Abstract
Neuronostatin, a somatostatin gene-encoded peptide, exerts important physiological and metabolic actions in diverse tissues. However, the direct biological effects of neuronostatin on pituitary function of humans and primates are still unknown. This study used baboon (Papio anubis) primary pituitary cell cultures, a species that closely models human physiology, to demonstrate that neuronostatin inhibits basal, but not ghrelin-/GnRH-stimulated, growth hormone (GH) and luteinizing hormone (LH) secretion in a dose- and time-dependent fashion, without affecting the secretion of other pituitary hormones (prolactin, ACTH, FSH, thyroid-stimulating hormone (TSH)) or changing mRNA levels. Actions of neuronostatin differs from somatostatin which in this study reduced GH/PRL/ACTH/LH/TSH secretion and GH/PRL/POMC/LH gene expression. Remarkably, we found that inhibitory actions of neuronostatin are likely mediated through: (1) the orphan receptor GPCR107 (found to be highly expressed in pituitary compared to somatostatin-receptors), (2) common (i.e. adenylyl cyclase/protein kinase A/MAPK/extra-/intracellular Ca2+ mobilization, but not phospholipase C/protein kinase C/mTOR) and distinct (i.e. PI3K) signaling pathways than somatostatin and; (3) dissimilar molecular mechanisms than somatostatin (i.e. upregulation of GPCR107 and downregulation of GHS-R/Kiss1-R expression by neuronostatin and, upregulation of sst1–5 expression by somatostatin). Altogether, the results of this study provide the first evidence that there is a functional neuronostatin signaling circuit, unique from somatostatin, which may work in concert with somatostatin to fine-tune hormone release from somatostropes and gonadotropes.
Introduction
Neuronostatin (NST), a recently described peptide hormone encoded in the preprosomatostatin gene but without amino-acid homology to somatostatin (SST) (Samson et al. 2008), has been shown to exert important physiological actions in diverse tissues (Hua et al. 2009, Carlini et al. 2011, Yosten et al. 2011, Su et al. 2012, Salvatori et al. 2014). Immunoreactivity studies have demonstrated that NST and SST co-localized in a variety of cell types, including hypothalamic neurons and pancreatic cells (Samson et al. 2008, Dun et al. 2010). However, measurement of SST and NST in the same samples indicated variations in the ratio of both peptides in different tissues, suggesting differential processing of these two peptides from the same precursor (Samson et al. 2008). Although it is clear that the actions of SST are mediated through activation of the SST receptor subtypes (sst1–sst5) (Ben-Shlomo & Melmed 2010, Vazquez-Borrego et al. 2017), it has been reported that NST failed to activate any of the sst-subtypes in an in vitro system (Samson et al. 2008), suggesting that NST and SST might exert different functions, or that the associated activities might be independent from each other. In fact, evidence indicating that NST acts through the G-protein-coupled receptor 107 (GPCR107) to exert some of its functions (Yosten et al. 2012, Elrick et al. 2016) is available.
Irrespective of the receptors involved, NST has been shown to regulate metabolic function at the central (i.e. acting as a neuropeptide in the cerebellum and hypothalamus) and the peripheral levels (i.e. heart, pancreas, gastrointestinal tract, etc.), including regulation of neuronal migration, hypothalamic neuron firing, modulation of food/water intake and blood pressure (Samson et al. 2008, Hua et al. 2009, Dun et al. 2010, Carlini et al. 2011, Yosten et al. 2011, Su et al. 2012, Salvatori et al. 2014). In fact, some of the actions of NST are common to SST (Samson et al. 2008, Hua et al. 2009). In spite of the genetic and putative functional link between NST and SST, the actions of NST on pituitary function, also known as the ‘master gland’ of the body, has not been explored in detail despite the fact that SST was originally identified based on its ability to suppress the secretion of growth hormone (GH) and subsequent studies have shown that SST also suppresses the secretion of other pituitary hormones (Brazeau et al. 1973, Eigler & Ben-Shlomo 2014, Vazquez-Borrego et al. 2017). In addition, NST induces c-Fos expression in the pituitary (Samson et al. 2008) and is expressed in the arcuate nucleus of the hypothalamus which represents an important site for the control of the function of different pituitary cell types (Dun et al. 2010). Based on these associations, the current study sought to explore for the first time the direct effects of NST on pituitary function using primary pituitary cell cultures from baboons (Papio anubis), a species that closely models human physiology (McClure 1984, Comuzzie et al. 2003).
