Abstract
Fetal alcohol exposure (FAE) is known to increase prolactin (PRL) secretion from the pituitary lactotropes. In this study, we determined whether microRNAs (miRs) are involved in FAE-induced alteration in PRL release. We employed a rat animal model of FAE involving feeding pregnant Fisher 344 rats with a liquid diet containing 6.7% alcohol between gestational days 7–21 (AF). Both cyclic and estradiol-implanted FAE females showed increased levels of plasma PRL and pituitary Prl mRNA but reduced levels of pituitary dopamine D2 receptor (D2r) and its short spliced form (D2s). FAE increased the expression levels of miR-9 and miR-326 and did not produce any significant changes in miR-153 or miR-200a levels in the pituitary. Effects of FAE on miR-9 and miR-326 were associated with reduced levels of D2r and D2s, increased levels of Prl in the pituitary, and in plasma. These effects of FAE on D2r, D2s and Prl were enhanced following estradiol treatment. In PRL-producing MMQ cells, ethanol increased miR-9 but not miR-326, reduced levels of D2r and D2s and increased levels of Prl. Treatment of MMQ cells with an anti-miR-9 oligo reduced ethanol effects on miR-9, D2r, D2s and Prl. miR-9 mimic oligos reduced the luciferase activity of reporter vector containing D2r 3′UTR, but failed to reduce the mutant luciferase activity. These data suggest that FAE programs the pituitary to produce increased amounts of miR-9 expression that represses the D2r gene and its spliced variant D2s by targeting its 3′UTR leading to an increase in PRL production and secretion.
Introduction
Dopaminergic neurons in the hypothalamus are important regulators of lactotropic cells in the pituitary gland. Dopamine released from these neurons travels to the pituitary gland and acts on D2 receptors located on the lactotropes of the pituitary gland to reduce secretion of PRL hormone and inhibit control of the lactotropic cell growth (Ben-Jonathan & Hnasko 2001, Cristina et al. 2006, Sarkar 2006). Alcohol is known to alter alternative splicing of the D2 receptor and by reducing the D2S variant, it is believed to suppress dopamine’s ability to reduce PRL secretion and lactotropic cell proliferation (Mello et al. 1988, Seki et al. 1992, De et al. 2002). These effects of alcohol are enhanced by the hormone estradiol (Oomizu et al. 2003, Sengupta & Sarkar 2012), which is also known to reduce D2R activity in lactotropes (Raymond et al. 1978, Sarkar 1982, 2006). Recently, we found that the effects of alcohol on lactotropic cell functions are long lasting especially if the exposure period is during the fetal life (Gangisetty et al. 2015). Fetal alcohol induces epigenetic marks involving long-lasting changes in the expression of DNA methyl transferases (Dnmts) and MeCp2 in association with increased promoter methylation and reduced expression of the D2r gene that lasts through the adult period (Gangisetty et al. 2015). Thus, FAE induces hypermethylation of D2r gene that leads to reduction in D2r expression and its control of lactotrope’s functions.
D2r splice variants D2l and D2s differ by inclusion or exclusion of exon 6, which encodes 29 amino acids in the third intracellular loop, which is essential for G-protein interactions (Guiramand et al. 1995). D2L-mediated signaling inhibits the AKT/protein kinase B activity, whereas D2S, in contrast, is required for the activation of the ERK 1/2 pathway (Iaccarino et al. 2002). Under normal conditions, presence of only one of the two D2R isoforms prevents hyperprolactinemia, formation of lactotrope’s hyperplasia and tumorigenesis that is observed when these isoforms are deleted in D2r−/− mice (Kelly et al. 1997). However, the protective function of the single D2R isoform is overridden when single isoform-knockout mice are challenged by chronic estrogen treatments as they show increased PRL production and lactotrope hyperplasia (Saiardi et al. 1997, Radl et al. 2013). The exact mechanism by which FAE alters D2r splicing is not clearly understood. One possibility is that miRs, small non-coding RNAs, which are about 20–22 nucleotides in length (Bartel 2004), may participate in ethanol-activated D2r splicing and expression changes. This is because an aberrant expression of miRs is associated with FAE (Wang et al. 2009) and is linked to the development of pituitary adenoma (Bottoni et al. 2007, Mao et al. 2010). We addressed whether FAE-induced changes in miRs expression alter the expression of D2r and its spliced isoform D2s and result in increased pituitary PRL production. We show here that miR-9 mediates FAE-induced changes in D2r and D2s expressions and PRL production and secretion from the pituitary.
Materials and methods
Animals
Fisher-344 strain rats were obtained from Harlan Laboratories (Indianapolis, IN, USA), housed and bred in a controlled condition of 12-h light/dark cycle at a constant temperature of 22°C throughout the study. On gestational day 7–21, pregnant rats were fed rat chow ad libitum (AD), a liquid diet containing ethanol (AF) or pair-fed (PF) an isocaloric liquid diet. Both diets were purchased from Bioserve (Frenchtown NJ, USA). The concentration of ethanol varied in the diet for the first 4 days from 1.7 to 5.0% v/v to habituate the animals with the alcohol diet. After this habituation period, animals were fed the liquid diet containing ethanol at a concentration of 6.7% v/v (given fresh diet daily at 17:00 h). We have previously shown that in Fisher-344 rats alcohol feeding via the above-mentioned liquid diet paradigm in pregnant rats elevates the blood ethanol concentration in the range of 80–90 mg/dL at 2 h after the beginning of the dark period (De et al. 1995). At postnatal day 2 (PD2), AF and PF pups were cross-fostered to untreated lactating AD dams to prevent any compromised nurturing by the AF and PF moms. Litter size was reduced to 8 pups per dam. Pups were weaned on PD21 and housed by sex. Only one female offspring per litter was used in each treatment group to avoid any gene homogeneity. A group of AD, PF or AF animals at 30 days of age were ovariectomized and subcutaneously implanted with an estaradiol-17β (Sigma-Aldrich) filled 1-cm silastic capsule (Dow Corning, Midland, MI, USA) under general anesthesia as described previously (Gangisetty et al. 2015). Ovariectomized rats with the estradiol implants were used at 60 days after the implant and about 90 days after birth (n = 6/group). Estrogen levels in plasma of rats with estradiol implants was about 150 pg/mL (Supplementary Fig. 1, see section on supplementary data given at the end of this article). A group of cyclic AD, PF and AF female rats were used at diestrus stage of the estrous cycle around 90 days after birth (n = 6/group). Estrogen levels in plasma of cyclic rats varied between 15 and 22 pg/mL (Supplementary Fig. 1). The stage of the estrous cycle was determined by microscopic examination of vaginal smears, and diestrus phase was characterized by the presence of many leukocytes. Animals were killed and trunk blood and pituitary samples were collected. Trunk blood samples were collected in tubes containing EDTA (0.1 mM), and plasma was isolated from the blood by centrifugation at 1500 g for 15 min. Pituitary and plasma samples were stored at −80°C until use. Trunk blood samples were used for estrogen and PRL assays and pituitary samples were used for gene expression measurements. Animal surgery and care were performed in accordance with institutional guidelines and compiled with NIH policy. Rutgers Institutional Animal Care and Use Committee (IACUC) approved this research protocol.
