Abstract
Many hormones/cytokines are secreted in response to exercise and cytokine signaling may play a pivotal role in the training adaptations. To investigate the importance of cytokine signaling during vertical ladder climbing, a resistance exercise model, we produced mice lacking SOCS3 protein exclusively in steroidogenic factor-1 (SF1) cells (SF1 Socs3 KO mice). SF1 expression is found in steroidogenic cells of the adrenal cortex and gonads, as well as in neurons of the ventromedial nucleus of the hypothalamus. Histological markers of the fetal adrenal zone (or X-zone in rodents) were still present in adult males and postpartum SF1 Socs3 KO females, suggesting a previously unrecognized effect of SOCS3 on the terminal differentiation of the adrenal gland. This change led to a distinct distribution of lipid droplets along the adrenal cortex. Under basal conditions, adult SF1 Socs3 KO mice exhibited similar adrenal weight, and plasma ACTH and corticosterone concentrations. Nonetheless, SF1 Socs3 KO mice exhibited a blunted ACTH-induced corticosterone secretion. The overall metabolic responses induced by resistance training remained unaffected in SF1 Socs3 KO mice, including changes in body adiposity, glucose tolerance and energy expenditure. However, training performance and glucose control during intense resistance exercise were impaired in SF1 Socs3 KO mice. Furthermore, a reduced counter-regulatory response to 2-deoxy-d-glucose was observed in mutant mice. These findings revealed a novel participation of SOCS3 regulating several endocrine and metabolic aspects. Therefore, cytokine signaling in SF1 cells exerts an important role to sustain training performance possibly by promoting the necessary metabolic adjustments during exercise.
Introduction
Cytokines normally regulate cellular behavior via the activation of plasma membrane receptors (Krebs & Hilton 2001). Many cytokine receptors recruit the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway, which controls the transcription of numerous genes and thereby regulates cell proliferation, differentiation and apoptosis (Krebs & Hilton 2001). Cytokine signaling is modulated by proteins from the family of suppressors of cytokine signaling (SOCS). SOCS proteins comprise 8 proteins that can bind tyrosine-phosphorylated residues of cytokine receptors or JAK, blocking their capacity to activate intracellular signaling pathways (e.g., activation of STAT proteins) or leading them to proteosomal degradation (Krebs & Hilton 2001, Howard & Flier 2006). Interestingly, cytokine signaling can robustly increase the SOCS expression, indicating that SOCS proteins regulate cytokine signaling via a negative feedback loop (Krebs & Hilton 2001, Howard & Flier 2006).
Among the different SOCS proteins, SOCS3 has received considerable attention because several studies described its effects controlling important metabolic aspects. Obese animals exhibit increased SOCS3 expression in different tissues (Bjorbaek et al. 1998, Jorgensen et al. 2013). Notably, brain-specific or muscle-specific SOCS3 ablation improves insulin sensitivity and may partially prevent diet-induced obesity (Mori et al. 2004, Jorgensen et al. 2013, Pedroso et al. 2014). These effects occur because SOCS3 inhibits several cytokines/hormones that regulate the metabolism, such as leptin, insulin, growth hormone, prolactin, interleukin-6 and insulin-like growth factor-1 signaling (Krebs & Hilton 2001, Howard & Flier 2006).
Physical exercise produces robust metabolic consequences (Laing et al. 2016). Importantly, the levels of many hormones/cytokines are markedly altered by acute or chronic exercise, including those inhibited by SOCS3 (Strasser et al. 2012, Golbidi & Laher 2014). Exercise increases SOCS3 expression in different tissues (Spangenburg et al. 2006, Trenerry et al. 2007, Pereira et al. 2015), suggesting that SOCS3 may have a profound impact on cytokine signaling during exercise, which highlights a possible participation of this protein in the regulation of training adaptations. In the present study, we hypothesize that exercise-induced cytokine signaling plays a pivotal role in the training adaptations, which may depend on the activation of signaling pathways either in specific brain areas or peripheral tissues. For example, earlier studies observed that physical exercise activates cytokine signaling pathways in the hypothalamus (Pereira et al. 2015) or skeletal muscle (Spangenburg et al. 2006, Trenerry et al. 2007, Begue et al. 2013).
Since whole-body SOCS3-knockout mice exhibit embryonic lethality (Roberts et al. 2001), we employed the Cre-loxP system to produce tissue-specific SOCS3 ablation, as previously described (Mori et al. 2004, Jorgensen et al. 2013, Pedroso et al. 2014, Zampieri et al. 2015, Bohlen et al. 2016). To investigate the potential role of SOCS3 in exercise-induced metabolic adaptations, we generated mice lacking SOCS3 only in cells that express the nuclear receptor steroidogenic factor-1 (SF1). In the central nervous system, SF1-positive cells are specifically found in the ventromedial nucleus of the hypothalamus (VMH) (Ikeda et al. 1995, Segal et al. 2005, Kim et al. 2011), which comprises an important neuronal population involved in the regulation of the energy balance, glucose homeostasis and autonomic nervous system (Brobeck 1946, Powley 1977, Ikeda et al. 1995, Majdic et al. 2002, Seoane-Collazo et al. 2015). Additionally, VMH neurons express receptors for several hormones whose levels change in response to physical exercise, including insulin (Klockener et al. 2011), leptin (Nagaishi et al. 2014), growth hormone (Furigo et al. 2017), prolactin (Furigo et al. 2014, 2017) and interleukin-6 (Schobitz et al. 1993). Therefore, cytokine signaling in the SF1/VMH cells may promote metabolic adjustments during or after exercise. In fact, a recent study showed that a hypothalamic SF1 expression is required for the beneficial metabolic effects of exercise (Fujikawa et al. 2016). Pituitary gonadotropic cells as well as steroidogenic cells of the adrenal cortex and gonads also express SF1, which controls the transcription of key enzymes that synthetize steroid hormones (Ikeda et al. 1995, Zhao et al. 2001, Parker et al. 2002). Since exercise performance is also affected by glucocorticoids and sex hormone levels, the SOCS3 expression in these endocrine cells possibly modulates training adaptations as well. Thus, the objective of the present study was to characterize the endocrine and metabolic consequences of SOCS3 ablation in SF1 cells. Subsequently, these conditional knockout mice were subjected to a resistance exercise protocol in order to investigate whether the SF1-specific SOCS3 expression regulates training performance and the metabolic effects of exercise.
Material and methods
Animals and genotyping
Mice expressing the Cre recombinase under SF1 promoters (Tg(Nr5a1-cre)7Lowl/J, The Jackson Laboratory, Bar Harbor, ME, USA) were bred with animals carrying a loxP-flanked Socs3 allele (B6.129S4-Socs3tm1Ayos/J, The Jackson Laboratory). Mice carrying an SF1-specific SOCS3 inactivation (SF1 Socs3 KO group) were homozygous for the loxP-flanked Socs3 allele and carried the Cre transgene, whereas the control group was composed of littermate mice carrying only the loxP-flanked Socs3 allele in homozygosity. SF1-Cre animals were also bred with the Cre-inducible tdTomato-reporter mouse (B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J, The Jackson Laboratory). The purpose of this breeding was to allow the visualization of SF1-positive cells through the red fluorescent tdTomato protein. Mice were weaned at 3–4 weeks of age and genotyped through PCR using DNA extracted from the tail tip (REDExtract-N-Amp Tissue PCR Kit, Sigma-Aldrich). Mice were bred and maintained under standard conditions of light (12-h light/darkness cycle; lights on at 8:00 h) and temperature (22 ± 2°C). In all experiments, animals received a regular rodent chow diet (2.99 kcal/g; 9.4% calories from fat; Quimtia, Colombo, Brazil). The animal procedures were approved by the Ethics Committee on the Use of Animals of the Institute of Biomedical Sciences at the University of São Paulo (protocol number 71/2016).
