in vivo treatment in our experimental model. We found that ABT-898 treatment in fact recovered the pituitary-active TGFβ1 concentration (Fig. 7A). In accordance, pituitary weight was reduced in the ABT-treated hCGβ+ group (Fig. 7B, P < 0.05), as well as the serum prolactin levels (Fig. 7C, P < 0.01). As females used in this experiment were younger (4–5 months) than the previously used mice (Fig. 1B, 6–7 months), the hyperprolactinemia observed in hCGβ+ females was not as high as previously observed, since serum PRL levels increase exponentially from 3 months onwards. On the other hand, Fig. 7D shows higher PRL concentration in WT pituitary homogenates, due to the normal inhibitory effect of dopamine and TGFβ1 on hormone secretion. But the pituitary PRL concentration decreased in prolactinomas from hCGβ+ control female because this inhibition was lost (P < 0.001). Interestingly, as ABT treatment enhanced biological TGFβ1 activity, the inhibition on hormone secretion was recovered (P < 0.05).
Thrombospondin 1 (TSP-1) synthetic analog ABT-898 normalizes pituitary active TGF-β1 level. (A) Active TGFβ1 concentration was measured by ELISA in pituitary homogenates (n = 5–7/group). One-way ANOVA followed by Tukey’s test was performed (P = 0.0007). hCGβ+ control pituitaries showed lower active cytokine concentration levels compared to WT females (*P < 0.05). ABT treatment increased active TGFβ1 levels in hCGβ+ pituitaries (ABT-898) compared to control hCGβ+ females (***P < 0.001). (B) Pituitary weight (mg, n = 5–7/group). One-way ANOVA was performed followed by Tukey’s test (P = 0.0054). hCGβ+ control females showed higher pituitary weight compared to WT (**P < 0.01). hCGβ+ ABT-898-treated female mice showed decreased pituitary weight compared to hCGβ+ control group (*P < 0.05). (C) Serum prolactin levels measured by RIA (n = 5–7/group). One-way ANOVA was performed followed by Tukey’s test (P < 0.0001). hCGβ+ control females showed higher serum PRL levels compared to WT (***P < 0.001). hCGβ+ ABT-898-treated female hCGβ+ mice showed decreased serum PRL levels compared to hCGβ+ control female group (**P < 0.01). (D) Pituitary PRL concentration measured by RIA in pituitary homogenates (n = 5–7/group). One-way ANOVA was performed followed by Tukey’s test (P = 0.0004). hCGβ+ control females as well as hCGβ+ ABT-898-treated females showed lower pituitary PRL concentration levels compared to WT (***P < 0.001). However, hCGβ+ ABT-898-treated group partially recover pituitary PRL content, showing increased pituitary PRL concentration levels compared to hCGβ+ control group (*P < 0.05).
Citation: Journal of Endocrinology 232, 3; 10.1530/JOE-16-0371
Other members of TGFβ family
Finally, as other members of the TGFβ growth factor family, such as TGFβ3 and BMP4, have also been involved in prolactinoma development, we next measured the mRNA expression of these factors in our experimental model. As Fig. 8A shows, we did not find genotype differences in pituitary Tgfβ3 mRNA levels in females. However, we found a gender difference: decreased Tgfβ3 mRNA levels were found in male pituitaries related to females (P = 0.0009).
Other members of TGFβ family. mRNA transcripts were amplified with specific primers by qPCR and normalized to CyclophilinB. Results are expressed relative to those WT females (n = 5–7/group) and analyzed by two-way ANOVA. Bonferroni’s post hoc test was conducted when the interaction between effects was significant. (A) Tgfβ3 mRNA expression: genotype × sex interaction (P = 0.9966). Sex differences: a, P < 0.0009. No differences among genotypes were found. (B) Bmp4 mRNA expression. Genotype × sex interaction: P = 0.0055. Sex differences: a, P < 0.0001. Differences among genotypes were found only in females (*P < 0.001 vs wt female).