Cell culture and transfection
MMQ rat pituitary tumor cell line was purchased from American Type Culture Collection and was grown in DMEM/F12 medium (Sigma-Aldrich) with 12.5% horse serum, 2.5% fetal bovine serum and 5% Penn/strep antibiotics (Life Technologies) in 37°C incubator with 7.5% CO2. The cells were cultured in DMEM/F12 medium containing serum supplements (20 nM apotransferrin, 0.6 uM sodium selenite, 2 uM putrecine and 5 ng/mL insulin) (Sigma-Aldrich) during experimentation. MMQ cells were used between passages 6–8. MMQ cells were seeded 200,000 cells per well in F12 medium with serum supplements in 6-well plates. Cells were treated with ethanol at a concentration of 50 mM or 100 mM for 24-h and 48-h time period by adding ethanol every 12 h (n = 6/group). Treated cells were centrifuged and extracted for miRs, RNA and protein.
MMQ cells were transfected with miR-9 mimic oligo or anti-miR-9 oligo or negative control oligo (Life Technologies) at final concentration of 50 nM using Lipofectamine LTX transfection reagent (Life Technologies) as per instructions from the manufacturer. After 12 h of transfection, cells were treated with 50 mM ethanol at 12-h intervals for a period of 24 h. Treated cells were extracted for miRs and total RNA using mirVana microRNA isolation kit (Life Technologies) and RNeasy kit (Qiagen) and determined the expression levels of miRs, D2r, D2s and Prl. Treated cells were also used for extraction of protein and measured the D2R expression by Western blot. The cell culture supernatant was used for PRL measurement by ELISA.
MicroRNA assay
MicroRNA was extracted from pituitary or MMQ cells using mirVana microRNA isolation kit (Life Technologies). The concentration of miR in each sample was measured using nanodrop and quality of miR was assessed by determining absorbance at 260/280 ratio, which was found to be in the range of 1.8–2.0. About 10 ng of miR was converted to cDNA using TaqMan miRNA reverse transcription kit using RT primer specific for each miR. RT reaction was performed in a thermocycler (Applied Biosystems) using the program (16°C for 30 min, 42°C for 30 min, 85°C for 5 min and finally at ~4°C). TaqMan assay for each miR was performed using a specific assay for miR-9 (Id 000583), miR-153 (Id 001191), miR-200a (Id 000502), miR-326 (Id 001061) and U6 snRNA (Id001973). All miR kits were obtained from Life Technologies. TaqMan RT-PCR was performed at 50°C for 2 min, 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min in a 7500 Real-Time PCR machine (Applied Biosystem). The Ct values for all targeted miRs were observed in the range of 25–27 and U6 snRNA was observed at 22. None of the miRs or U6 snRNA required any pre-amplification step. Relative quantity of each miR was determined by standard curve method. Each miR/U6 snRNA RT sample was serially diluted and Ct value was determined. A standard curve was plotted using known concentrations of miR/U6 snRNAs versus Ct values. Results were presented as miR and U6 snRNA (internal control) ratios.
Real-time PCR for gene expression measurements
Gene expression levels of Prl, D2r, D2s in rat pituitaries and MMQ cells were measured by quantitative RT-PCR (SYBR green assay). Total RNA from pituitary or MMQ cells was extracted using RNeasy kit (Qiagen). The concentration of RNA in each sample was determined using nanodrop, and quality was assessed by measuring absorbance at 260/280 ratio, which was found to be in the range of 1.8–2.0. About 1 µg of RNA was converted to first-strand complementary DNA (cDNA) using high-capacity cDNA reverse transcription kit (Life Technologies) as per instructions from the manufacturer. All the primer sequences used for the study are given in Table 1. Real-time quantitative PCR was performed at 95°C for 5 min followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, 72°C for 40 s in Applied Biosystems 7500 Real-Time PCR System. The quantity of target gene expression was measured using standard curve method. Control RT sample was serially diluted and Ct values of these diluted samples were measured. A standard curve was plotted using known concentrations of RNA versus Ct values. Gapdh, 18S rRna and Rpl-19 were used as reference genes (internal controls) in the study. Values of these genes are shown in Supplementary Fig. 2. Gene expression levels in the text were presented as the ratios of target gene and Gapdh.
Primer sequences used for the study.
| Primer name | Sequence |
|---|---|
| Prl FP | 5′ CAGAAAGTCCCTCCGGAACTT 3′ |
| Prl RP | 5′ AGGAGCTTCATGGATTCCACC 3′ |
| D2r FP | 5′ CCCAGAGAGGACCCGGTATAG 3′ |
| D2r RP | 5′ CTGGTTTGGCAGGACTGTCA 3′ |
| D2s FP | 5′ CCACTCAAGGATGCTGC 3′ |
| Gapdh FP | 5′ AGACAGCCGCATCTTCTTGT 3′ |
| Gapdh RP | 5′ CTTGCCGTGGGTAGAGTCAT 3′ |
| D2r 3′UTR FP1 | 5′ CCGCTCGAGGTCTGCCCCTTGCC 3′ |
| D2r 3′UTR RP | 5′ GACTCTTGTCAAGGTTTTATT 3′ |
| D2r 3′UTR miR-9 FP1 | 5′ CCGCTCGAGCAAGCTGTGGGCAG 3′ |
| D2r 3′UTR miR-9 RP1 | 5′ TTGCGGCCGCTCCCTCCCACCACCT 3′ |
| D2r 3′UTR mut1 FP | 5′ CCCTGTCTCCTTGGCAGGGAAGATGCAGCGGCCTT 3′ |
| D2r 3′UTR mut1 RP | 5′ AAGGCCGCTGCATCTTCCCTGCCAAGGAGACAGGG 3′ |
| D2r 3′UTR mut2 FP | 5′ CCTGTCTCCTTGGCACCATTTATGCAGCGGCCTTCCTTG 3′ |
| D2r 3′UTR mut2 RP | 5′ CAAGGAAGGCCGCTGCATAAATGGTGCCAAGGAGACAGG 3′ |
| D2r 3′UTR mut3 FP | 5′ ACCCTGTCTCCTTGGCAGGATTGATGCAGCGGCCTTCCT 3′ |
| D2r 3′UTR mut3 RP | 5′ AGGAAGGCCGCTGCATCAATCCTGCCAAGGAGACAGGGT 3′ |
| miR-9 inhibitor | 5′-mU/ZEN/mCmA mUmAmC mAmGmC mUmAmG mAmUmA mAmCmC mAmAmA mG/3ZEN/-3′ |
| NC5 Neg.con.inhibitor | 5′-mG/ZEN/mCmG mAmCmU mAmUmA mCmGmC mGmCmA mAmUmA mUmGmG /3ZEN/-3′ |
Forward primer (FP), reverse primer (RP), 2′-O-methyl residue (m) with ZENTM modifications (ZEN) at or near the end of miRNA inhibitor oligos to confers resistance to nuclease degradation and increase the binding affinity.