Characterization of SF1 Socs3 KO mice
To identify Cre-mediated DNA recombination, the hypothalamus, cerebellum, adrenal gland and liver of SF1 Socs3 KO mice were collected. After the same DNA extraction protocol employed for genotyping, we performed a PCR reaction to identify a 250-bp DNA fragment that would indicate Cre-mediated SOCS3 ablation (Mori et al. 2004). Control primers were also used to confirm that DNA extraction and PCR reaction did not fail in negative controls (cerebellum and liver). To analyze the effects of SF1-specific SOCS3 ablation in the hypothalamus, SF1-Cre/tdTomato-reporter or SF1 Socs3 KO mice (n = 3) were transcardiacally perfused with formalin and their brains were prepared for histological analysis, as previously described (Furigo et al. 2014, Nagaishi et al. 2014). The distribution of tdTomato-expressing cells in the brain was assessed. Additionally, the VMH cytoarchitecture was analyzed through DAPI staining using Dapi-Fluoromount-G mounting medium (EMS, Hatfield, PA, USA), standard thionin staining and after a peroxidase reaction to label estrogen receptor-α immunoreactivity (ERα-ir) in the VMH of control and SF1 SOCS3 KO mice, as previously described (da Silva et al. 2014). To analyze the consequences of SF1-specific SOCS3 ablation in the gonadal function, the testicles were weighed and plasma samples were collected to assess testosterone levels by enzyme-linked immunosorbent assay (Calbiotech; TE187S-100; Spring Valley, CA, USA). Additionally, fertility was evaluated in males and females by measuring the time required for control and SF1 Socs3 KO mice to produce litters. The potential effects in the adrenal gland were evaluated by measuring adrenal weight, and basal plasma corticosterone (DetectX Enzyme Immunoassay Kit, Arbor Assays, Ann Arbor, MI, USA) and adrenocorticotropic hormone levels (ACTH; Milliplex MAP Mouse Bone Magnetic Bead Panel, Millipore Corporation). An ACTH stimulation test was also performed in 3-month-old male mice as previously described (Scheys et al. 2011). Briefly, mice received i.p. injections of 5 mg/kg dexamethasone at the lights off 1 day before and at 10:00 h on the test day to suppress the hypothalamic–pituitary–adrenal (HPA) axis. Two hours later, a blood sample was collected (time 0), followed by an i.p. injection of 1 mg/kg ACTH (Bachem, Torrance, CA, USA). Mice were killed after 60 min to assess serum corticosterone levels. The histological analysis of the adrenal gland was evaluated in another group of adult males (5 months) and in virgin or postpartum adult females. In the latter case, females were allowed to nurse the pups for 5 days. Then, the pups were removed and the adrenals were collected after approximately 5 days. The counter-regulatory response to 2-deoxy-d-glucose (2DG) was evaluated by assessing changes in glycemia after an i.p. infusion of 0.5 mg/kg 2DG (Sigma) for 3 h (Flak et al. 2014). Serum ACTH and corticosterone levels were also determined 60 min after an i.p. injection of 0.5 mg/kg 2DG.
Experimental design
Experimental design is summarized in Fig. 1. Four-month-old male mice were distributed in 4 groups according to genotype and training condition: sedentary control (n = 20), exercise control (n = 20), sedentary SF1 Socs3 KO (n = 16) and exercise SF1 Socs3 KO (n = 16). The exercise groups were subjected to an 8-week resistance exercise protocol, as described in detail later, whereas sedentary groups were exposed to the same experimental conditions, except for the training protocol. Exercise training was performed in the light period from 14:00 h to 16:00 h (lights off at 20:00 h) and researchers were blinded to the experimental groups. Along the experiment, mice were weighted weekly. Performance was measured through the increments of the weight lifted during the 8-week training period and by one repetition maximum (1RM) tests performed at the beginning of training protocol and after 4 and 8 weeks of training. Glycemia was assessed just before the beginning of the last 1RM test and immediately after exhaustion using a portable glucometer (OneTouch, Johnson & Johnson). After 4 and 5 weeks of training, mice were subjected to a glucose tolerance test (GTT; 2 g glucose/kg; i.p.) and an insulin tolerance test (0.8 IU insulin/kg; i.p.), respectively. During the last 2 weeks of training, mice were placed in the Oxymax/Comprehensive Lab Animal Monitoring System (CLAMS; Columbus Instruments, Columbus, OH, USA) to analyze O2 consumption (VO2), CO2 production (VCO2), respiratory exchange ratio (RER; VCO2/VO2), food intake, water intake and locomotor activity (through infrared beam sensors). After 3 days of adaptation inside the CLAMS, the metabolic parameters of each mouse were evaluated for 4 consecutive days. Therefore, the results presented here were the average of this period. Both sedentary and exercise groups were evaluated in the CLAMS, and the exercise groups were maintained in their regular training protocol. The data produced by the CLAMS were presented as pre-training (the light cycle before the training session from 8:00 h to 14:00 h), post-training (the light cycle immediately after the training session from 16:00 h to 20:00 h) and dark cycle (from 20:00 h to 8:00 h). In the following day after the last training session, food was removed from cages for 4 h and mice were killed by decapitation (approximately from 14:00 h to 16:00 h). Body adiposity was calculated by summing the weight of the perigonadal, subcutaneous and retroperitoneal fat pads. The soleus muscle was removed in order to assess cross-sectional area (CSA) of individual fibers after a standard hematoxylin and eosin (HE) staining. Quantification and evaluation of fiber CSA (150 fibers per muscle) were performed as previously described (Fortes et al. 2015). After removing the soleus muscle, sections from the midportion region were obtained. A cryostat (Leica CM3050 S; Leica Microsystems, Nussloch GmbH, Germany) was used to acquire a 10 µm thick section from each muscle. Sections were imaged using an optical microscope with camera (Nikon DXM 1200; Nikon Instruments). Digitized images were analyzed using the AxioVision software (version 4.8.1.0, Carl Zeiss).
Scheme that summarizes the experimental design. 1RM, one repetition maximum; CLAMS, Comprehensive Lab Animal Monitoring System; GTT, glucose tolerance test; ITT, insulin tolerance test.
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
Resistance exercise protocol
A 110 cm high and 18 cm wide ladder angled at 80° and with a 2 cm spacing between the steps (Hornberger & Farrar 2004) was used for the training sessions. A 20 × 20 × 20 cm chamber is located at the top of the ladder and serves as a shelter during the rest periods between the series of climbs. Initially, the animals from the exercise groups were familiarized to the apparatus for 3 days, which consisted of three climbing attempts. Before the first attempt, mice were kept in the shelter for 90 s to feel safe. On the first attempt, the mouse was placed at the ladder top portion at an approximate distance of 35 cm from the door of the shelter. On the second attempt, the animal was positioned at the middle of the ladder at a distance of approximately 55 cm from the door of the shelter. On the third attempt, the animal was placed at the bottom of the ladder at a distance of approximately 110 cm from the door of the shelter. Afterward, animals were adapted to the exercise protocol. The resistance training started after the adaptation period, which consisted of 4 series of 8 climb repetitions during 1 week without any load. The protocol was adapted from Kim and coworkers and consisted of climbing a vertical ladder with progressive loads attached to the mouse tail base (Kim et al. 2015). To determine the initial training workload, all mice were subjected to a 1RM test, which consisted of climbing repetitions carrying a progressively heavier load. In the initial climbing, mice had to carry 75% of the animal’s own body mass load. When mice reached the top of the ladder, a rest of 2 min was given before the next attempt. During subsequent attempts, an additional 5 g load was added until the animal was unable to climb the ladder completely. Thus, the load carried in the last successful climbing was considered as the 1RM load. The training protocol consisted of 4 series of climbing repetitions with progressive overload. Each series contained an average of 8 repetitions. In the first series, animals had to carry 75% of 1RM load. An additional 5–10% 1RM load was added in the following series. The load was kept until the animal could climb the whole ladder. If the animal could perform all series, the load of the last series would be the initial load on the following day. Resistance ladder climbing exercise was performed 5 days per week for 8 weeks.