Citation: Journal of Endocrinology 232, 3; 10.1530/JOE-16-0371
On the other hand, when we evaluated pituitary Bmp4 mRNA levels, it was found significantly reduced in hCGβ+ female pituitaries compared to WT littermates (Fig. 8B, P < 0.001). Interestingly, we found an important gender difference in pituitary Bmp4 expression: Bmp4 levels were significantly reduced in male pituitaries compared to females (P < 0.0001).
These results show that neither BMP4 nor TGFβ3 are involved in prolactinoma development in hCGβ+ females.
Discussion
In the present study, we describe alterations and sex differences in the pituitary TGFβ1 system of transgenic hCGβ+ mice. Active and total cytokine levels, TGFβ1 biological activity as well as the expression of Ltbp1, TβR2, Alk5, Smad4 and Smad7 were found decreased in tumoral hCGβ+ female pituitaries when compared with WT siblings.
On the other hand, we found that male pituitaries presented higher levels of active and total cytokine than females. In accordance, we also found the expression of several other components of the system increased, including Ltbp1, TβR2, Alk5, Alk1, Smad4 and Smad7, and TGFβ1 target genes (Tmepai and Klf14) in male pituitaries when compared to females.
TGFβ1 being an important inhibitory factor of lactotroph function, we postulate that: 1- decreased TGFβ1 activity found in pituitaries from hCGβ+ females is involved in their development of prolactinomas; 2- the higher expression of TGFβ1 system found in male pituitaries could protect this sex from the prolactinoma development, even in the presence of high levels of hCG.
To demonstrate the involvement of the reduced pituitary TGFβ1 activity in prolactinoma development in hCGβ+ female mice, we conducted an in vivo treatment to recover the pituitary-active TGFβ1 concentration. In fact, we found that ABT-898 treatment was successful in restoring pituitary TGFβ1 activity and, in accordance, pituitary weight, as well as the serum prolactin levels, were reduced in the ABT-treated hCGβ+ group.
As mentioned before, the hyperstimulation of the immature ovary by constant high hCG levels, induces a marked alteration in ovarian steroid production at early stage of sexual maturation in hCGβ+ females and induces precocious puberty, and production of high levels of estradiol, testosterone and progesterone during the first month of age. Subsequently, the persistent high hCG levels induces a massive luteinization and a constant increase in serum progesterone. By 6 months of age, females, but not males, present with large prolactinomas and marked hyperprolactinemia (Rulli et al. 2002, Ratner et al. 2012). Even though the effect of chronically elevated levels of estradiol is well known to induce experimental prolactinomas (Heaney et al. 1999, 2002), adult hCGβ+ females present normal estradiol levels. In a previous work, amplifying effect of progesterone was demonstrated on the growth of these estrogen-dependent tumors in hCGβ+ females (Ahtiainen et al. 2010). However, males exposed to high serum levels of hCG and androgens do not develop pituitary tumors (Ahtiainen et al. 2005). Thus, additional factors must be involved in the development of prolactinomas in hCGβ+ females.
The elevated estrogens level presented by hCGβ+ females at early age was proposed to partially explain the occurrence of prolactinoma in adulthood (Rulli et al. 2002, Ratner et al. 2012). In fact, an ovariectomy at 6 weeks of age totally abolished the pituitary gland enlargement and the hyperprolactinemia. Perhaps, this fact could initiate the process of transformation that was later accompanied by the effect of other factors, including high progesterone levels. In this regard, it was described that progesterone not only acts at the pituitary level but also in the hypothalamus, where it suppresses messenger ribonucleic acid levels in the arcuate nucleus (Arbogast & Voogt 1993, 1994).
In fact, the high levels of progesterone present in hCGβ+ female could be involved in the decreased expression of hypothalamic Th we found in this group. Because TH activity is the main critical factor that controls DA synthesis, its decreased activity could influence the DA levels reaching the pituitary. In accordance, the Drd2 expression was found increased in pituitaries from hCGβ+ female compared to their WT siblings, and it could be reflecting a lower dopaminergic tone in this group.