Western blot analysis for protein measurements
Protein levels of D2R were determined by Western blot analysis. About 30 µg of total protein from pituitary tissue or MMQ cells were run in 12% SDS PAGE and transferred to PVDF membrane (GE Health Care, Piscataway, NY, USA) at 30 V overnight at 4°C. The membranes were blocked in 5% non-fat dry milk-TBS-0.1% Tween 20 (TBST) at room temp for 3 h and then incubated with primary antibody in the same buffer at 4°C for overnight. The primary antibodies used were rabbit polyclonal D2R (H-50) (1:200; cat# sc-9113; Santa Cruz Biotechnology) and mouse anti-β-actin monoclonal antibody (JLA20; cat# CP01; 1:5000, Calbiochem). The membranes were washed in TBST and then incubated with corresponding peroxidase conjugated secondary antibody (Vector Labs) at room temperature for 1 h. The membranes were washed in TBST and incubated with ECL reagent (Thermo Fisher Scientific) and were developed on the film by autoradiography. The protein band intensities were determined by Image Studio software (Image Studio, Lincoln, NE, USA) and normalized with corresponding β-actin band intensity.
PRL hormone enzyme immunoassay (EIA)
Plasma PRL levels were measured using rat PRL ELISA kit (Alpco Diagnostics, Salem, NH, USA). Each sample was assayed in duplicate. The lower detection limit for prolactin using this kit is about 0.6 ng/mL. The intra-assay coefficients of variation of the assay were found to be 3.85–5.32%.
Estrogen ELISA assay
Plasma estrogen levels were measured using rat estrogen ELISA kit (My Biosource, San Diego, CA, USA). Each sample was assayed in duplicate. The detection range of the assay is 12.5 pg/mL–1000 pg/mL. The intra-assay coefficients of variation of the assay were found to be 4.8–5.3%.
In vivo knock down of miR-9
miR-9 and negative control inhibitor oligos were custom synthesized for in vivo experiments (IDT, Coralville, IA, USA) and sequences were listed in Table 1. miR-9 inhibitor and negative control inhibitor oligos were infused directly into the third ventricle as described previously (Gangisetty et al 2014, Jan et al. 2015). Rats were injected with 5 µL of oligos dissolved in artificial cerebrospinal fluid at a concentration of 1 nmol/µL directly into the third ventricle at the rate of 1 µL/min. After injection the syringe was kept in place for 5 min to avoid the oligo being sucked out during removal. The skin was closed with a wound clip. After 24 h, these rats were sacrificed and their blood and pituitary samples were collected. Plasma was extracted from the blood for PRL measurement. Pituitary samples were utilized for miRNA assay and gene expression measurement and protein expression.
Luciferase assay
The 3′UTR of rat D2r full length or short sequence containing miR-9 binding site were PCR amplified from pituitary genomic DNA using primers with restriction enzyme adopters as listed in Table 1. We initially cloned the PCR product in to basic PCR2.1 vector (Invitrogen) and digested the plasmid with Xho1 and Not1 restriction enzymes and cloned in to psiCHECK 2.0 (Promega), a luciferase reporter vector downstream of renilla luciferase gene and the clones were validated by sequencing. In this vector, renilla luciferase was used as a target reporter and firefly luciferase was used as a normalization control. We constructed 3 different mutants with change in nucleotide sequences of miR-9-binding site using quick change site-directed mutagenesis kit (Agilent Technologies) according to manufacturer instructions. We used the psiCHECK 2.0 vector containing D2r 3′-UTR wild-type sequence as a template to make mutants, and primers used are given in the Table 1.
MMQ cells (50,000 cells/well) were transfected with 100 ng of reporter vector or vector containing D2R 3′-UTR wild-type or mutant plasmid DNA along with either miR-9 mimic oligo or negative control oligo (50 nM at final concentration) using Lipofectamine LTX reagent. After 48 h post transfection we measured renilla and firefly luciferase activity using Dual Glo luciferase assay system (Promega) in BioTech model synergy HT plate reader (Winooski, VT, USA). Eight samples were used in each group in transfection studies. Luciferase activity was measured in duplicate.
Statistical analysis
The data shown in figures are mean ± s.e.m. The significant differences between two groups were analyzed using the unpaired t test, and two-tailed P value <0.05 was considered significant. The significant differences between different treatment groups with single factor (e.g. alcohol treatment) were analyzed by one-way analysis of variance (ANOVA) with Newman–Keuls post hoc test. The significant differences between different treatment groups with multiple factors (e.g., cyclic and estradiol treatment) were analyzed using two-way ANOVA with Bonferroni post hoc tests. Significance level was set at P < 0.05. F-statistics and P values of data shown in figures were presented in Supplementary Table 1.
Results
Fetal alcohol exposure increases PRL levels in plasma and the pituitary but decreases D2r and D2s levels in the pituitary
To investigate whether rats that were exposed to alcohol in utero display any abnormalities in lactotropic hormone secretion and dopamine receptor D2R regulation during adulthood, we analyzed PRL, D2R and D2S expression in ovariectomized and estradiol-treated rats. Data shown in this figure confirm our previous observations (Gangisetty et al. 2015) that estradiol administration increases plasma PRL (Fig. 1A) and pituitary Prl mRNA levels (Fig. 1B) while decreases pituitary D2r (Fig. 1C) and D2s mRNA levels (Fig. 1D). Furthermore, data shown in Fig. 1A and B indicate that both plasma levels of PRL and pituitary levels of Prl mRNA were elevated in cyclic and estrogen-implanted rats treated with alcohol in utero (AF) as compared to controls (AD and PF). In contrast, data shown in Fig. 1C and D indicate that D2r and D2s mRNA levels in the pituitary were reduced in both cyclic and estrogen-treated AF rats, as compared to PF and AD controls. Reference genes Gapdh, 18S rRna and Rpl-19 expression levels were unaltered in any of the treatment conditions (Supplementary Fig. 3A, C and E). These data provide correlative evidence for a possible mediatory role of D2R and its spliced variant D2S in FAE-induced increases in PRL production and secretion from the pituitary gland.