Specifically, in this study, we compared the direct effects of NST to SST on the pituitary hormone (GH, prolactin (PRL), follicle-stimulating hormone (FSH), luteinizing hormone (LH), adrenocorticotropic hormone (ACTH) and thyroid-stimulating hormone (TSH)) release and expression. In addition, to better understand the mechanisms behind these actions, we used pharmacological inhibitors to various intracellular signaling pathways previously shown to be important in the actions of SST (adenylyl cyclase (AC), protein kinase A (PKA), phospholipase C (PLC), protein kinase C (PKC), extracellular Ca2+ L-type channels, intracellular Ca2+ channels, mitogen-activated protein kinases (MAPK), mammalian target of rapamycin (mTOR) and phosphatidylinositol-3-kinase (PI3K)). Finally, we evaluated the impact of NST and SST on the expression of key receptors and transcriptional factors involved in the normal functioning of the pituitary cell types.
Materials and methods
Reagents
All the material (reagents, peptides, inhibitors of signaling pathways, etc.) used in this study were purchased from Sigma-Aldrich unless otherwise specified. Human amidated NST-19 (Ala-Pro-Ser-Asp-Pro-Arg-Leu-Arg-Gln-Phe-Leu-Gln-Lys-Ser-Leu-Ala-Ala-Ala-Ala-NH2) and SST-14 (SST; Ala-Gly-Cys-Lys-Asn-Phe-Phe-Trp-Lys-Thr-Phe-Thr-Ser-Cys; with a disulfide bridge: Cys3–Cys14) were purchased from Phoenix Pharmaceuticals (Burlingame, CA, USA). α-Minimum essential media, HEPES, horse serum and penicillin–streptomycin were obtained from Invitrogen. U73122 was purchased from Cayman Chemical.
Animals and tissue collection
Primate (olive baboon; Papio anubis; n = 5, 8–10 years of age; 15.0–31.8 kg of weight) pituitaries and hypothalami were obtained from randomly cyclic control females from a breeding colony at the University of Illinois at Chicago within 15 min after sodium pentobarbital overdose as previously reported (Cordoba-Chacon et al. 2012a , Sarmento-Cabral et al. 2017). All animals in which tissues were taken were covered by protocols approved by the University of Illinois at Chicago Institutional Animal Care and Use Committee. Hypothalami were immediately frozen in liquid nitrogen and stored at −80°C until extraction for total RNA (see the 'RNA isolation, reverse-transcription and qrtPCR of baboon transcripts' section below). Pituitaries were placed in sterile cold (4°C) α-MEM (media supplemented with 0.15% BSA, 6 nM HEPES, 10 IU/mL penicillin and 10 µg/mL streptomycin). Then, the pars distalis of the pituitary was isolated, washed twice in fresh media and cut into small pieces (~20–40 mg) with surgical blades under sterile conditions. One fragment of the pituitary was rapidly frozen in liquid nitrogen and stored at −80°C until extraction for total RNA (see the 'RNA isolation, reverse-transcription and qrtPCR of baboon transcripts' section below), while the remaining pieces of the pituitary were transported to the laboratory in sterile cold α-MEM, minced into 1–2 mm3 pieces under sterile conditions and then, incubated in 30-mL S-MEM medium complemented with 0.3% trypsin (Becton, Dickinson and Company, Sparks, MD, USA) in a spinner flask (Bellco Glass, Vineland, NJ, USA) for 2 h at 37°C under gentle shaking to obtain dispersed single cells for culture (see the 'Primary pituitary cell cultures' section below), as previously reported (Luque et al. 2006, Kineman & Luque 2007). To avoid fibroblast contamination, suspensions of dispersed pituitary cells were filtered through a nylon gauze of 130-µM-mesh, and cultured in media with d-valine (replaced for l-valine) to selectively inhibit fibroblast proliferation/overgrowth. In addition, visual inspection of primary cell cultures at the time of experimental assays showed no sign of cells displaying the typical fibroblast-like morphology.