Adrenal and pituitary analysis
For the HE staining, left adrenal glands from 5-month-old males and 3-month-old virgin or postpartum females of control and SF1 Socs3 KO groups (5 per group) were removed, fixed in formalin and embedded in paraffin. Serial histological sections (10 μm thickness) were used for a standard HE staining procedure. The cell morphology and the cortical areas images were captured under a light microscope (Nikon Eclipse 80i) and analyzed by Neurolucida and Neurolucida Explorer software (MBF Bioscience). For the quantification of the adrenal X-zone, images were captured with 10× magnitude. The X-zone area was manually delimited based on the strong eosin staining. The area occupied by eosinophilic cells in the corticomedullary junction was determined using ImageJ software (ImageJ 1.51n, Wayne Rasband, National Institute of Health, Bethesda, MA, USA). For the oil red O (ORO) staining and immunofluorescence (IF) against anti-cythochrome P450 family 17 subfamily A member1 (Cyp17a1), right adrenal glands were collected and the excess fat was removed. The tissue was rapidly frozen in dry ice and embedded in optimal cutting media (OCT, Sakura) for cryosection. For the ORO staining and quantification, we performed a standard protocol, as previously described (Mehlem et al. 2013). The relative quantification of ORO staining was performed in 15 different images of the adrenal cortex per animal and analyzed using the ImageJ software, following the protocol previously described (Mehlem et al. 2013). For the IF, sections (3 animals from each experimental group) were fixed in ice-cold acetone (10 min) and washed in PBS. Blocking solution (10% donkey serum) was applied in each section and incubated for 1 h. After washing, primary anti-Cyp17a1 (ab134910; Abcam) at 1:250 dilution (PBS + 0.3% Triton X + 1% donkey serum) was applied and sections were incubated overnight at 4°C. Sections were washed and incubated with 1:1000 secondary donkey anti-rabbit IgG Alexa Fluor 594 (Jackson ImmunoResearch Laboratories). Sections were mounted on antifade reagent (ProLong Gold, Life Technologies) and analyzed under a fluorescent microscope (Nikon Eclipse 80i). Fresh pituitary glands from adult male mice were collected to analyze the mRNA levels of pituitary hormones. The protocol to extract the total RNA, produce the complementary DNA and perform the RT-PCR has been described in previous studies from our group (Pedroso et al. 2014, 2016, Zampieri et al. 2015, Bohlen et al. 2016). The expression of the constitutive gene cyclophilin A was used to normalize the data. The following primers were used: cyclophilin A (forward: tatctgcactgccaagactgagt; reverse: cttcttgctggtcttgccattcc), GH (forward: gcttctcagagaccatcccg; reverse: agcgagaagcgaagcaattc), POMC (forward: tagatgtgtggagctggtgc; reverse: ccagcgagaggtcgagtttg), LHβ (forward: agttctgcccagtctgcatc; reverse: actcggaccatgctaggaca) and FSHβ (forward: aataccacttggtgtgcggg; reverse: gccaggcaatcttacggtct).
Statistical analysis
When data from control and SF1 Socs3 KO groups were compared, independently of training protocol, the unpaired two-tailed Student’s t-test was used. To analyze the effects of exercise training and/or SF1-specific SOCS3 ablation, a two-way ANOVA test followed by Bonferroni posttests was employed. GraphPad Prism software was used for the statistical analyses and the results were expressed as mean ± s.e.m. Only P values <0.05 were considered to be statistically significant.
Results
Characterization of SF1 Socs3 KO mice
It is well established that the hypothalamus and adrenal cortex contain SF1-expressing cells, whereas no SF1 expression is normally found in cerebellum and liver (Ikeda et al. 1995, Kim et al. 2011). Using primers that amplify a 250-bp DNA fragment, which is only expressed after Cre-mediated recombination in Socs3 gene (Mori et al. 2004), we confirmed that SF1 Socs3 KO mice had SOCS3 ablation in the hypothalamus and adrenal gland, but not in the cerebellum or liver (Fig. 2A). To identify the distribution of SF1-expressing cells in the brain, we used a Cre-inducible tdTomato-reporter mouse. So, SF1-positive cells could be visualized by the red fluorescent protein tdTomato. In accordance with previous studies that mapped the distribution of SF1 expression in the brain (Ikeda et al. 1995, Segal et al. 2005, Kim et al. 2011), the tdTomato expression was abundantly found in the VMH and only few scattered cells were present in other brain nuclei (Fig. 2B). Therefore, central SOCS3 ablation essentially affected VMH neurons. SF1 is critically involved in the VMH formation (Ikeda et al. 1995, Majdic et al. 2002) and ablation of SF1 in the central nervous system drastically reduces the expression of steroid receptors in the VMH (Kim et al. 2010). We assessed VMH cytoarchitecture and integrality through thionin staining (Fig. 2C and D) and by the presence of ERα in the ventrolateral part of the VMH (VMHvl; Fig. 2E and F), but no changes were observed in SF1 Socs3 KO mice.
Characterization of SF1 Socs3 KO mice. (A) Agarose gel showing the products of a PCR reaction from different tissues of SF1 Socs3 KO mice. A 250-bp DNA fragment indicates Cre-mediated recombination in the Socs3 gene, whereas a ~800-bp fragment is a positive control band. (B) Epifluorescence photomicrograph illustrating the distribution of SF1 neurons in the ventromedial nucleus of the hypothalamus (VMH), using a reporter mouse that expresses the red fluorescent tdTomato protein under Cre recombination. DAPI staining was used as an anatomical reference. (C and D) Thionin staining illustrating a normal VMH cytoarchitecture in SF1 SOCS3 KO mice. (E and F) Peroxidase reaction to label estrogen receptor-α immunoreactivity (ERα-ir) in the VMH of control and SF1 SOCS3 KO mice. 3 V, third ventricle; ARH, arcuate nucleus of the hypothalamus; VMHc, central part of the VMH; VMHdm, dorsomedial part of the VMH; VMHvl, ventrolateral part of the VMH. Scale bar = 200 µm.
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
SOCS3 expression in SF1 cells is required for the terminal differentiation of the adrenal gland and maximal adrenal steroidogenic capacity
Previous studies have indicated that prolactin signaling induces the SOCS3 expression in the adrenal cortex of rats (Tam et al. 2001), and maternal dietary restriction can induce adrenocortical hypertrophy by upregulating cytokine signaling (Zhang et al. 2013). Whether SOCS3 plays a role in the adrenal cortex physiology remains unclear. Thus, here we investigated morphological and functional aspects of the adrenal cortex of SF1 Socs3 KO mice. HE staining revealed a different pattern of the cortex morphology in the medullary boundary (Fig. 3), with some clusters of eosinophilic cells matching the description and localization of the fetal adrenal zone or X-zone in rodents (Jones 1952). Indeed, these cells were positive for the steroidogenic enzyme Cyp17A1 (Fig. 4A and B), which is a marker for X-zone in rodents (Keeney et al. 1995). ORO staining showed that the presence of this zone disturbed the morphology of the adjacent zones, especially the distribution of lipid droplets along the cortex (Fig. 4C, D, E and F). Due to this change, the total amount of lipids in adrenal cortex was significantly decreased (P = 0.0011) in the SF1 Socs3 KO animals compared to control mice (Fig. 5A). We then evaluated possible functional consequences in the adrenal of SF1 Socs3 KO mice. Under basal conditions, control and SF1 Socs3 KO mice exhibited similar adrenal weight (Fig. 5B) as well as plasma ACTH (Fig. 5C) and corticosterone (Fig. 5D) levels. However, when the adrenal capacity to secrete corticosterone was evaluated during an ACTH stimulation test, SF1 Socs3 KO mice exhibited a blunted response in comparison with control animals (Fig. 5E). These results indicate a lower maximal adrenal steroidogenic capacity in SF1 Socs3 KO mice, even though their adrenal function seems to be normal during basal conditions.
SF1-specific SOCS3 ablation induces histological alterations in the adrenal cortex. (A, B, C, D, E, F, G and H) Photomicrographs of the adrenal gland of control (A, C, E and G) and SF1 Socs3 KO (B, D, F and H) mice after hematoxylin/eosin staining. The arrows indicate the localization of the fetal adrenal zone (or X-zone in rodents) in the medullary boundary, which is visible only in SF1 Socs3 KO mice. m, adrenal medulla; x, X-zone; zf, zona fasciculata; zg, zona glomerulosa. Scale bars = 0.05 mm.