Fetal alcohol exposure alters lactotropic cell function in the pituitary gland of cyclic and estradiol-treated ovariectomized rats. Alcohol-fed (AF), pair-fed (PF) or ad libitum-fed (AD) rats were used either on the day of diestrus (cyclic) or used 60 days after ovariectomy with an estradiol implant (E2). Levels of plasma PRL (A), pituitary Prl mRNA (B), D2r mRNA (C) and D2s mRNA (D) are shown in histograms. Data are mean ± s.e.m. of n = 6 animals per groups and analyzed using two-way ANOVA with the Bonferroni post hoc test. **P < 0.01 and ***P < 0.001 between AF and controls (AD or PF) in the similarly treated group (for F values please see Supplementary Table 1). Please note that AF-treated cyclic group did not achieve a significant level when compared to AD- and PF-treated cyclic group in two-way ANOVA test but did achieve a significant level when compared to AD and PF group in one-way ANOVA test (df-2,15; F-32.22; P < 0.001) and Newman–Keul post hoc test (AF vs AD and PF, P < 0.001).
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
MicroRNA target prediction in 3′UTR of dopamine receptor D2 (D2r)
We used target scan web tool to predict the miRs targeting 3′UTR of D2r. The prediction analysis showed that 3′UTR of rat D2r has putative binding sites for miR-153, miR-200a, miR-9 and miR-326. The sequence alignment of D2r 3′UTR target and miR sequence showing 7–8-mer seed match (Fig. 2A). Of these four miRs, miR-9-, miR-200a- and miR-326-binding sites were conserved among different species such as mouse, human, chimpanzee and rhesus monkey (Fig. 2B).
MicroRNA target prediction in 3′UTR of dopamine receptor D2 (D2r). (A) D2r gene with 5′UTR and 3′UTR was represented. The putative miRNA-biding sites of D2r 3′UTR were also represented by thick vertical lines at 3′UTR region. The position of each miRNA-binding site of D2r 3′UTR, the sequence pairing of target region and miRNA seed match were described. (B) The conserved binding sequence of each miRNA in different species such as rat, human, mouse, chimpanzee and rhesus monkey were highlighted.
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
Fetal alcohol exposure increases miR-9 and miR-326 expression in the pituitary gland
We measured the expression level of miRs targeting 3′UTR of D2r using TaqMan miRNA assay in the pituitary of both cyclic and estradiol-treated AF, AD and PF rats. We did not find any change in the expression of these miRs with estradiol treatment (Fig. 3). However, we found that in both cyclic and estradiol-treated rats, expression levels of miR-9 and miR-326 were significantly increased in the pituitary of AF rats compared to AD and PF controls (Fig. 3A and D). However, expression levels of miR-153 and 200a were unaltered in cyclic or estrogen-treated ovariectomized AF rats (Fig. 3B and C). The expression level of reference control U6 snRNA was unaltered in any of the treatment conditions (Supplementary Fig. 2A). These results indicate that FAE enhances production of some of the miRs that are known to target 3′UTR of D2r.
Fetal alcohol exposure increases miR-9 and miR-326 expressions in the pituitary gland. Alcohol-fed (AF), pair-fed (PF) or ad libitum-fed (AD) rat pituitaries were used either on the day of diestrus (cyclic) or used 60 days after ovariectomy and an estradiol implant (E2). MicroRNA levels were analyzed by TaqMan real-time PCR and were represented in the histograms; miR-9 (A), miR-153 (B), miR-200a (C), miR-326 (D). Each miR expression was normalized with U6 snRNA. Data are mean ± s.e.m. of n = 6 animals per groups and were analyzed using two-way ANOVA with the Bonferroni post hoc test. **P < 0.01 and ***P < 0.001 between AF and controls (AD or PF) in the similarly treated group.
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
Alcohol increases miR-9 and reduces D2r and D2s expressions in pituitary tumor cell line MMQ
We determined the roles of miR-9 and miR-326 in ethanol-induced repression of D2r gene using a PRL-producing MMQ cell line with functional D2R. We treated the cells with either 50 mM or 100 mM concentration of ethanol for 24 h or 48 h. We found that miR-9 expression was significantly increased in MMQ cells treated with both doses of ethanol at 24 h and 48 h compared to control (Fig. 4A). However, miR-326 expression was unchanged with ethanol treatment (Fig. 4B). These results suggest that in lactotropic cells, ethanol acts primarily on miR-9. We further evaluated ethanol-induced changes in D2R expression at both mRNA and protein levels in MMQ cells. We found that D2r mRNA level was significantly reduced in MMQ cells treated with ethanol compared to control (Fig. 4C). We also found that D2R protein level was significantly reduced by ethanol treatment (Fig. 4D). Our results also indicate that D2s expression was reduced (Fig. 4E) while Prl expression was increased following both 50 nM and 100 nM doses of ethanol treatments (Fig. 4F). We did not observe any differences in Prl mRNA levels between 50 mM and 100 mM ethanol concentrations. These results demonstrate that, like in the pituitary tissue, ethanol exposure increases miR-9 and Prl levels and reduces D2r and D2s expressions in lactotropic cells in cultures.
Alcohol exposure increases miR-9, reduces D2r and D2s and increases Prl expression in MMQ cells in cultures. Lactotropes-derived MMQ cells were treated with 50 mM, 100 mM ethanol for 24 h and 48 h and analyzed for miRs, D2r, D2s and Prl expression and were represented in the histograms; miR-9 (A), miR-326 (B), D2r mRNA (C), D2R protein (D), D2s mRNA (E) and Prl mRNA (F). Data are mean ± s.e.m. of n = 6 animals per groups and were analyzed using two-way ANOVA with Bonferroni post hoc test (Fig. 4A, B, C and E) and one-way ANOVA with the Newman–Keuls post hoc test (Fig. 4D and F). *P < 0.05, **P < 0.01 and ***P < 0.001 between ethanol treatment and controls at the same time period.