Primary pituitary cell cultures
Single cells (50,000–200,000 cells/well) were plated onto 48- or 24-well plates in media containing 10% fetal horse serum. After 36-h incubation (37°C), media were removed and cells pre-incubated for 1 h with fresh, warm, serum-free media alone to stabilize basal hormone secretion. After this pre-incubation period, cells were incubated with serum-free media containing the following treatments: (1) NST alone (0.01–10 nM; dose–response experiment; 4 h incubation); (2) NST alone (10 nM) for 30 min, 4, 12 and 24 h (time course experiment); (3) NST or SST alone (10 nM) for 4 h and 24 h (experiment for the comparison between the two somatostatin gene-encoded peptides); (4) NST or SST alone (10 nM) or in combination with acylated-ghrelin (10 nM) or gonadotropin-releasing hormone (GnRH, 10 nM) for 4 h.
In order to study and compare the intracellular signaling pathways involved in the NST- and SST-mediated actions on GH and LH release, serum-free media containing inhibitors of different intracellular signaling pathways (AC (MDL-12330A; 10 µM), PKA (H89; 15 µM), PLC (U73122; 50 µM), PKC (Go6983; 20 μm), extracellular Ca2+ L-type channels (nifedipine; 1 µM), intracellular Ca2+ channels (thapsigargin; 10 µM), MAPK (PD-98059; 10 μm), mTOR (rapamycin; 10 nm) and PI3K (wortmannin; 1 μm)) were incubated for 90 min after the 1-h pre-incubation period with serum-free media, and then, the media were replaced with media with the specific inhibitor alone (vehicle) or media with the inhibitor containing NST or SST (10 nM) and incubated for an additional 4 h. Additional controls consisted of serum-free media alone or media with NST or SST (in all cases without inhibitors). Doses for acylated-ghrelin, SST, GnRH or inhibitors of intracellular signaling pathways were selected based on previous studies (Kineman & Luque 2007, Cordoba-Chacon et al. 2011, 2012b , Luque et al. 2011).
At the end of the corresponding incubation periods with the different treatments, media were collected for hormone analysis using commercial ELISAs (see the 'Hormone release analysis' section below) and, in selected cases, cells were processed for total RNA recovery and assessment of mRNA levels by quantitative real-time PCR (qPCR; see the 'RNA isolation, reverse-transcription and qrtPCR of baboon transcripts' section below).
Hormone release analysis
GH, PRL, ACTH, LH, FSH and TSH hormone concentrations in the culture media were measured using human commercial ELISAs (human: GH, PRL, ACTH, LH, FSH and TSH (reference numbers: EIA-1787, EIA-1291, EIA-3647, EIA-1289, EIA-1288 and EIA-1790, respectively; DRG, Mountainside, NJ, USA)). All the assays were performed following the manufacturer’s instructions where the information regarding specificity, detectability and reproducibility for each of the assays can be accessed at the websites of the indicated company.