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
Presence of X-zone in adrenal glands of SF1 Socs3 KO mice. (A and B) Photomicrographs of the adrenal gland of control (A) and SF1 Socs3 KO (B) mice after immunofluorescence against Cyp17a1 (n = 3/group). Insets show a high-powered field of the adrenal cortex in the medullary boundary. (C, D, E and F) Photomicrographs of the adrenal gland of control (C and D) and SF1 Socs3 KO (E and F) mice after oil red O staining. m, adrenal medulla; x, X-zone; zf, zona fasciculata; zg, zona glomerulosa. Scale bars: (A, B and C) E = 0.1 mm; D and F = 0.05 mm; insets = 0.01 mm.
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
Effects of SF1-specific SOCS3 ablation in the adrenal gland function. (A) Quantification of oil red O (ORO) staining, which represents the total amount of lipids in adrenal cortex (n = 18/group). (B, C and D) Basal adrenal weight (B) and plasma ACTH (C) and corticosterone (D) levels in control (n = 3–5) and SF1 Socs3 KO (n = 3–6) mice. (E) Serum corticosterone levels during an ACTH stimulation test (n = 7/group). *significant (P < 0.05) different than control group (unpaired two-tailed Student’s t-test).
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
SF1-specific SOCS3 ablation leads to a lower testis weight without affecting testosterone levels, fertility or pituitary function
SF1 expression is also found in the gonads (Ikeda et al. 1995, Kim et al. 2011), indicating that SOCS3 ablation may have occurred in the testis of SF1 Socs3 KO mice. In fact, SOCS3 can modulate leptin and interleukin-6 signaling and affect testicular functions (Yuan et al. 2014, Huang et al. 2016). To assess the consequences of SF1-specific SOCS3 ablation in testicular functions, we initially measured testis weight. SF1 Socs3 KO mice exhibited significantly lighter testes compared to control animals (Fig. 6A). However, no changes in plasma testosterone levels were observed between groups (Fig. 6B). In addition, fertility was not impaired in male SF1 Socs3 KO mice (Fig. 6C), indicating that despite the lower testis weight, SF1 Socs3 KO mice showed no apparent reproductive dysfunction. Pituitary-specific SF1 inactivation causes infertility due to a robust reduction in LH and FSH expressions, but does not affect other pituitary cell types, such as somatotropes, corticotropes and thyrotropes (Zhao et al. 2001). To investigate whether SF1-specific SOCS3 ablation affects the pituitary gland, we analyzed the mRNA levels of several pituitary hormones. SF1 Socs3 KO male mice showed similar mRNA levels of GH, POMC, LHβ and FSHβ in the pituitary gland, compared to control animals (Fig. 6D). Therefore, SF1-specific SOCS3 inactivation does not induce apparent defects in the pituitary function.
Effect of SF1-specific SOCS3 ablation in gonadal and pituitary functions. (A) Testis weight in control (n = 8) and SF1 Socs3 KO (n = 9) mice. (B) Plasma testosterone levels in control (n = 5) and SF1 Socs3 KO (n = 4) mice. (C) Fertility test evaluated by measuring the number of days required for control (n = 20) and SF1 Socs3 KO (n = 30) males to produce litters when breeding with female mice. (D) Gene expression analysis in the pituitary gland of control (n = 4) and SF1 Socs3 KO (n = 4) mice. (E) Quantification of the area occupied by eosinophilic cells in the corticomedullary junction, representing the X-zone. Unpaired two-tailed Student’s t-test was used in the statistical analyses. *, significant (P < 0.05) different than virgin control and postpartum SF1 Socs3 KO groups.
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
SOCS3 expression in SF1 cells is required for X-zone regression in postpartum adult females
In female mice, the X-zone atrophy disappears after the first pregnancy (Tanaka & Matsuzawa 1995). As expected, a histological analysis in the adrenal gland of virgin control females confirmed the presence of the X-zone in the medullary boundary (Figs 6E and 7A, D and G), which disappeared in postpartum control females (Figs 6E and 7B, E and H). Remarkably, SF1 Socs3 KO postpartum females retained the X-zone in the adrenal cortex (Figs 6E and 7C, F and I), indicating that the SOCS3 expression in SF1 cells is required for X-zone regression in postpartum adult females. The fertility of female mice was also analyzed. However, the number of days breeding until giving birth (control: 27.8 ± 2.5 days; SF1 Socs3 KO: 27.3 ± 1.7 days) and the number of pups per litter (control: 5.9 ± 0.4; SF1 Socs3 KO: 6.7 ± 0.6) were similar between the groups. Thus, SF1-specific SOCS3 ablation did not affect the fertility.
Presence of X-zone in adrenal gland of SF1 Socs3 KO postpartum female mice. (A, D and G) Photomicrographs of the adrenal gland of a virgin control female. (B, E and H) Photomicrographs of the adrenal gland of a postpartum control female. (C, F and I) Photomicrographs of the adrenal gland of postpartum SF1 Socs3 KO female. Black arrows indicate the X-zone. m, adrenal medulla. Scale bar = 0.02 mm.
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
Resistance exercise reduces body adiposity and improves glucose tolerance
We assessed the metabolic consequences of 8-week resistance training. Compared to sedentary animals, exercise training reduced the body weight (Fig. 8A), weight gain (Fig. 8B) and body adiposity (Fig. 8C). Furthermore, glucose tolerance was improved by exercise training (Fig. 8D). These effects were equally observed in control and SF1 Socs3 KO mice (Fig. 8A. B, C and D). SOCS3 deletion or resistance exercise had no significant effect on insulin sensitivity (Fig. 8E). Therefore, SF1-specific SOCS3 deletion did not change the beneficial effects of exercise on energy balance and glucose homeostasis.
Resistance exercise reduces body adiposity and improves glucose tolerance. (A, B, and C) Body weight (A), weight change (B) and body adiposity (C) at the end of experiment in sedentary control (n = 20), exercise control (n = 20), sedentary SF1 Socs3 KO (n = 16) and exercise SF1 Socs3 KO (n = 16). (D and E) Glucose tolerance test (D) and insulin tolerance test (E) after 4 and 5 weeks of training, respectively (n = 13/group). *, significant (P < 0.05) effect of exercise (two-way ANOVA test).
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
Metabolic changes induced by exercise training or SF1-specific SOCS3 ablation
Additional metabolic parameters were obtained in the last 2 weeks of training when mice were evaluated by the Oxymax/CLAMS (Fig. 9). During the post-training period (4 h after the exercise session), exercise groups exhibited increased VO2 (Fig. 9B), as well as reduced RER (Fig. 9E) and locomotor activity (Fig. 9H) compared to sedentary animals, independently of the genotype. Exercise also increased water intake during the dark cycle (Fig. 9O). We observed a significant effect of SF1-specific SOCS3 ablation by reducing the RER in the dark cycle (Fig. 9F), the food and water intake during the pre-training period (Fig. 9J and M) and the water intake in the post-training period (Fig. 9N).
Metabolic changes induced by exercise training or SF1-specific SOCS3 ablation. (A, B, C, D, E, F, G, H, I, J, K, L, M, N and O) VO2 (A, B and C) respiratory exchange ratio (RER, D, E, and F), locomotor activity (G, H, and I), food intake (J, K and L) and water intake (M, N and O) in sedentary control (n = 14), exercise control (n = 15), sedentary SF1 Socs3 KO (n = 13) and exercise SF1 Socs3 KO (n = 14). These data represent the average analysis of 4 consecutive days and were presented as pre-training (the light cycle before the training session from 8:00 h to 14:00 h), post-training (the light cycle immediately after the training session from 16:00 h to 20:00 h) and dark cycle (from 20:00 h to 8:00 h). *significant (P < 0.05) effect of exercise (two-way ANOVA test). †significant (P < 0.05) effect of SF1-specific SOCS3 ablation.