As DA, acting through the Drd2, upregulates TGFβ1 and TβR2 expression in lactotrophs (Sarkar et al. 2005), as well as the local cytokine activity (Recouvreux et al. 2011), the reduced levels of active and total TGFβ1, as well as TβR2 expression we found in tumoral pituitaries from hCGβ+ female, could reflect a lower dopaminergic tone in hCGβ+ females. However, no differences were found in hypothalamic DA concentration, measured by HPLC, among WT and hCGβ+ females. The pressure exercised on the median eminence by the prolactinoma in hCGβ+ females could prevent the release and transport of DA and other hypothalamic factors toward the pituitary. Nevertheless, with the present results, we cannot assure that the lower TGFβ1 activity found in hCGβ+ female pituitaries is a consequence of lower dopaminergic tone reaching the pituitaries in this group, and this deserves future studies.
On the other hand, in males, lower hypothalamic Th and higher pituitary Drd2 expression were observed, according to lower dopaminergic tone in this sex compared to females (Gudelsky & Porter 1981, Freeman et al. 2000), but interestingly, the hCGβ overexpression did not induce alterations in males.
The reduced expression of the other components of TGFβ1 system we observed in hCGβ+ female pituitaries could be related to the decreased TGFβ1 biological activity found in this group. In this regard, it was described that the cytokine enhances its own expression as well as Ltbp1 levels in several normal and transformed cells (Taipale et al. 1996, Weikkolainen et al. 2003). Moreover, a dose-related increase in Ltbp1 production was demonstrated in response to treatment with TGFβ1 (Dallas et al. 1994, Koli & Keski-Oja 1995). Smad7 transcription is also regulated by TGFβ1 through direct binding of Smad3 and Smad4 to the Smad7 promoter (Nagarajan et al. 1999, Stopa et al. 2000). On the contrary, we did not observe genotype differences in the pituitary TGFβ1 system in males. Moreover, all the components evaluated were found increased in male pituitaries, compared to WT females, and this factor could protect them from tumor development.
Other members of the TGFβ growth factor family, such as TGFβ3 and BMP4, have also been shown to play a role in prolactinoma development. Because Tgfβ3 is synthetized by lactotrophs, we could expect increased pituitary Tgfβ3 expression reflecting the increase in the proportion of lactotrophs in hCGβ+ female pituitaries. However, we did not find significant genotype differences. As pituitary Tgfβ3 mRNA levels are regulated by estradiol (Hentges et al. 2000), the lack of genotype differences could be a consequence of normal and physiological levels of estradiol present in hCGβ+ females (Rulli et al. 2002). On the other hand, the decreased Tgfβ3 mRNA levels found in male pituitaries could be the result of lower serum estradiol level in this sex. Hence, with this result, we demonstrated that the prolactinoma development in hCGβ+ females does not depend on pituitary Tgfβ3 expression.
Regarding pituitary BMP4 expression, it has been previously demonstrated, by immunohistochemistry, that it is principally confined to the somatotroph, corticotroph and thyrotroph cell populations, and rarely detectable in lactotroph cells in normal pituitary (Giacomini et al. 2006). However, BMP4 protein was found overexpressed in several experimental models of prolactinomas, and even in human prolactinomas compared with normal pituitaries (Paez-Pereda et al. 2003). However, and in contrast to these previous findings, other group found BMP4 overexpression only in a low proportion of the human prolactinoma assayed, finding reduced BMP4 expression in the others (Yacqub-Usman et al. 2012).
When we assayed Bmp4 mRNA expression in the hCGβ+ mouse model, we found it significantly reduced in hCGβ+ female pituitaries compared with their WT siblings. On the other hand, we found a sharp gender difference. Male pituitaries express greatly reduced levels of Bmp4 without differences among genotypes. It would therefore be worth finding out the causes and consequences of (a) the gender differences found and (b) the decreased Bmp4 mRNA expression found in hCGβ+ female pituitaries. With the present results, we could assure that the prolactinoma development in hCGβ+ female does not depend on Bmp4 overexpression.