RNA isolation, reverse-transcription and qrtPCR of baboon transcripts
Tissues (pituitary and hypothalamus) and pituitary cell cultures from baboons were processed for recovery of total RNA and the subsequent quantification of the amount of RNA recovered using kits and methods previously described (Sarmento-Cabral et al. 2017). Briefly, total RNA was reverse-transcribed in a 20-µL volume using random-hexamer primers and the cDNA First Strand Synthesis kit (MRI Fermentas, Hannover, MD, USA). cDNAs were amplified by qrtPCR using a Stratagene Mx3000p real-time PCR machine and the brilliant SYBR Green QPCR Master Mix (Stratagene). To estimate mRNA copy number, samples were run against specific synthetic standards (1–106 copies of synthetic cDNA template for each transcript of interest) run on the same plate. Details regarding the development, validation and application of a qrtPCR to measure expression levels of baboon transcripts, including cyclophilin-A (used as a housekeeping gene), have been reported previously (Luque et al. 2006, Kineman & Luque 2007). Specific sets of primer sequences used in this study have been previously reported (Luque et al. 2006, 2011, Cordoba-Chacon et al. 2012a ). New baboon primer sequences were used in the present study to amplify baboon sst3 (sense: CCAGCCCTTCAGTCACCA; antisense: CCGAAGGGCCAGTAAGACA; product size: 115 bp; accession number: EU156181.1), sst4 (sense: TCTTTGTGCTCTGCTGGATG; antisense: AACCATAGAGTACGGGGTTGG; product size: 138 bp; accession number: EU156182.1) and GPCR107 (sense: GCATCAGCAACAGATGGAAA; antisense: GGAACAGCGAGTTTGAGGAG; product size: 131 bp; accession number: XM_003911188.4). To control for variations in the amount of RNA used in the RT reaction and the efficiency of the RT reaction, mRNA copy numbers of the baboon transcripts analyzed were adjusted by cyclophilin-A expression, where baboon cyclophilin-A mRNA levels did not significantly vary between experimental groups (data not shown).
Statistical analysis
Samples from all groups within an experiment were processed at the same time. To normalize values within each treatment and minimize intragroup variations in the different experiments (i.e. different age of the tissue donor, stage of the estrus cycle and/or to the metabolic environment, etc.), the values obtained were compared with vehicle-treated control cultures (set at 100%), where this style of data presentation does not alter the relative differences between NST- or SST-treated and vehicle-treated groups. Results were obtained from at least three separate independent experiments carried out on different days and with different cell preparations (3–4 replicate culture wells/treatment/experiment). Differences between groups were assessed by one-way ANOVA (or two-way ANOVA when the intracellular signaling pathways, with treatments with and without (controls) specific inhibitors, were studied) followed by a Newman–Keuls test for multiple comparisons. P ≤ 0.05 was considered significant. All data are expressed as means ± s.e. All statistical analyses were performed using the GB-STAT software package (Dynamic Microsystems, Silver Spring, MD, USA).
Results
Direct effect of NST on pituitary hormone release
Incubation of cultured baboon pituitary cells with increasing doses of NST for 4 h revealed clear inhibitory effects on GH and LH release in a concentration-dependent manner (at doses equal to or above 10−9 M for GH and 10−7 M for LH; Fig. 1). Conversely, NST failed to alter basal PRL, ACTH, FSH or TSH release at all the doses tested (Fig. 1). Based on these results, the dose of NST that caused a maximal decrease of both GH and LH release, 10−7 M, was chosen to further analyze the action of the peptide on baboon pituitary function.
Direct effect of neuronostatin (NST) on baboon pituitary hormone secretion. Dose response (4 h) of NST (dose between 10−7 M and 10−11 M; white columns) on the secretion of baboon GH, PRL, ACTH, FSH, LH and FSH. Data are expressed as percent of control (set at 100%; black columns) and represent the mean ± s.e.m. (n = 4 individual experiments, 3–4 wells/experiment). Values that do not share a common letter (a, b, c) are statistically different.
Citation: Journal of Endocrinology 237, 3; 10.1530/JOE-18-0135
Interestingly, treatment with 10−7 M NST, for different incubation times (30 min, 4, 12 and 24 h), revealed an inhibitory effect on both GH and LH, but not PRL, ACTH, FSH or TSH, release between 4 h and 12 h, whereas hormone release was not impacted after short-term (30 min) or long-term (24 h) incubation (Fig. 2).