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
Impaired training performance, glucose control during intense exercise and counter-regulatory response to 2-deoxy-D-glucose (2DG) in SF1 Socs3 KO mice. (A) Changes in the weight lifted by control (n = 9) and SF1 Socs3 KO (n = 8) mice along the 8-week training period. (B) Maximal weight lifted during 1RM tests performed in the first, fourth and eighth weeks of training (n = 9/group). (C) Glycemia measured just before the last 1RM test and immediately after exhaustion (n = 9/group). (D) Evaluation of the counter-regulatory response induced by an acute injection of 0.5 mg/kg 2DG. (E) Area under the curve in the glycemia after 2DG administration (n = 10–12/group). (F and G) Serum ACTH (F) and corticosterone (G) levels in control (n = 12) and SF1 Socs3 KO (n = 8) mice 60 min after an i.p. injection of 2DG. Unpaired two-tailed Student’s t-test was used in the statistical analyses.
Citation: Journal of Endocrinology 235, 3; 10.1530/JOE-17-0255
Impaired training performance, glucose control during intense exercise and counter-regulatory response to 2DG in SF1 Socs3 KO mice
Training performance was initially assessed through the weight lifted by the animals during the training sessions. During the first weeks of training, SF1 Socs3 KO and control mice carried similar loads during the climbing series (Fig. 10A). However, while control animals progressively increased the weight lifted, SF1 Socs3 KO mice were not able to lift similar loads from the fifth week of training, compared to control animals (Fig. 10A). The 1RM tests also confirmed the impaired exercise performance of SF1 Socs3 KO mice along the training protocol (Fig. 10B). Regarding the 1RM tests performed in the first and fourth weeks of training, SF1 Socs3 KO mice exhibited a similar performance compared to control animals (Fig. 10B). However, at the eighth week of training, SF1 Socs3 KO mice did not present improvements in their performance to the same extent as control animals (Fig. 10B). The analysis of the CSA of individual fibers of the soleus muscle revealed an interaction effect between the training status and the genotype (P = 0.0494). While exercise training increased in 22% soleus CSA of individual fibers in control animals, the exercise SF1 Socs3 KO group exhibited no increment compared to sedentary mutants (data not shown).
An adequate blood glucose level is necessary to maintain performance during exercise (Coyle 1999). Since both the adrenal cortex and the VMH are related to the control of blood glucose (Verberne et al. 2014, Meek et al. 2016), we investigated whether SOCS3 ablation in SF1 cells affects the glycemia regulation during exercise. Thus, we assessed glycemia just before the beginning of the last 1RM test and immediately after exhaustion. Despite the high intensity of the 1RM test, in which mice carried approximately 4 times their body weight during the ladder climbing, control animals were able to sustain the same pre-exercise glycemia values at the fatigue moment (Fig. 10C). On the other hand, SF1 Socs3 KO mice exhibited a significantly lower glycemia at the exhaustion compared to pre-exercise glycemia (Fig. 10C). Therefore, the SOCS3 expression in SF1 cells is required to sustain training performance and glycemia during exercise. SF1-positive neurons in the VMH are critically involved in the glucoregulatory responses required to reestablish glycemia under metabolic challenges like hypoglycemia or 2DG administration (Flak et al. 2014, Verberne et al. 2014, Meek et al. 2016). Thus, we assessed whether SF1 Socs3 KO mice exhibit changes to the counter-regulatory response evoked by 2DG administration. Notably, the conditional knockout mice showed an attenuated glucoregulatory response compared to control animals (Fig. 10D and E). This defect occurred despite a similar activation of the HPA axis, since serum ACTH (Fig. 10F) and corticosterone (Fig. 10G) levels showed no differences between the groups after 2DG infusion.
Discussion
In the present study, we investigated whether the SOCS3 expression in SF1 cells regulates adrenal, gonadal and pituitary functions, resistance training performance as well as the metabolic effects of exercise. Our hypothesis was that exercise-induced cytokine signaling exerts an important modulation in the training adaptations, and SF1-specific SOCS3 ablation might change the metabolic responses to exercise. Our results revealed that SF1 Socs3 KO mice exhibit histological and functional changes in the adrenal gland. The overall metabolic responses induced by resistance training remained unchanged in SF1 Socs3 KO mice. However, resistance training performance and glucose control during intense exercise were impaired in mice carrying SF1-specific SOCS3 ablation. Furthermore, a reduced counter-regulatory response to hypoglycemia was also observed in SF1 Socs3 KO mice. Therefore, our findings suggest a previously unrecognized participation of SOCS3 modulating several endocrine and metabolic aspects.
The main role of the adrenal gland is to maintain body homeostasis by secreting corticosteroids, such as corticosterone and aldosterone in rodents. Multiple signaling pathways have already been described to promote steroid hormone biosynthesis in steroidogenic cells, including cytokine-induced cAMP-independent pathways (Stocco et al. 2005). Our results show that SOCS3 ablation in SF1-positive cells apparently did not alter the adrenal gland function under basal conditions. For example, adrenal weight and basal corticosterone and ACTH level were not affected in SF1 Socs3 KO mice. However, a reduction in the total amount of lipids along the adrenal cortex was observed in SF1 Socs3 KO mice, which suggests a lower capacity to produce steroid hormones, since steroidogenic cells do not store significant amounts of steroid hormones, and there is a need for a constant supply of cholesterol (including from lipid droplets) to synthesize new steroid hormones when the cell is stimulated (Shen et al. 2016). In accordance with these results, SF1 Socs3 KO mice showed a blunted adrenal steroidogenic capacity when corticosterone secretion was evaluated during an ACTH stimulation test. Therefore, these findings indicate that although SF1 Socs3 KO mice are able to maintain normal adrenal function during basal conditions, their maximal adrenal steroidogenic capacity seems to be limited.
One of the most intriguing phenotypes observed in SF1 Socs3 KO mice was the retention of the fetal adrenal X-zone in adult animals. In rodents, a transient cell layer, named the X-zone, is located in the corticomedullary junction and regresses at puberty in males and at the first pregnancy in females (Holmes & Dickson 1971). Interestingly, even with the presence of this zone in SF1 Socs3 KO mice, the atrophy of the adult cortex resulted in an adrenal weight equivalent to control animals. Knockout mice for the Stat5a and Stat5b genes have no profound effect on X-zone morphology or on the expression of 20α-hydroxysteroid dehydrogenase, which is a steroidogenic enzyme expressed in X-zone cells (Hershkovitz et al. 2007). Although the molecular mechanisms that drive fetal zone regression and terminal differentiation of the adrenal cortex are not yet clearly defined, our findings suggest that SOCS3 is a previously unrecognized factor required for the terminal differentiation of the adrenal gland.
The beneficial metabolic effects of exercise are well established (Strasser et al. 2012, Golbidi & Laher 2014, Sarvas et al. 2015). Chronic exercise improves energy and glucose homeostasis (Laing et al. 2016). Interestingly, several studies reported increased SOCS3 expression in response to exercise in the skeletal muscle (Spangenburg et al. 2006, Trenerry et al. 2007, Guerra et al. 2011, Begue et al. 2013) or hypothalamus (Pereira et al. 2015). Although these results seem to be conflicting since increased SOCS3 levels are associated with metabolic imbalances, such as obesity and insulin resistance (Bjorbaek et al. 1998, Mori et al. 2004, Howard & Flier 2006, Jorgensen et al. 2013), an increased SOCS3 expression may simply indicate an acute effect of exercise caused by cytokine/hormone secretion. In fact, chronic exercise causes no changes or even a reduction in the SOCS3 expression in different tissues, which may help to explain the higher insulin and leptin sensitivity observed in trained animals (Steinberg et al. 2004, Yaspelkis et al. 2010, Guerra et al. 2011, Olmedillas et al. 2011, Kang et al. 2013, Sarvas et al. 2015).