Gender differences in prolactinoma incidence and behavior have been previously described. Women present higher prevalence of prolactinomas during the fertile period (20–50 years), when the tumor ratio between the sexes is estimated to be 10:1. But after the fifth decade of life, when serum estradiol decreases, this sexual difference disappears and the frequency is similar between sexes. The higher levels of serum estradiol have been proposed to be involved in the higher incidence of prolactinomas in fertile women (Colao et al. 2003, Gillam et al. 2006).
Interestingly, we have previously demonstrated that estradiol negatively controls most of the components of the TGFβ1 system (Recouvreux et al. 2013). In fact, we here described sex differences in the pituitary TGFβ1 system in this model, as we had previously observed in another well-characterized model of prolactinoma, the transgenic knockout mice lacking functional dopamine receptor type 2 (Drd2−/−).
In summary, we postulate that the reduced TGFβ1 activity we found in hCGβ+ female pituitaries is involved in the development of female prolactinomas. We demonstrated that by enhancing the pituitary TGFβ1 activity, we succeeded in reducing the tumor growth, decreasing the hyperprolactinemia and recovering the inhibition of hormone secretion in hCGβ+ females.
Even though the high serum progesterone levels could amplify the effect of normal estradiol, acting directly on lactotroph proliferation, it also induced a decrease in hypothalamic TH, and it could decrease the dopamine levels reaching the pituitary. The influence of these factors merits future studies.
On the other hand, the sex differences observed in regulation of the pituitary TGFβ1 system could explain the gender differences found in the incidence of prolactinoma development: the stronger TGFβ1 system found in male pituitaries could protect them from excessive lactotroph proliferation.
Finally, prolactinomas are the most prevalent type of hormone-secreting pituitary tumors in humans, and generally respond well to the therapies with dopamine agonists. However, for patients exhibiting resistance to these drugs, alternative treatments are desired. Our results place the synthetic TSP-1 analogue as potential alternative or complementary therapy in current treatments against prolactinomas, especially in those that are resistant to dopaminergic drugs.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the Agencia Nacional de Promoción Científica y Técnica, Buenos Aires, Argentina (grant PICT N2136 to G D T), CONICET, Argentina (PIP 183 to S B R), René Barón Foundation (Argentina, to G D T and S B R) and Williams Foundation (Argentina, to G D T and S B R).
Acknowledgements
The authors thank the National Institute of Diabetes and Digestive and Kidney Diseases National Hormone and Pituitary Program and Dr A F Parlow for prolactin RIA kit.
References
Ahtiainen P, Rulli SB, Shariatmadari R, Pelliniemi LJ, Toppari J, Poutanen M & Huhtaniemi IT 2005 Fetal but not adult Leydig cells are susceptible to adenoma formation in response to persistently high hCG level: a study on hCG overexpressing transgenic mice. Oncogene 24 7301–7309. (doi:10.1038/sj.onc.1208893)
Ahtiainen P, Sharp V, Rulli SB, Rivero-Muller A, Mamaeva V, Roytta M & Huhtaniemi I 2010 Enhanced LH action in transgenic female mice expressing hCGbeta-subunit induces pituitary prolactinomas; the role of high progesterone levels. Endocrine-Related Cancer 17 611–621. (doi:10.1677/ERC-10-0016)
Arbogast LA & Voogt JL 1993 Progesterone reverses the estradiol-induced decrease in tyrosine hydroxylase mRNA levels in the arcuate nucleus. Neuroendocrinology 58 501–510. (doi:10.1159/000126583)
Arbogast LA & Voogt JL 1994 Progesterone suppresses tyrosine hydroxylase messenger ribonucleic acid levels in the arcuate nucleus on proestrus. Endocrinology 135 343–350. (doi:10.1210/en.135.1.343)
Ben-Jonathan N 1985 Dopamine: a prolactin inhibiting hormone. Endocrine Reviews 6 564–589. (doi:10.1210/edrv-6-4-564)
Ben Jonathan N & Hnasko R 2001 Dopamine as a prolactin (PRL) inhibitor. Endocrine Reviews 22 724–763. (doi:10.1210/edrv.22.6.0451)
Brunschwig EB, Wilson K, Mack D, Dawson D, Lawrence E, Willson JK, Lu S, Nosrati A, Rerko RM & Swinler S et al. 2003 PMEPA1, a transforming growth factor-beta-induced marker of terminal colonocyte differentiation whose expression is maintained in primary and metastatic colon cancer. Cancer Research 63 1568–1575.