Time-dependent effect of neuronostatin (NST; 10−7 M; 30 min, 4, 12, and 24 h; white columns) on the secretion of baboon GH, PRL, ACTH, FSH, LH and FSH. Data are expressed as percent of control (set at 100% at 30 min of incubation; black columns) and represent the mean ± s.e.m. (n = 4 individual experiments, 3–4 wells/experiment). Values that do not share a common letter (a, b and c) are statistically different in the vehicle-treated controls at different times. Asterisks indicate values of the NST-treated groups at different times of incubation that significantly differ from their respective vehicle-treated control values (*P < 0.05).
Citation: Journal of Endocrinology 237, 3; 10.1530/JOE-18-0135
Comparison between the effects of NST and SST on pituitary hormone expression and release
In a separate experiment, we confirmed that NST treatment (10−7 M) was able to significantly reduce GH and LH secretion at 4 h, but not at 24 h (Fig. 3A), without impacting the release of other pituitary hormones or altering gene expression (GH, PRL, pro-opiomelanocortin (POMC, the precursor of ACTH), FSH, LH or TSH) (Fig. 3B). In this set of studies, we compared these actions to SST at the same dose (10−7 M) and found that SST was able to significantly reduce GH, PRL, ACTH and LH secretion at both 4 h and 24 h, as well as TSH release at 4 h, but not at 24 h, of incubation (Fig. 3A). Interestingly, the inhibitory effect of SST on basal GH, but not LH, release was significantly higher than that exerted by NST at 4 h (Fig. 3A). Moreover, SST treatment was also able to significantly reduce GH, PRL, POMC and LH, but not FSH or TSH, expression at 24 h of incubation (Fig. 3B).
Comparison between direct effect of 4-h and 24-h treatment of neuronostatin (NST; 10−7 M; white columns) and somatostatin (SST; 10−7 M; grey columns) on the secretion of baboon GH, PRL, ACTH, FSH, LH and FSH (A) and, on the expression of GH, PRL, POMC, FSH, LH, FSH and pituitary transcription factor-1 (Pit-1) (B) in primary pituitary cell cultures from baboons. Values are expressed as percentage of controls (4 h or 24 h, set at 100% within each experiment; black columns), and represent the mean ± s.e.m. of four independent experiments (three to four wells/experiment). Values that do not share a common letter (a, b, c, d) differ significantly (P < 0.05).
Citation: Journal of Endocrinology 237, 3; 10.1530/JOE-18-0135
It should be mentioned that the inhibitory effect of NST or SST on somatotrope function (or on lactotrope function by SST) does not seem to be mediated by a reduction in pituitary transcription factor-1 (Pit-1) mRNA production (a critical factor for normal development and function of somatotrope and lactotrope cells (Andersen & Rosenfeld 2001); Fig. 3B).
Interaction of NST or SST with key regulators of GH and LH secretion: ghrelin and GnRH in a non-human primate model
We next tested the direct effects of 4 h of incubation with NST or SST alone or in combination with a primary stimulatory factor of somatotrope (i.e. ghrelin (Kineman & Luque 2007)) or gonadotrope (i.e. GnRH (Luque et al. 2011)) function (Fig. 4). Specifically, we found that treatments with NST or SST alone inhibited GH and LH release, whereas ghrelin or GnRH alone stimulated GH or LH release in primary pituitary cell cultures, respectively (Fig. 4). The stimulatory effects of ghrelin on GH and of GnRH on LH secretion were fully blocked by the co-administration with SST, but not with NST (Fig. 4). Interestingly, we found that NST augmented the inhibitory action of SST on ghrelin-stimulated GH release (Fig. 4; left panel), while it did not impact the actions of SST on GnRH-stimulated LH release (Fig. 4; right panel).
Interaction of neuronostatin (NST; 10−7 M) and/or somatostatin (SST; 10−7 M) and the main stimulatory regulator of somatotrope and gonadotrope function (ghrelin and gonadotrophin-releasing hormone (GnRH), respectively) in primary pituitary cell cultures from baboons. Effect of 4-h treatment of NST or SST and/or ghrelin (10 nM) on GH secretion and, of NST or SST and/or GnRH (10 nM) on LH secretion. Values are expressed as percentage of controls, set at 100% within each experiment, and represent the mean ± s.e.m. of three independent experiments (three to four wells/experiment). Values that do not share a common letter (a, b, c, d) differ significantly (P < 0.05).