Previous studies have shown improved body adiposity and glucose homeostasis after SOCS3 ablation (Mori et al. 2004, Pedroso et al. 2014, 2016, Zampieri et al. 2015, Bohlen et al. 2016). Zhang et al. (2008) also studied mice carrying SF1-specific SOCS3 deletion. These authors observed no changes in body weight and adiposity in mutant mice exposed to normal chow or high-fat diet. However, different from our results, they found improved glucose homeostasis and lower energy expenditure in SF1 Socs3 KO mice (Zhang et al. 2008). Comparing control and SF1 Socs3 KO mice, independently of the training status, we only found very small metabolic differences. For example, we observed a lower food and water intake in SF1 Socs3 KO mice during the pre-training period. A previous study also showed that SOCS3 deletion in SF1 cells reduces food intake in mice, an effect attributed to increased leptin sensitivity in the VMH (Zhang et al. 2008). The reduced water intake was probably secondary to a lower food intake, since water intake is important for swallowing the dry pelleted feed. Furthermore, our data confirmed some expected metabolic effects induced by exercise. Trained animals showed a lower body weight and adiposity, and an improved glucose tolerance compared to sedentary groups. Regarding the acute effects induced by the training session, we observed a significant effect of exercise during the post-training period by increasing VO2, probably representing the excess post-exercise oxygen consumption (Maehlum et al. 1986) and by reducing RER and locomotor activity, which may indicate, respectively, a higher fat oxidation and a tiredness state. Water intake also increased in the dark period possibly indicating a post-exercise rehydration. However, none of these parameters were affected by SF1-specific SOCS3 ablation.
SF1 Socs3 KO mice showed a remarkably lower performance during the last weeks of training. The lack of changes in the first weeks of training may indicate that at lower intensities, SF1-specific SOCS3 ablation causes no significant biological effects for the exercise adaptations. However, when the intensity progressively increased, mutant mice were not able to lift similar loads during training sessions or 1RM test, compared to control animals. Interestingly, SF1 Socs3 KO mice were also unable to maintain circulating glucose levels during the last 1RM test. An incapacity to control glycemia at situations that consume high amounts of glucose is certainly a factor that can impair exercise performance and thereby training adaptations (Coyle 1999). A reduced adrenal capacity to respond to stress-secreting glucocorticoids could impair high-intensity exercise training by disrupting glycemia control.
Defects in VMH neurons could also affect glucose homeostasis and other metabolic changes. It is well established that VMH neurons control the energy balance, glucose homeostasis and autonomic nervous system (Brobeck 1946, Powley 1977, Ikeda et al. 1995, Majdic et al. 2002, Seoane-Collazo et al. 2015). Pharmacological manipulations in VMH neurons can decrease plasma glucose levels, hepatic glycogenolysis, lipolysis and fatty acid oxidation during exercise, leading to a reduced performance (Vissing et al. 1989, Balkan et al. 1991, Wanner et al. 2010, Miyaki et al. 2011). Exercise also increases noradrenergic and dopaminergic tonus to VMH neurons (Kitaoka et al. 2010), which in turn modulate the autonomic nervous system in order to produce the required adjustments in the cardiovascular system, nutrient mobilization and glucose homeostasis (Ball 2015, Seoane-Collazo et al. 2015). Accordingly, VMH SF1-positive neurons send projections to autonomic sympathetic and parasympathetic centers of the hypothalamus and hindbrain, which innervate white and brown adipose tissue, heart, liver, pancreas and skeletal muscles (Lindberg et al. 2013, Seoane-Collazo et al. 2015). VMH SF1-positive neurons are also fundamental components of the neurocircuitry that regulates counter-regulatory responses to hypoglycemia, ensuring a rapid and efficient recovery of glucose levels (Flak et al. 2014, Verberne et al. 2014, Meek et al. 2016). In the present study, a lower glucoregulatory response to 2DG was observed in SF1 Socs3 KO mice. Since VMH neurons trigger the counter-regulatory response evoked by 2DG and the reduced counter-regulatory response occurred despite a similar activation of the HPA axis by 2DG, these results suggest a possible involvement of VMH SF1 neurons in the metabolic defects observed in SF1 Socs3 KO mice.
In conclusion, our study showed for the first time that SOCS3 expression in SF1 cells is required to maintain training performance and glucose control during intense resistance exercise. Additionally, SF1-specific SOCS3 ablation decreased testis weight, although it did not affect the fertility, and caused histological and functional changes in the adrenal cortex. Furthermore, an attenuated counter-regulatory response to hypoglycemia was also observed in SF1 Socs3 KO mice. Therefore, our results revealed a novel participation of SOCS3 regulating several endocrine and metabolic aspects. These findings provide new insights into how cytokine signaling can modulate multiple biological functions, especially regarding physical exercise and the terminal differentiation of the adrenal gland.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the São Paulo Research Foundation (FAPESP; grant numbers 10/18086-0, 12/23535-4, 13/21722-4, 13/24409-5, 14/11752-6, 14/50140-6 and 15/10992-6).
Author contribution statement
J A B P and J D designed the study; J A B P, I T, V L P, L B L, I C F and D N B performed the exercise training and in vivo analyses; M A S F did the muscle analysis; P O R M, T B A, I C C and C F P L did the adrenal analysis; A M R L performed the brain histology; J A B P, M A S F, P O R M, T B A, I C C, C F P L and J D analyzed the data; J A B P, P O R M and J D wrote the paper. All authors read and approved the final version of the manuscript.
References
Balkan B, Strubbe JH, Bruggink JE & Steffens AB 1991 Altered sympathetic control of nutrient mobilization during physical exercise after lesions in the VMH. American Journal of Physiology 260 R368–R372.
Ball D 2015 Metabolic and endocrine response to exercise: sympathoadrenal integration with skeletal muscle. Journal of Endocrinology 224 R79–R95. (doi:10.1530/JOE-14-0408)
Begue G, Douillard A, Galbes O, Rossano B, Vernus B, Candau R & Py G 2013 Early activation of rat skeletal muscle IL-6/STAT1/STAT3 dependent gene expression in resistance exercise linked to hypertrophy. PLoS ONE 8 e57141. (doi:10.1371/journal.pone.0057141)
Bjorbaek C, Elmquist JK, Frantz JD, Shoelson SE & Flier JS 1998 Identification of SOCS-3 as a potential mediator of central leptin resistance. Molecular Cell 1 619–625. (doi:10.1016/S1097-2765(00)80062-3)
Bohlen TM, Silveira MA, Zampieri TT, Frazao R & Donato J Jr 2016 Fatness rather than leptin sensitivity determines the timing of puberty in female mice. Molecular and Cellular Endocrinology 423 11–21. (doi:10.1016/j.mce.2015.12.022)
Brobeck JR 1946 Mechanisms of the development of obesity in animals with hypothalamic lesions. Physiological Reviews 25 541–559.
Coyle EF 1999 Physiological determinants of endurance exercise performance. Journal of Science and Medicine in Sport 2 181–189. (doi:10.1016/S1440-2440(99)80172-8)
da Silva RP, Zampieri TT, Pedroso JA, Nagaishi VS, Ramos-Lobo AM, Furigo IC, Camara NO, Frazao R & Donato J Jr 2014 Leptin resistance is not the primary cause of weight gain associated with reduced sex hormone levels in female mice. Endocrinology 155 4226–4236. (doi:10.1210/en.2014-1276)
Flak JN, Patterson CM, Garfield AS, D’Agostino G, Goforth PB, Sutton AK, Malec PA, Wong JM, Germani M & Jones JC et al. 2014 Leptin-inhibited PBN neurons enhance responses to hypoglycemia in negative energy balance. Nature Neuroscience 17 1744–1750. (doi:10.1038/nn.3861)
Fortes MA, Pinheiro CH, Guimaraes-Ferreira L, Vitzel KF, Vasconcelos DA & Curi R 2015 Overload-induced skeletal muscle hypertrophy is not impaired in STZ-diabetic rats. Physiological Reports 3 e12457. (doi:10.14814/phy2.12457)
Fujikawa T, Castorena CM, Pearson M, Kusminski CM, Ahmed N, Battiprolu PK, Kim KW, Lee S, Hill JA & Scherer PE et al. 2016 SF-1 expression in the hypothalamus is required for beneficial metabolic effects of exercise. eLife 5 e18206. (doi:10.7554/eLife.18206)
Furigo IC, Kim KW, Nagaishi VS, Ramos-Lobo AM, de Alencar A, Pedroso JA, Metzger M & Donato J Jr 2014 Prolactin-sensitive neurons express estrogen receptor-alpha and depend on sex hormones for normal responsiveness to prolactin. Brain Research 1566 47–59. (doi:10.1016/j.brainres.2014.04.018)
Furigo IC, Metzger M, Teixeira PD, Soares CR & Donato J Jr 2017 Distribution of growth hormone-responsive cells in the mouse brain. Brain Structure and Function 222 341–363. (doi:10.1007/s00429-016-1221-1)
Golbidi S & Laher I 2014 Exercise induced adipokine changes and the metabolic syndrome. Journal of Diabetes Research 2014 726861. (doi:10.1155/2014/726861)
Guerra B, Olmedillas H, Guadalupe-Grau A, Ponce-Gonzalez JG, Morales-Alamo D, Fuentes T, Chapinal E, Fernandez-Perez L, De Pablos-Velasco P & Santana A et al. 2011 Is sprint exercise a leptin signaling mimetic in human skeletal muscle? Journal of Applied Physiology 111 715–725. (doi:10.1152/japplphysiol.00805.2010)
Hershkovitz L, Beuschlein F, Klammer S, Krup M & Weinstein Y 2007 Adrenal 20alpha-hydroxysteroid dehydrogenase in the mouse catabolizes progesterone and 11-deoxycorticosterone and is restricted to the X-zone. Endocrinology 148 976–988. (doi:10.1210/en.2006-1100)
Holmes PV & Dickson AD 1971 X-zone degeneration in the adrenal glands of adult and immature female mice. Journal of Anatomy 108 159–168.