Colao A, Sarno AD, Cappabianca P, Briganti F, Pivonello R, Somma CD, Faggiano A, Biondi B & Lombardi G 2003 Gender differences in the prevalence, clinical features and response to cabergoline in hyperprolactinemia. European Journal of Endocrinology 148 325–331. (doi:10.1530/eje.0.1480325)
Dallas SL, Park-Snyder S, Miyazono K, Twardzik D, Mundy GR & Bonewald LF 1994 Characterization and autoregulation of latent transforming growth factor beta (TGF beta) complexes in osteoblast-like cell lines. Production of a latent complex lacking the latent TGF beta-binding protein. Journal of Biological Chemistry 269 6815–6821.
Freeman ME, Kanyicska B, Lerant A & Nagy G 2000 Prolactin: structure, function, and regulation of secretion. Physiological Reviews 80 1523–1631.
Galvin-Burgess KE, Travis ED, Pierson KE & Vivian JL 2013 TGF-beta-superfamily signaling regulates embryonic stem cell heterogeneity: self-renewal as a dynamic and regulated equilibrium. Stem Cells 31 48–58. (doi:10.1002/stem.1252)
Gharib SD, Wierman ME, Shupnik MA & Chin WW 1990 Molecular biology of the pituitary gonadotropins. Endocrine Reviews 11 177–199. (doi:10.1210/edrv-11-1-177)
Giacomini D, Páez-Pereda M, Theodoropoulou M, Labeur M, Refojo D, Gerez J, Chervin A, Berner S, Losa M & Buchfelder M et al. 2006 Bone morphogenetic protein-4 inhibits corticotroph tumor cells: involvement in the retinoic acid inhibitory action. Endocrinology 147 247–256. (doi:10.1210/en.2005-0958)
Gillam MP, Molitch ME, Lombardi G & Colao A 2006 Advances in the treatment of prolactinomas. Endocrine Reviews 27 485–534. (doi:10.1210/er.2005-9998)
Gudelsky GA & Porter JC 1981 Sex-related difference in the release of dopamine into hypophysial portal blood. Endocrinology 109 1394–1398. (doi:10.1210/endo-109-5-1394)
Haviv F, Bradley MF, Kalvin DM, Schneider AJ, Davidson DJ, Majest SM, McKay LM, Haskell CJ, Bell RL & Nguyen B et al. 2005 Thrombospondin-1 mimetic peptide inhibitors of angiogenesis and tumor growth: design, synthesis, and optimization of pharmacokinetics and biological activities. Journal of Medicinal Chemistry 48 2838–2846. (doi:10.1021/jm0401560)
Heaney AP, Horwitz GA, Wang Z, Singson R & Melmed S 1999 Early involvement of estrogen-induced pituitary tumor transforming gene and fibroblast growth factor expression in prolactinoma pathogenesis. Nature Medicine 5 1317–1321. (doi:10.1038/15275)
Heaney AP, Fernando M & Melmed S 2002 Functional role of estrogen in pituitary tumor pathogenesis. Journal of Clinical Investigation 109 277–283. (doi:10.1172/Jbib214264)
Heldin CH, Landstrom M & Moustakas A 2009 Mechanism of TGF-beta signaling to growth arrest, apoptosis, and epithelial-mesenchymal transition. Current Opinion in Cell Biology 21 166–176. (doi:10.1016/j.ceb.2009.01.021)
Hentges S, Pastorcic M, De A, Boyadjieva N & Sarkar DK 2000 Opposing actions of two transforming growth factor-beta isoforms on pituitary lactotropic cell proliferation. Endocrinology 141 1528–1535. (doi:10.1210/en.141.4.1528)
Itoh F, Watabe T & Miyazono K 2014 Roles of TGF-beta family signals in the fate determination of pluripotent stem cells. Seminars in Cell and Developmental Biology 32 98–106. (doi:10.1016/j.semcdb.2014.05.017)
Jonas KC, Oduwole OO, Peltoketo H, Rulli SB & Huhtaniemi IT 2014 Mouse models of altered gonadotrophin action: insight into male reproductive disorders. Reproduction 148 R63–R70. (doi:10.1530/REP-14-0302)
Koli K & Keski-Oja J 1995 1,25-Dihydroxyvitamin D3 enhances the expression of transforming growth factor beta 1 and its latent form binding protein in cultured breast carcinoma cells. Cancer Research 55 1540–1546.