Citation: Journal of Endocrinology 237, 3; 10.1530/JOE-18-0135
Intracellular signaling pathways involved in NST- and SST-mediated GH and LH release in a non-human primate model
The use of pharmacological inhibitors indicates that NST and SST inhibit GH and LH release through almost identical signaling pathways (Fig. 5A and B, respectively). Given the limited source of baboon cell preparations, we were able to study only some selected signaling routes. Specifically, administration of these inhibitors alone did not modify basal GH or LH release (Fig. 5A or B, respectively; control-columns). Our results indicate that the inhibitory effect of NST and SST on GH and LH release is mediated through AC/PKA, MAPK and extra-/intracellular Ca2+ influx because incubation with specific blockers of these routes, but not with PLC/PKC or mTOR inhibitors, completely blocked the inhibitory effect of NST on GH and LH secretion (Fig. 5A or B, respectively; NST and SST columns). Interestingly, blockade of PI3K activity completely abolished the inhibitory effect of SST, but not of NST, on GH secretion (Fig. 5A).
Intracellular signaling pathways of neuronostatin (NST)- and somatostatin (SST)-inhibited baboon GH and LH secretion. Effect of the inhibition of AC (MDL-12330A; 10 μM), protein kinase A (H89; 15 μM), PLC (U73122; 50 μM), protein kinase C (Go6983; 20 μM), extracellular Ca2+ L-type channels (nifedipine; 1 μM), intracellular Ca2+ channels (thapsigargin; 10 μM), MAPK (PD-98059; 10 μM), mTOR (rapamycin; 10 nM) and PI3K (wortmannin; 1 μM) on NST- and SST-inhibited GH (A) and LH (B) secretion. On the day of the experiment, inhibitors were added to the incubation media 90 min before NST or SST treatment (4 h; 10−7 M). Values are expressed as percentage of vehicle-treated controls without inhibitor (set at 100%) within each experiment, and represent the mean ± s.e.m. of four independent experiments (three to four wells/treatment per experiment). Values that do not share a common letter (a, b, c) significantly differ (P < 0.05).
Citation: Journal of Endocrinology 237, 3; 10.1530/JOE-18-0135
Presence of receptors for NST and SST in the pituitary, and homologous and heterologous regulation of these receptors
GPCR107 was highly expressed in baboon pituitaries (Fig. 6A), and this expression was higher than that found in the hypothalamus (where NST has been previously shown to be highly produced and to exert relevant functions (Samson et al. 2008)). Interestingly, we also found that the expression level of GPCR107 in pituitaries from female baboons was remarkably higher than that of the various sst-subtypes (sst1–5; Table 1). The relevant expression levels of the sst-subtypes shown in this study are consistent with previous reports in baboon and human (sst5 > sst2 > sst1 > sst3 > sst4; (Neto et al. 2009, Cordoba-Chacon et al. 2012b )) (Table 1).
Presence and regulation of the expression of key pituitary receptors for the regulation of somatotrope and gonadotrope function. (A) Presence of GPCR107 (absolute mRNA copy numbers) in the pituitary (PIT; white column) and hypothalamus (HPT; black column) of baboons, as determined by quantitative rtRT-PCR. (B) Effects of neuronostatin (NST; 10−7 M; white columns) and somatostatin (SST; 10−7 M; grey columns) treatment on the expression of pituitary receptors for SST (sst1–sst5), NST (GPCR107), GHRH (GHRH-R), ghrelin (GHS-R) and Kiss1 (Kiss1-R) in primary pituitary cell cultures from baboons after 4 h of treatment. Data are expressed as absolute mRNA copy numbers per 0.05 μg total RNA in the whole pituitary of female baboons ((A); n = 5), or as percentage of vehicle-treated controls ((B); set at 100%; black columns) in primary pituitary cell cultures from baboons and represent the mean ± s.e.m. (n = 4 individual experiments; 3–4 wells/experiment). Asterisks indicate values that significantly differ from their respective control values (**P ≤ 0.01).