Hornberger TA Jr & Farrar RP 2004 Physiological hypertrophy of the FHL muscle following 8 weeks of progressive resistance exercise in the rat. Canadian Journal of Applied Physiology 29 16–31. (doi:10.1139/h04-002)
Howard JK & Flier JS 2006 Attenuation of leptin and insulin signaling by SOCS proteins. Trends Endocrinology and Metabolism 17 365–371. (doi:10.1016/j.tem.2006.09.007)
Huang G, Yuan M, Zhang J, Li J, Gong D, Li Y, Zhang J, Lin P & Huang L 2016 IL-6 mediates differentiation disorder during spermatogenesis in obesity-associated inflammation by affecting the expression of Zfp637 through the SOCS3/STAT3 pathway. Scientific Reports 6 28012. (doi:10.1038/srep28012)
Ikeda Y, Luo XR, Abbud R, Nilson JH & Parker KL 1995 The nuclear receptor steroidogenic factor-1 is essential for the formation of the ventromedial hypothalamic nucleus. Molecular Endocrinology 9 478–486. (doi:10.1210/mend.9.8.7476982)
Jones IC 1952 The disappearance of the X zone of the mouse adrenal cortex during first pregnancy. Proceedings of the Royal Society of London: Series B, Containing Papers of a Biological Character 139 398–410. (doi:10.1098/rspb.1952.0020)
Jorgensen SB, O’Neill HM, Sylow L, Honeyman J, Hewitt KA, Palanivel R, Fullerton MD, Oberg L, Balendran A & Galic S et al. 2013 Deletion of skeletal muscle SOCS3 prevents insulin resistance in obesity. Diabetes 62 56–64. (doi:10.2337/db12-0443)
Kang S, Kim KB & Shin KO 2013 Exercise training improves leptin sensitivity in peripheral tissue of obese rats. Biochemical and Biophysical Research Communications 435 454–459. (doi:10.1016/j.bbrc.2013.05.007)
Keeney DS, Jenkins CM & Waterman MR 1995 Developmentally regulated expression of adrenal 17 alpha-hydroxylase cytochrome P450 in the mouse embryo. Endocrinology 136 4872–4879. (doi:10.1210/endo.136.11.7588219)
Kim KW, Li S, Zhao H, Peng B, Tobet SA, Elmquist JK, Parker KL & Zhao L 2010 CNS-specific ablation of steroidogenic factor 1 results in impaired female reproductive function. Molecular Endocrinology 24 1240–1250. (doi:10.1210/me.2009-0206)
Kim KW, Zhao L, Donato J Jr, Kohno D, Xu Y, Elias CF, Lee C, Parker KL & Elmquist JK 2011 Steroidogenic factor 1 directs programs regulating diet-induced thermogenesis and leptin action in the ventral medial hypothalamic nucleus. PNAS 108 10673–10678. (doi:10.1073/pnas.1102364108)
Kim HJ, So B, Choi M, Kang D & Song W 2015 Resistance exercise training increases the expression of irisin concomitant with improvement of muscle function in aging mice and humans. Experimental Gerontology 70 11–17. (doi:10.1016/j.exger.2015.07.006)
Kitaoka R, Fujikawa T, Miyaki T, Matsumura S, Fushiki T & Inoue K 2010 Increased noradrenergic activity in the ventromedial hypothalamus during treadmill running in rats. Journal of Nutritional Science and Vitaminology 56 185–190. (doi:10.3177/jnsv.56.185)
Klockener T, Hess S, Belgardt BF, Paeger L, Verhagen LAW, Husch A, Sohn J-W, Hampel B, Dhillon H & Zigman JM et al. 2011 High-fat feeding promotes obesity via insulin receptor/PI3K-dependent inhibition of SF-1 VMH neurons. Nature Neuroscience 14 911–918. (doi:10.1038/nn.2847)
Krebs DL & Hilton DJ 2001 SOCS proteins: negative regulators of cytokine signaling. Stem Cells 19 378–387. (doi:10.1634/stemcells.19-5-378)
Laing BT, Do K, Matsubara T, Wert DW, Avery MJ, Langdon EM, Zheng D & Huang H 2016 Voluntary exercise improves hypothalamic and metabolic function in obese mice. Journal of Endocrinology 229 109–122. (doi:10.1530/JOE-15-0510)
Lindberg D, Chen P & Li C 2013 Conditional viral tracing reveals that steroidogenic factor 1-positive neurons of the dorsomedial subdivision of the ventromedial hypothalamus project to autonomic centers of the hypothalamus and hindbrain. Journal of Comparative Neurology 521 3167–3190. (doi:10.1002/cne.23338)
Maehlum S, Grandmontagne M, Newsholme EA & Sejersted OM 1986 Magnitude and duration of excess postexercise oxygen consumption in healthy young subjects. Metabolism 35 425–429. (doi:10.1016/0026-0495(86)90132-0)
Majdic G, Young M, Gomez-Sanchez E, Anderson P, Szczepaniak LS, Dobbins RL, McGarry JD & Parker KL 2002 Knockout mice lacking steroidogenic factor 1 are a novel genetic model of hypothalamic obesity. Endocrinology 143 607–614. (doi:10.1210/endo.143.2.8652)
Meek TH, Nelson JT, Matsen ME, Dorfman MD, Guyenet SJ, Damian V, Allison MB, Scarlett JM, Nguyen HT & Thaler JP et al. 2016 Functional identification of a neurocircuit regulating blood glucose. PNAS 113 E2073–E2082. (doi:10.1073/pnas.1521160113)
Mehlem A, Hagberg CE, Muhl L, Eriksson U & Falkevall A 2013 Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease. Nature Protocols 8 1149–1154. (doi:10.1038/nprot.2013.055)
Miyaki T, Fujikawa T, Kitaoka R, Hirano N, Matsumura S, Fushiki T & Inoue K 2011 Noradrenergic projections to the ventromedial hypothalamus regulate fat metabolism during endurance exercise. Neuroscience 190 239–250. (doi:10.1016/j.neuroscience.2011.05.051)
Mori H, Hanada R, Hanada T, Aki D, Mashima R, Nishinakamura H, Torisu T, Chien KR, Yasukawa H & Yoshimura A 2004 Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nature Medicine 10 739–743. (doi:10.1038/nm1071)
Nagaishi VS, Cardinali LI, Zampieri TT, Furigo IC, Metzger M & Donato J Jr 2014 Possible crosstalk between leptin and prolactin during pregnancy. Neuroscience 259 71–83. (doi:10.1016/j.neuroscience.2013.11.050)
Olmedillas H, Guerra B, Guadalupe-Grau A, Santana A, Fuentes T, Dorado C, Serrano-Sanchez JA & Calbet JA 2011 Training, leptin receptors and SOCS3 in human muscle. International Journal of Sports Medicine 32 319–326. (doi:10.1055/s-0030-1269892)
Parker KL, Rice DA, Lala DS, Ikeda Y, Luo X, Wong M, Bakke M, Zhao L, Frigeri C & Hanley NA et al. 2002 Steroidogenic factor 1: an essential mediator of endocrine development. Recent Progress in Hormone Research 57 19–36. (doi:10.1210/rp.57.1.19)
Pedroso JA, Buonfiglio DC, Cardinali LI, Furigo IC, Ramos-Lobo AM, Tirapegui J, Elias CF & Donato J Jr 2014 Inactivation of SOCS3 in leptin receptor-expressing cells protects mice from diet-induced insulin resistance but does not prevent obesity. Molecular Metabolism 3 608–618. (doi:10.1016/j.molmet.2014.06.001)