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
miR-9 overexpression reduces D2r, D2s expression and increases PRL levels in MMQ cells
To test if miR-9 is involved in regulation of D2R, D2S and PRL, we first tested the effects of miR-9 mimic oligo on miR-9, D2r, D2s and Prl expression in MMQ cells. As expected, the miR-9 mimic oligo robustly increased miR-9 levels compared to the negative control oligo (Fig. 5A). Treatment with miR-9-specific oligo reduced the level of D2r (Fig. 5B) and D2s mRNA (Fig. 5C) but increased Prl mRNA (Fig. 5D). These data support a role of miR-9 in regulation of D2r, D2s and Prl expression in lactotropic cells in the pituitary.
miR-9 overexpression by miR-9 mimic reduces D2r, D2s and increases Prl expression in MMQ cells in cultures. MMQ cells were transfected with miR-9 mimic oligo (miR-9 mimic) or negative control oligo (neg. contl.) and expression levels of miR-9 (A), D2r (B), D2s (C) and Prl (D) were measured after 24 h. Data are presented as mean ± s.e.m. of n = 6 per group and were analyzed using t test. *P < 0.05 and ***P < 0.001 between miR-9 mimic and neg. contl.
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
miR-9 knockdown prevents ethanol actions on D2R, D2S and PRL expression in MMQ cells
Because alcohol exposure increases miR-9 and reduces D2r and D2s mRNA levels and miR-9 mimic suppresses these receptor genes and increases Prl gene expression in the pituitary as well as MMQ cells, we hypothesized that miR-9 is involved in regulating D2r, D2s and Prl expression. To test this hypothesis, we knocked down miR-9 expression using anti-miR-9 oligo in MMQ cells treated with 50 mM ethanol. The results show that anti-miR-9 oligo, but not control oligo, reduced miR-9 expression in control as well as ethanol-treated cells (Fig. 6A). We found that anti-miR-9 oligos, but not control oligo, increased D2r expression and prevented ethanol-suppressive action on D2r and D2s expression (Fig. 6B, C and D). Additionally, we found that Prl expression, which is increased with ethanol, was significantly reduced by anti-miR-9 oligos in cells treated with ethanol (Fig. 6E). However, we did not find any change in the expression of Prl in control cells transfected with anti-miR-9 oligo (Fig. 6E). We also found the anti-miR-9 oligo reduced PRL secretion in MMQ cell supernatants (Fig. 6F). These results suggest for a possible mediatory role of miR-9 in ethanol action on D2r, D2s and PRL expression and secretion.
miR-9 knockdown suppresses ethanol actions on D2r, D2s and Prl expressions in MMQ cells in cultures. MMQ cells were transfected with anti-miR-9 inhibitor oligo (anti-miR-9), negative control inhibitor oligo (Neg.control), and mock transfection (control) followed by treatment with ethanol (50 mM) for 24 h and measurement of expression levels of miR-9 (A), D2r mRNA (B), D2R protein (C), D2s mRNA (D), Prl mRNA (E) and PRL secretion (F). Data are mean ± s.e.m. of n = 6 per group and were analyzed using one-way ANOVA with the Newman–Keuls post hoc test. *, **, *** significant at P < 0.05, 0.01, 0.001 vs control or neg. control. @, @@, @@@ significant at P < 0.05, 0.01, 0.001 vs Neg.control or Neg.control + ethanol.
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
In vivo knockdown of miR-9 increases D2R, D2S expression in FAE rat pituitary
We further confirmed the effect of miR-9 on D2r and D2s expression in vivo by knocking down miR-9 in FAE rat offspring. miR-9 inhibitor and negative control inhibitor oligos were injected into the third ventricles of AD, PF and AF rats and after 24-h pituitary tissues were collected and analyzed for the expression of miR-9, D2r, D2s and Prl expression and plasma samples were collected for measurement of PRL levels. We found that the miR-9 inhibitor oligo effectively reduced miR-9 expression in all three groups of rats compared to negative controls (Fig. 7A). We also observed that the miR-9 inhibitor prevented FAE-induced suppression of D2r mRNA and D2R protein levels (Fig. 7B and C). Also, FAE-induced suppression of D2s expression was normalized by the treatment of the anti-miR-9 oligo (Fig. 7D). Furthermore, miR-9 inhibitor suppressed FAE-induced increase in pituitary Prl mRNA levels (Fig. 7E). The plasma PRL levels after miR-9 knockdown in rats were significantly lower in all three groups of animals compared to negative control oligo (Fig. 7F). These results indicate that miR-9 may regulate FAE-induced changes in D2r and D2s levels as well as Prl expression and secretion.
In vivo knock down of miR-9 increases D2r, D2s mRNAs and reduces Prl mRNA levels in the pituitary and PRL levels in plasma of FAE rat offspring. AD, PF and AF rat offspring were treated with miR-9 inhibitor (anti-miR-9) or negative control oligo (neg.control) through intracerebroventricular (icv) injection. Pituitary miR-9 (A), D2r mRNA (B), D2R protein (C), D2s mRNA (D), Prl mRNA (E) and plasma PRL(F) levels were measured 24 h after the treatments. Data are presented as mean ± s.e.m. of n = 6 animals per group and were analyzed using two-way ANOVA with the Bonferroni post hoc test. *, **, *** significant at P < 0.05, 0.01, 0.001 vs AD or PF in neg. control group. @, @@, @@@ significant at P < 0.05, 0.01, 0.001 vs corresponding AD or PF or AF in neg. control group.
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
miR-9 directly targets D2r 3′UTR to repress its expression
In order to test the hypothesis that miR-9 may target 3′UTR of D2r to suppress its expression, we cloned the 3′UTR of D2r downstream of renilla luciferase in a reporter vector and measured luciferase activity. We made two different constructs one with the full-length 3′UTR and another with a short construct comprising of the miR-9-binding site to measure luciferase activity (Fig. 8A). We transfected these plasmids along with either the miR-9 mimic oligo or negative control oligo and determined the renilla luciferase activity as a measure of D2r 3′UTR function. We found that the miR-9 mimic oligo significantly reduced the luciferase activity compared to negative control oligo or mock transfection in both the plasmids transfected in MMQ cells (Fig. 8B). These results suggest that miR-9 represses D2r expression by binding to its 3′UTR and its binding site on D2r gene.