Lawler J 2002 Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. Journal of Cellular and Molecular Medicine 6 1–12. (doi:10.1111/j.1582-4934.2002.tb00307.x)
Levy L & Hill CS 2005 Smad4 dependency defines two classes of transforming growth factor β (TGF-β) target genes and distinguishes TGF-β-induced epithelial-mesenchymal transition from its antiproliferative and migratory responses. Molecular and Cellular Biology 25 8108–8125. (doi:10.1128/MCB.25.18.8108-8125.2005)
Maurer RA 1982 Estradiol regulates the transcription of the prolactin gene. Journal of Biological Chemistry 257 2133–2136.
Missale C, Nash SR, Robinson SW, Jaber M & Caron MG 1998 Dopamine receptors: from structure to function. Physiological Reviews 78 189–225.
Nagarajan RP, Zhang J, Li W & Chen Y 1999 Regulation of Smad7 promoter by direct association with Smad3 and Smad4. Journal of Biological Chemistry 274 33412–33418. (doi:10.1074/jbc.274.47.33412)
Paez-Pereda M, Giacomini D, Refojo D, Nagashima AC, Hopfner U, Grubler Y, Chervin A, Goldberg V, Goya R & Hentges ST et al. 2003 Involvement of bone morphogenetic protein 4 (BMP-4) in pituitary prolactinoma pathogenesis through a Smad/estrogen receptor crosstalk. PNAS 100 1034–1039. (doi:10.1073/pnas.0237312100)
Pastorcic M, De A, Boyadjieva N, Vale W & Sarkar DK 1995 Reduction in the expression and action of transforming growth factor-b1 on lactotropes during estrogen-induced tumorigenesis. Cancer Research 55 4892–4898.