Pedroso JA, Silveira MA, Lima LB, Furigo IC, Zampieri TT, Ramos-Lobo AM, Buonfiglio DC, Teixeira PD, Frazao R & Donato J Jr 2016 Changes in leptin signaling by SOCS3 modulate fasting-induced hyperphagia and weight regain in mice. Endocrinology 157 3901–3914. (doi:10.1210/en.2016-1038)
Pereira BC, da Rocha AL, Pauli JR, Ropelle ER, de Souza CT, Cintra DE, Sant’Ana MR & da Silva AS 2015 Excessive eccentric exercise leads to transitory hypothalamic inflammation, which may contribute to the low body weight gain and food intake in overtrained mice. Neuroscience 311 231–242. (doi:10.1016/j.neuroscience.2015.10.027)
Powley TL 1977 The ventromedial hypothalamic syndrome, satiety, and a cephalic phase hypothesis. Psychology Review 84 89–126. (doi:10.1037/0033-295X.84.1.89)
Roberts AW, Robb L, Rakar S, Hartley L, Cluse L, Nicola NA, Metcalf D, Hilton DJ & Alexander WS 2001 Placental defects and embryonic lethality in mice lacking suppressor of cytokine signaling 3. PNAS 98 9324–9329. (doi:10.1073/pnas.161271798)
Sarvas JL, Otis JS, Khaper N & Lees SJ 2015 Voluntary physical activity prevents insulin resistance in a tissue specific manner. Psychology Review 3 e12277. (doi:10.14814/phy2.12277)
Scheys JO, Heaton JH & Hammer GD 2011 Evidence of adrenal failure in aging Dax1-deficient mice. Endocrinology 152 3430–3439. (doi:10.1210/en.2010-0986)
Schobitz B, de Kloet ER, Sutanto W & Holsboer F 1993 Cellular localization of interleukin 6 mRNA and interleukin 6 receptor mRNA in rat brain. European Journal of Neuroscience 5 1426–1435. (doi:10.1111/j.1460-9568.1993.tb00210.x)
Segal JP, Stallings NR, Lee CE, Zhao L, Socci N, Viale A, Harris TM, Soares MB, Childs G & Elmquist JK et al. 2005 Use of laser-capture microdissection for the identification of marker genes for the ventromedial hypothalamic nucleus. Journal of Neuroscience 25 4181–4188. (doi:10.1523/JNEUROSCI.0158-05.2005)
Seoane-Collazo P, Ferno J, Gonzalez F, Dieguez C, Leis R, Nogueiras R & Lopez M 2015 Hypothalamic-autonomic control of energy homeostasis. Endocrine 50 276–291. (doi:10.1007/s12020-015-0658-y)
Shen WJ, Azhar S & Kraemer FB 2016 Lipid droplets and steroidogenic cells. Experimental Cell Research 340 209–214. (doi:10.1016/j.yexcr.2015.11.024)
Spangenburg EE, Brown DA, Johnson MS & Moore RL 2006 Exercise increases SOCS-3 expression in rat skeletal muscle: potential relationship to IL-6 expression. Journal of Physiology 572 839–848. (doi:10.1113/jphysiol.2005.104315)
Steinberg GR, Smith AC, Wormald S, Malenfant P, Collier C & Dyck DJ 2004 Endurance training partially reverses dietary-induced leptin resistance in rodent skeletal muscle. American Journal of Physiology: Endocrinology and Metabolism 286 E57–E63. (doi:10.1152/ajpendo.00302.2003)
Stocco DM, Wang X, Jo Y & Manna PR 2005 Multiple signaling pathways regulating steroidogenesis and steroidogenic acute regulatory protein expression: more complicated than we thought. Molecular Endocrinology 19 2647–2659. (doi:10.1210/me.2004-0532)
Strasser B, Arvandi M & Siebert U 2012 Resistance training, visceral obesity and inflammatory response: a review of the evidence. Obesity Reviews 13 578–591. (doi:10.1111/j.1467-789X.2012.00988.x)
Tam SP, Lau P, Djiane J, Hilton DJ & Waters MJ 2001 Tissue-specific induction of SOCS gene expression by PRL. Endocrinology 142 5015–5026. (doi:10.1210/endo.142.11.8466)
Tanaka S & Matsuzawa A 1995 Comparison of adrenocortical zonation in C57BL/6J and DDD mice. Experimental Animals 44 285–291. (doi:10.1538/expanim.44.285)
Trenerry MK, Carey KA, Ward AC & Cameron-Smith D 2007 STAT3 signaling is activated in human skeletal muscle following acute resistance exercise. Journal of Applied Physiology 102 1483–1489. (doi:10.1152/japplphysiol.01147.2006)
Verberne AJ, Sabetghadam A & Korim WS 2014 Neural pathways that control the glucose counterregulatory response. Frontiers in Neuroscience 8 38. (doi:10.3389/fnins.2014.00038)
Vissing J, Wallace JL, Scheurink AJ, Galbo H & Steffens AB 1989 Ventromedial hypothalamic regulation of hormonal and metabolic responses to exercise. American Journal of Physiology 256 R1019–R1026.
Wanner SP, Guimaraes JB, Pires W, La Guardia RB, Haibara AS, Marubayashi U, Coimbra CC & Lima NR 2010 Physical exercise-induced cardiovascular adjustments are modulated by muscarinic cholinoceptors within the ventromedial hypothalamic nucleus. Physiological Research 59 165–175.
Yaspelkis BB 3rd, Kvasha IA, Lessard SJ, Rivas DA & Hawley JA 2010 Aerobic training reverses high-fat diet-induced pro-inflammatory signalling in rat skeletal muscle. European Journal of Applied Physiology 110 779–788. (doi:10.1007/s00421-010-1559-7)
Yuan M, Huang G, Li J, Zhang J, Li F, Li K, Gao B, Zeng L, Shan W & Lin P et al. 2014 Hyperleptinemia directly affects testicular maturation at different sexual stages in mice, and suppressor of cytokine signaling 3 is involved in this process. Reproductive Biology and Endocrinology 12 15. (doi:10.1186/1477-7827-12-15)
Zampieri TT, Ramos-Lobo AM, Furigo IC, Pedroso JA, Buonfiglio DC & Donato J Jr 2015 SOCS3 deficiency in leptin receptor-expressing cells mitigates the development of pregnancy-induced metabolic changes. Molecular Metabolism 4 237–245. (doi:10.1016/j.molmet.2014.12.005)
Zhang R, Dhillon H, Yin H, Yoshimura A, Lowell BB, Maratos-Flier E & Flier JS 2008 Selective inactivation of Socs3 in SF1 neurons improves glucose homeostasis without affecting body weight. Endocrinology 149 5654–5661. (doi:10.1210/en.2008-0805)
Zhang S, Morrison JL, Gill A, Rattanatray L, MacLaughlin SM, Kleemann D, Walker SK & McMillen IC 2013 Maternal dietary restriction during the periconceptional period in normal-weight or obese ewes results in adrenocortical hypertrophy, an up-regulation of the JAK/STAT and down-regulation of the IGF1R signaling pathways in the adrenal of the postnatal lamb. Endocrinology 154 4650–4662. (doi:10.1210/en.2013-1414)
Zhao L, Bakke M, Krimkevich Y, Cushman LJ, Parlow AF, Camper SA & Parker KL 2001 Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function. Development 128 147–154.