miR-9 directly targets D2r 3′UTR to repress its expression. (A) Schematic representation of D2r 3′UTR full length (D2r 3′UTR FL) and a short sequence containing miR-9 binding site (D2r 3′UTR miR-9 bs) were cloned down stream of renilla luciferase in a reporter vector. (B) D2r 3′UTR activity in MMQ cells transfected with a reporter plasmid harboring D2r 3′UTR FL or D2r 3′UTR miR-9 bs along with miR-9 mimic oligo (miR-9 mimic) or negative control oligo (NC mimic) or Mock transfection (Mock). (C) D2r 3′UTR containing wild-type miR-9-binding site and mutants with altered miR-9-binding site cloned in a reporter vector downstream of renilla luciferase was represented. (D) D2r 3′UTR activity of MMQ cells transfected with a reporter plasmid containing D2r 3′UTR with miR-9-binding site wild type (UTR WT) or mutant (UTR mut) along with miR-9 mimic oligo (miR-9 mimic) or negative control mimic oligo (NC mimic). D2r 3′UTR activity was measured as renilla luciferase activity and normalized with firefly luciferase. Data are presented as mean ± s.e.m. of n = 8 per group and were analyzed using one-way ANOVA with the Newman–Keuls post hoc test. *P < 0.05 and ***P < 0.001 between miR-9 mimic and NC mimic or Mock. **P < 0.01 between UTR (WT) + miR-9 mimic and UTR (WT) + NC mimic.
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
We further confirmed the specificity of miR-9 binding at 3′UTR by mutating the miR-9-binding site using site-directed mutagenesis. We made three different mutant constructs by altering the miR-9-binding site as it was shown in Fig. 8C. We found that miR-9 mimic oligo significantly reduced luciferase activity with wild-type plasmid compared to negative control oligo. However, the miR-9 mimic oligo did not alter luciferase activity of any of the three mutants transfected compared to the negative control oligo (Fig. 8D). Our results revealed that the miR-9-binding site is essential for miR-9 to reduce the D2r 3′UTR activity.
Discussion
We recently reported that FAE induces hyperprolactinemia by reducing D2R levels in the pituitary gland (Gangisetty et al. 2015). The data presented here confirm the FAE effects on D2r, D2s and Prl and identify a role of miR9 in this process. This interpretation is based on TargetScan predictions of miRs targets on D2r 3′UTR, demonstrating two miRs (miR-9 and miR-326 with predicted binding sites on D2r 3′UTR) are altered in the pituitary following FAE treatment. Effects of FAE were stronger on D2r, D2s and Prl in estrogen-treated rats over cyclic animals, and also data showing miR-9 is altered in lactotrope-derived MMQ cells following ethanol treatment. We observed two miRs; miR-9 and miR-326 were increased in the pituitary following FAE treatment and only miR-9 expression was increased in MMQ cells following ethanol treatment. The cellular heterogeneity in the pituitary gland may have differential expression, which is not the same as MMQ cells although they were derived from estrogen-induced rat pituitary tumor and secrete prolactin and express functional D2R (Judd et al. 1988). Additional support for a mediatory role of miR-9 is the finding that overexpression of miR-9 using miR-9 mimic oligo suppresses D2r and D2s and increases Prl in MMQ cells, while reduction of miR-9 prevents ethanol/FAE’s inhibitory actions on D2r and D2s and the stimulatory action on Prl in both MMQ cells in vitro and pituitary tissue in vivo. Also, we show that the site-directed mutagenesis of the miR-9-binding site of D2r 3′UTR prevented miR-9 mimic’s ability to alter D2r 3′UTR activity.
Lactotrope cell growth and PRL production are largely regulated by the tonic inhibitory control of the dopaminergic system. D2R is the predominant dopamine receptor subtype in the anterior pituitary and mediates dopamine’s inhibitory action on lactotropes (Mansour et al. 1990), and a loss of D2R function is connected to the increased production of PRL, cell proliferation and tumorigenesis (Cristina et al. 2006, Sarkar 2006). Estrogen is known to stimulate the PRL synthesis and affect the growth of lactotropes by inhibiting the function of dopaminergic system. It downregulates dopamine production in the hypothalamus and suppresses the activity of D2R in lactotropes. It also alters the splicing of D2r to reduce its D2s isoform (Sarkar et al. 1982, Guivarc’h et al. 1998, Oomizu et al. 2003). In addition, various growth factors released by lactotropes or other cells within the pituitary gland also influence PRL production and secretion. Accumulating evidences also suggest that PRL negatively regulates its own synthesis. It has been reported that PRL receptor-knockout mice display lactotrope hyperplasia and prolactinoma (Schuff et al. 2002). The data presented in this study indicate that D2r expression is negatively regulated by miR-9 in lactotropic cells of the pituitary. Previous studies have identified changes in various miRs during pituitary tumorigenesis. It has been reported that miR-15a, miR-16 and miR-132 are downregulated (Bottoni et al. 2007, Renjie & Haiqian 2015) while miR-200C is upregulated in pituitary adenoma (Mao et al. 2010), and miR-126 and miR-381 are downregulated in growth hormone-secreting pituitary adenomas (Mao et al. 2010) and miR-21, miR-141 and miR-150 are reduced in pituitary corticotropinoma (Amaral et al. 2009). Only a few studies illustrated the role of these miRs toward their target genes. miR-200C has known to regulate pituitary tumor formation through the PTEN/Akt signaling pathway (Liao et al. 2013). miR-132 and miR-15a/16 have shown to act as tumor suppressor genes by targeting Sox5, an oncogene, that is upregulated in pituitary tumor (Renjie & Haiqian 2015). We showed here that D2r is a direct target of miR-9, as evidenced by the reduction of the reporter luciferase activity of D2r 3′UTR following treatment with the miR-9 mimic oligo. Furthermore, we confirmed this by ameliorating the reporter luciferase activity of miR-9-binding site mutants using the miR-9 mimic oligo. These data suggest that D2r is a direct target of miR-9 in rat pituitary cells. In our study, FAE-induced miR-9 suppresses D2R and thereby increases PRL production in the pituitary gland. Alternative splicing of D2r results in two spiced isoforms, D2l and D2s. These two isoforms differ by exon 6 inclusion or exclusion, which encodes 29 amino acids in the third intracellular loop, which is critical for G-protein coupling. Both the isoforms are expressed in pituitary lactotropes (Missale et al. 1998), and each may have its own specific physiological function. We report here that FAE reduces the D2s expression in the pituitary, which is in confirmity with our previous observations (Oomizu et al. 2003). In our present study, we showed that mir-9 not only regulates ethanol-induced repression of D2R but also alters the level of spliced isoform D2s. However, the mechanism by which miR-9 regulates D2r splicing requires further investigation. It has been shown that several spliceosome factors such as polypyrimidine tract-binding protein PTBP1 (Sasabe et al. 2011), hnRNP M and Nova-1 (Park et al. 2011) play an important role in D2r splicing. The possible role of FAE-induced spliceosome factors in the regulation of D2r splicing needs further investigation. It should be mentioned that D2r expression in the pituitary is regulated by the endogenous ligand dopamine from the tuberoinfundibular dopaminergic (TIDA) neurons in the hypothalamus (Sarkar et al. 1982, Ben-Jonathan & Hnasko 2001). Since D2R controls the feedback loop of TIDA neurons (Ben-Jonathan & Hnasko 2001), alcohol may similarly effect miR-9-regulated D2R expression and dopamine secretion from TIDA neurons and thereby dopamine action on the pituitary.