Citation: Journal of Endocrinology 237, 3; 10.1530/JOE-18-0135
Presence of somatostatin receptor subtypes, as well as GPCR107, in the baboon pituitary.
| Pituitary | |
|---|---|
| sst1 | 1424 ± 256 |
| sst2 | 4373 ± 301 |
| sst3 | 1318 ± 343 |
| sst4 | 56 ± 12 |
| sst5 | 6045 ± 589 |
| GPCR107 | 21,260 ± 2753 |
| Cyclophilin-A | 125,936 ± 9842 |
Absolute mRNA copy number per 0.05 μg total RNA of gene transcripts in the whole pituitary of female baboons, as determined by quantitative rtRT-PCR. Values represent means ± s.e.m. (from 5 separate whole pituitary extracts).
To confirm that primary pituitary cells of baboons maintain a differentiated phenotype after dispersion and culture, absolute mRNA levels (copy numbers per 0.05 µg total RNA) of NST and SST receptors and cyclophilin-A were compared between whole-tissue extracts (in vivo conditions; Table 1) and extracts prepared from pituitary cell cultures (in vitro conditions; 4 h after incubation in serum-free medium). Results indicated that transcript levels did not vary significantly between in vivo and in vitro samples (data not shown), indicating that the cell preparation and culture conditions did not impact the expression of pituitary receptors for NST or SST, which support that the culture system used allows for the maintenance of correct functions of the different pituitary cell types.
As previously reported (Cordoba-Chacon et al. 2012a ), we observed that 4 h of incubation with SST (10−7 M) markedly increased the expression of sst1, sst2 and sst5 in baboon pituitary cultures (Fig. 6B; left panel). Moreover, this is the first report showing that the expression of sst3 was also elevated in response to SST treatment in primary pituitary cell cultures from baboons (Fig. 6B, left panel). In contrast, SST did not alter the expression of GPCR107, GH-releasing hormone receptor (GHRH-R), ghrelin receptor (GHS-R) or kisspeptin-1 receptor (Kiss1-R) (Fig. 6B, left/right panels). Interestingly, NST treatment (10−7 M; 4 h of incubation) increased the expression of its own putative receptor (GPCR107; Fig. 6B, left panel), but decreased GHS-R and Kiss1-R expression, without impacting GHRH-R expression (Fig. 6B, right panel).
Discussion
NST, a recently discovered amidated peptide encoded by the somatostatin gene, has been shown to exert diverse activities at the central and peripheral level (Samson et al. 2008, Hua et al. 2009, Carlini et al. 2011, Yosten et al. 2011, Su et al. 2012, Salvatori et al. 2014). However, information about the direct role that NST exerts at the level of the pituitary gland, a true sensor of whole body function integrating central and peripheral signals and often referred to as the ‘master endocrine gland’, is quite limited. Specifically, to the best of our knowledge, the effect of NST at the pituitary level has been only derived from a single series of studies showing that treatment with NST increased c-fos immunoreactivity in rat pituitaries, but NST did not impact GH, PRL, ACTH or LH release from primary rat pituitary cell cultures after a short period of incubation (30 min) (Samson et al. 2008). Therefore, the question remains: can NST directly regulate pituitary function (basal and stimulated hormone release and hormone gene expression) if applied for longer periods and at different doses? To address this question, in the current study, we examined whether NST could directly impact hormone release/expression in primary pituitary cell cultures from normal baboons (Papio anubis), a primate model that closely models human physiology and is therefore of interest for translational medicine (McClure 1984, Comuzzie et al. 2003).