Ratner LD, Gonzalez B, Ahtiainen P, Di Giorgio NP, Poutanen M, Calandra RS, Huhtaniemi IT & Rulli SB 2012 Short-term pharmacological suppression of the hyperprolactinemia of infertile hCG-overproducing female mice persistently restores their fertility. Endocrinology 153 5980–5992. (doi:10.1210/en.2012-1393)
Recouvreux MV, Guida MC, Rifkin DB, Becu-Villalobos D & Diaz-Torga G 2011 Active and total transforming growth factor-β1 are differentially regulated by dopamine and estradiol in the pituitary. Endocrinology 152 2722–2730. (doi:10.1210/en.2010-1464)
Recouvreux MV, Camilletti MA, Rifkin DB, Becu-Villalobos D & Diaz-Torga G 2012 Thrombospondin-1 (TSP-1) Analogs ABT-510 and ABT-898 inhibit prolactinoma growth and recover active pituitary transforming growth factor-beta1 (TGF-beta1). Endocrinology 153 3861–3871. (doi:10.1210/en.2012-1007)
Recouvreux MV, Lapyckyj L, Camilletti MA, Guida MC, Ornstein A, Rifkin DB, Becu-Villalobos D & Diaz-Torga G 2013 Sex differences in the pituitary transforming growth factor-beta1 system: studies in a model of resistant prolactinomas. Endocrinology 154 4192–4205. (doi:10.1210/en.2013-1433)
Recouvreux MV, Camilletti MA, Rifkin DB & Diaz-Torga G 2016 The pituitary TGFbeta1 system as a novel target for the treatment of resistant prolactinomas. Journal of Endocrinology 228 R73–R83. (doi:10.1530/JOE-15-0451)
Rulli SB, Kuorelahti A, Karaer O, Pelliniemi LJ, Poutanen M & Huhtaniemi I 2002 Reproductive disturbances, pituitary lactotrope adenomas, and mammary gland tumors in transgenic female mice producing high levels of human chorionic gonadotropin. Endocrinology 143 4084–4095. (doi:10.1210/en.2002-220490)
Rulli SB, Zitta K, Calandra RS & Campo S 2003 Effect of dihydrotestosterone on pituitary follicle-stimulating hormone isoforms in adult male rats treated with a gonadotropin-releasing hormone antagonist. Neuroendocrinology 78 280–286. (doi:10.1159/000074449)
Sarkar DK, Kim KK & Minami S 1992 Transforming growth factor-beta1 messenger RNA and protein expression in the pituitary gland: its action on prolactin secretion and lactotropic growth. Molecular Endocrinology 6 1825–1833. (doi:10.1210/me.6.11.1825)
Sarkar DK, Pastoric M, De A, Engel M, Moses H & Ghasemzadeh MB 1998 Role of transforming growth factor-b type I and TGF-b type II receptors in the TGF-b1 regulated gene expression in pituitary prolactin-secreting lactotropes. Endocrinology 139 3620–3628. (doi:10.1210/endo.139.8.6135)
Sarkar DK, Chaturvedi K, Oomizu S, Boyadjieva NI & Chen CP 2005 Dopamine, dopamine D2 receptor short isoform, transforming growth factor (TGF)-beta1, and TGF-beta type II receptor interact to inhibit the growth of pituitary lactotropes. Endocrinology 146 4179–4188. (doi:10.1210/en.2005-0430)
Stopa M, Anhuf D, Terstegen L, Gatsios P, Gressner AM & Dooley S 2000 Participation of Smad2, Smad3, and Smad4 in transforming growth factor beta (TGF-beta)-induced activation of Smad7. THE TGF-beta response element of the promoter requires functional Smad binding element and E-box sequences for transcriptional regulation. Journal of Biological Chemistry 275 29308–29317. (doi:10.1074/jbc.M003282200)
Taipale J, Saharinen J, Hedman K & Keski-Oja J 1996 Latent transforming growth factor-beta 1 and its binding protein are components of extracellular matrix microfibrils. Journal of Histochemistry and Cytochemistry 44 875–889. (doi:10.1177/44.8.8756760)
Truty MJ, Lomberk G, Fernandez-Zapico ME & Urrutia R 2009 Silencing of the transforming growth factor-beta (TGFbeta) receptor II by Kruppel-like factor 14 underscores the importance of a negative feedback mechanism in TGFbeta signaling. Journal of Biological Chemistry 284 6291–6300. (doi:10.1074/jbc.M807791200)
Weikkolainen K, Keski-Oja J & Koli K 2003 Expression of latent TGF-beta binding protein LTBP-1 is hormonally regulated in normal and transformed human lung fibroblasts. Growth Factors 21 51–60. (doi:10.1080/08977198310001598778)
Yacqub-Usman K, Duong CV, Clayton RN & Farrell WE 2012 Epigenomic silencing of the BMP-4 gene in pituitary adenomas: a potential target for epidrug-induced re-expression. Endocrinology 153 3603–3612. (doi:10.1210/en.2012-1231)