Dopamine agonist therapy has become the first-line treatment for prolactinomas. Accumulating evidence also suggests that less than 10% of prolactinomas do not respond to dopamine agonist therapy and are resistant to this drug (Oh & Aghi 2011). D2 receptor inactivation and differential expression of its isoforms has been reported to be associated with dopamine agonist-resistant prolactinomas (Caccavelli et al. 1994, Gillam et al. 2006, Wu et al. 2010). Our present study showing a role of miR-9 in regulating D2r and its spliced isoform D2s expressions in FAE rat offspring identifies the novel possibility for the therapeutic use of miR-9 antagonists in dopamine-resistant prolactinomas.
In conclusion, the present study demonstrates that FAE programs the pituitary to differentially express miRNAs especially increasing the level of miR-9 causing the repression of D2r and its splice variant D2s, thereby regulating PRL production and secretion (Fig. 9).
Model diagram representing the role of miR-9 in regulation of FAE-induced changes in D2R expression and PRL production in the pituitary gland. In control rats, basal D2R expression maintains normal PRL production. FAE enhances miR-9 expression to suppress D2R production and its inhibitory control of PRL production.
Citation: Journal of Endocrinology 235, 1; 10.1530/JOE-17-0135
Supplementary data
This is linked to the online version of the paper at http://dx.doi.org/10.1530/JOE-17-0135.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work is supported by National Institute of Health grant R01 AA11591 and Hatch project grant NJ06160.
Author contribution statement
O G helped in designing experiments and performed research, analyzed data, writing the paper; S J performed research and analyzed the data; O W performed research and analyzed data; D K S designed research, analyzed data and wrote the paper.
Acknowledgements
The authors thank Amanda Jetzt for technical assistance in conducting luciferase assay.
References
Amaral FC, Torres N, Saggioro F, Neder L, Machado HR, Silva WA Jr, Moreira AC & Castro M 2009 MicroRNAs differentially expressed in ACTH-secreting pituitary tumors. Journal of Clinical Endocrinology and Metabolism 94 320–323. (doi:10.1210/jc.2008-1451)
Bartel DP 2004 MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116 281–297. (doi:10.1016/S0092-8674(04)00045-5)
Ben-Jonathan N & Hnasko R 2001 Dopamine as a prolactin (PRL) inhibitor. Endocrine Reviews 22 724–763. (doi:10.1210/edrv.22.6.0451)
Bottoni A, Zatelli MC, Ferracin M, Tagliati F, Piccin D, Vignali C, Calin GA, Negrini M, Croce CM & Degli Uberti EC 2007 Identification of differentially expressed microRNAs by microarray: a possible role for microRNA genes in pituitary adenomas. Journal of Cellular Physiology 210 370–377. (doi:10.1002/jcp.20832)
Caccavelli L, Feron F, Morange I, Rouer E, Benarous R, Dewailly D, Jaquet P, Kordon C & Enjalbert A 1994 Decreased expression of the two D2 dopamine receptor isoforms in bromocriptine-resistant prolactinomas. Neuroendocrinology 60 314–322. (doi:10.1159/000126764)
Cristina C, Garcia-Tornadu I, Diaz-Torga G, Rubinstein M, Low MJ & Becu-Villalobos D 2006 Dopaminergic D2 receptor knockout mouse: an animal model of prolactinoma. Frontiers of Hormone Research 35 50–63. (doi:10.1159/000094308)
De A, Boyadjieva N, Pastorcic M & Sarkar DK 1995 Potentiation of estrogen’s mitogenic effect on the pituitary gland by alcohol consumption. International Journal of Oncology 7 643–648.
De A, Boyadjieva N, Oomizu S & Sarkar DK 2002 Ethanol induces hyperprolactinemia by increasing prolactin release and lactotrope growth in female rats. Alcoholism Clinical and Experimental Research 26 1420–1429. (doi:10.1111/j.1530-0277.2002.tb02687.x)
Gangisetty O, Bekdash R, Maglakelidze G & Sarkar DK 2014 Fetal alcohol exposure alters proopiomelanocortin gene expression and hypothalamic-pituitary-adrenal axis function via increasing MeCP2 expression in the hypothalamus. PLoS ONE 9 e113228. (doi:10.1371/journal.pone.0113228)
Gangisetty O, Wynne O, Jabbar S, Nasello C & Sarkar DK 2015 Fetal alcohol exposure reduces dopamine receptor D2 and increases pituitary weight and prolactin production via epigenetic mechanisms. PLoS ONE 10 e0140699. (doi:10.1371/journal.pone.0140699)
Gillam MP, Molitch ME, Lombardi G & Colao A 2006 Advances in the treatment of prolactinomas. Endocrine Reviews 27 485–534. (doi:10.1210/er.2005-9998)
Guiramand J, Montmayeur JP, Ceraline J, Bhatia M & Borrelli E 1995 Alternative splicing of the dopamine D2 receptor directs specificity of coupling to G-proteins. Journal of Biological Chemistry 270 7354–7358. (doi:10.1210/er.2005-9998)
Guivarc’h D, Vincent JD & Vernier P 1998 Alternative splicing of the D2 dopamine receptor messenger ribonucleic acid is modulated by activated sex steroid receptors in the MMQ prolactin cell line. Endocrinology 139 4213–4221. (doi:10.1210/endo.139.10.6246)
Iaccarino C, Samad TA, Mathis C, Kercret H, Picetti R & Borrelli E 2002 Control of lactotrop proliferation by dopamine: essential role of signaling through D2 receptors and ERKs. PNAS 99 14530–14535. (doi:10.1073/pnas.222319599)
Jan A, Karasinska JM, Kang MH, de Haan W, Ruddle P, Kaur A, Connolly C, Leavitt BR, Sorensen PH & Hayden MR 2015 Direct intracerebral delivery of a miR-33 antisense oligonucleotide into mouse brain increases brain ABCA1 expression. Neuroscience Letters 598 66–72. (doi:10.1016/j.neulet.2015.05.007)
Judd AM, Login IS, Kovacs K, Ross PC, Spangelo BL, Jarvis WD & Macleod RM 1988 Characterization of the MMQ cell, a prolactin secreting clonal cell line that is responsive to dopamine. Endocrinology 123 2341–2350. (doi:10.1210/endo-123-5-2341)
Kelly MA, Rubinstein M, Asa SL, Zhang G, Saez C, Bunzow JR, Allen RG, Hnasko R, Ben-Jonathan N & Grandy DK et al. 1997 Pituitary lactotroph hyperplasia and chronic hyperprolactinemia in dopamine D2 receptor-deficient mice. Neuron 19 103–113. (doi:10.1016/S0896-6273(00)80351-7)
Liao C, Chen W, Fan X, Jiang X, Qiu L, Chen C, Zhu Y & Wang H 2013 MicroRNA-200c inhibits apoptosis in pituitary adenoma cells by targeting the PTEN/Akt signaling pathway. Oncology Research 21 129–136. (doi:10.3727/096504013X13832473329999)
Mansour A, Meador-Woodruff JH, Bunzow JR, Civelli O, Akil H & Watson SJ 1990 Localization of dopamine D2 receptor mRNA and D1 and D2 receptor binding in the rat brain and pituitary: an in situ hybridization-receptor autoradiographic analysis. Journal of Neuroscience 10 2587–2600.
Mao ZG, He DS, Zhou J, Yao B, Xiao WW, Chen CH, Zhu YH & Wang HJ 2010 Differential expression of microRNAs in GH-secreting pituitary adenomas. Diagnostic Pathology 5 79. (doi:10.1186/1746-1596-5-79)
Mello NK, Mendelson JH, Bree MP & Skupny A 1988 Alcohol effects on naloxone-stimulated luteinizing hormone, follicle-stimulating hormone and prolactin plasma levels in female rhesus monkeys. Journal of Pharmacology and Experimental Therapeutics 245 895–904.
Missale C, Nash SR, Robinson SW, Jaber M & Caron MG 1998 Dopamine receptors: from structure to function. Physiological Reviews 78 189–225.
Oh MC & Aghi MK 2011 Dopaine agonist-resistant prolactinomas. Journal of Neurosurgery 114 1369–1379. (doi:10.3171/2010.11.JNS101369)
Oomizu S, Boyadjieva N & Sarkar DK 2003 Ethanol and estradiol modulate alternative splicing of dopamine D2 receptor messenger RNA and abolish the inhibitory action of bromocriptine on prolactin release from the pituitary gland. Alcoholism Clinical and Experimental Research 27 975–980. (doi:10.1111/j.1530-0277.2003.tb04423.x)
Park E, Iaccarino C, Lee J, Kwon I, Baik SM, Kim M, Seong JY, Son GH, Borrelli E & Kim K 2011 Regulatory roles of heterogeneous nuclear ribonucleoprotein M and Nova-1 protein in alternative splicing of dopamine D2 receptor pre-mRNA. Journal of Biological Chemistry 286 25301–25308. (doi:10.1074/jbc.M110.206540)
Radl D, De Mei C, Chen E, Lee H & Borrelli E 2013 Each individual isoform of the dopamine D2 receptor protects from lactotroph hyperplasia. Molecular Endocrinology 27 953–965. (doi:10.1210/me.2013-1008)
Raymond V, Beaulieu M, Labrie F & Boissier J 1978 Potent antidopaminergic activity of estradiol at the pituitary level on prolactin release. Science 200 1173–1175. (doi:10.1126/science.418505)
Renjie W & Haiqian L 2015 MiR-132, miR-15a and miR-16 synergistically inhibit pituitary tumor cell proliferation, invasion and migration by targeting Sox5. Cancer Letters 356 568–578. (doi:10.1016/j.canlet.2014.10.003)
Saiardi A, Bozzi Y, Baik JH & Borrelli E 1997 Antiproliferative role of dopamine: loss of D2 receptors causes hormonal dysfunction and pituitary hyperplasia. Neuron 19 115–126. (doi:10.1016/S0896-6273(00)80352-9)
Sarkar DK 2006 Genesis of prolactinomas: studies using estrogen-treated animals. Frontiers of Hormone Research 35 32–49. (doi:10.1159/000094307)
Sarkar DK, Gottschall PE & Meites J 1982 Damage to hypothalamic dopaminergic neurons is associated with development of prolactin-secreting pituitary tumors. Science 218 684–686. (doi:10.1126/science.7134966)
Sasabe T, Futai E & Ishiura S 2011 Polypyrimidine tract-binding protein 1 regulates the alternative splicing of dopamine receptor D2. Journal of Neurochemistry 116 76–81. (doi:10.1111/j.1471-4159.2010.07086.x)
Schuff KG, Hentges ST, Kelly MA, Binart N, Kelly PA, Iuvone PM, Asa SL & Low MJ 2002 Lack of prolactin receptor signaling in mice results in lactotroph proliferation and prolactinomas by dopamine-dependent and -independent mechanisms. Journal of Clinical Investigation 110 973–981. (doi:10.1172/Jbib215912)
Seki M, Yoshida K & Okamura Y 1991 A study on hyperprolactinemia in female patients with alcoholics. Arukoru Kenkyuto Yakubutsu Ison 26 49–59.
Sengupta A & Sarkar DK 2012 Estrogen inhibits D2S receptor-regulated Gi3 and Gs protein interactions to stimulate prolactin production and cell proliferation in lactotropic cells. Journal of Endocrinology 214 67–78. (doi:10.1530/JOE-12-0125)
Wang LL, Zhang Z, Li Q, Yang R, Pei X, Xu Y, Wang J, Zhou SF & Li Y 2009 Ethanol exposure induces differential microRNA and target gene expression and teratogenic effects which can be suppressed by folic acid supplementation. Human Reproduction 24 562–579. (doi:10.1093/humrep/den439)
Wu ZB, Zheng WM, Su ZP, Chen Y, Wu JS, Wang CD, Lin C, Zeng YJ & Zhuge QC 2010 Expression of D2RmRNA isoforms and ER mRNA isoforms in prolactinomas: correlation with the response to bromocriptine and with tumor biological behavior. Journal of Neuro-oncology 99 25–32. (doi:10.1007/s11060-009-0107-y)