Our current findings are the first to show that NST inhibits somatotrope and gonadotrope function. Specifically, we showed that NST acts selectively to suppress basal GH and LH release, without altering GH and LH gene expression, whereas these selected effects differ from the broad inhibitory effects of SST on basal and stimulated pituitary hormone release and synthesis, as shown by our current studies and as previously reported (Weeke et al. 1975, Wildt et al. 1981, Cordoba-Chacon et al. 2011, 2012b , Luque et al. 2014, Sarmento-Cabral et al. 2017). It should be noted that although some reports (Yu et al. 1997, Milosevic et al. 2004), including the current study, show that SST has no effect on FSH release and synthesis, other reports have shown that SST is able to inhibit FSH (Evans 1999). In this sense, although LH and FSH are known to be co-stored in a subpopulation of bihormonal gonadotropes and are often co-regulated and released in response to different factors (Evans 1999), previous studies in non-human primate models have demonstrated that FSH secretion can follow a markedly different pattern from that of LH (Wildt et al. 1981), as it has been observed in the current study.
To the best of our knowledge, this is the first report studying, in a cell culture system, the direct interaction between SST and NST, and also the interaction of NST and/or SST with other primary regulators of pituitary function. We found that SST, but not NST, blocked ghrelin-stimulated GH release and GnRH-stimulated LH release, which is consistent with previous studies reported with SST (Kineman & Luque 2007, Cordoba-Chacon et al. 2011, 2012b , Luque et al. 2011), and with the only report published to date indicating that neither ghrelin-stimulated GH release nor GnRH-stimulated LH release was affected by NST treatment in rats cultured anterior pituitary cells (Samson et al. 2008). Interestingly, NST was able to augment the inhibitory effect of SST on ghrelin-stimulated GH, but GnRH-stimulated LH release. Therefore, our data are the first to provide evidence that NST might act together with SST to fine-tune somatotrope function. These results are novel and, although the mechanisms and physiologic relevance behind these actions remain unknown, set the stage for future investigations.
Our report also demonstrates for the first time that the actions of NST are mediated by AC/PKA, MAPK and extra-/intracellular Ca2+ mobilization, a complex set of second messenger pathways which almost parallels that found to be mediated by SST. We also confirm previous reports (Cordoba-Chacon et al. 2012b ), that activation of AC and MAPK pathways is required by SST to exert its action on GH release. Interestingly, we also found that the inhibitory actions of SST, but not NST, on GH secretion also require PI3K signaling which might suggest that activation of this pathway by SST could be important in mediating some of the unique actions associated to SST (not shared with NST).
Taken together, these results strongly indicate that the mechanism of action of NST clearly differs from SST at the pituitary. This differential effect may be related to the fact that SST is a cyclic, non-amidated peptide, and NST is a non-cyclic, amidated peptide. In fact, the presence or absence of amidation enzymes or degrading enzymes could dictate the expression levels and activity of NST and SST in a tissue-specific fashion (Samson et al. 2008). Indeed, the amidation process of NST seems to be essential to exert some of its physiological actions, including its influence in gastric emptying and gastrointestinal transit, hypertension activity, antinociceptive effect and depressive behavior (Yang et al. 2011a , b , Yosten et al. 2011, Su et al. 2012). In addition, differential effects of NST vs SST on pituitary function are likely mediated by different receptors. Specifically, SST exerts its inhibitory effects on pituitary function via somatostatin receptor subtypes sst1–5 (Samson et al. 2008, Ben-Shlomo & Melmed 2010, Vazquez-Borrego et al. 2017). However, it was previously reported that NST failed to activate sst1–5 in an in vitro experimental system (Samson et al. 2008), but could interact and be functionally connected with the orphan receptor GPCR107 (Yosten et al. 2012, Elrick et al. 2016). Importantly, we found that GPCR107 is highly expressed in the baboon pituitary (mRNA levels greater than those for all sst-subtypes) and pituitary GPCR107 expression (but not sst1–5 expression) is increased by NST treatment, where ligand-mediated upregulation of canonical receptors has been observed for other pituitary regulatory peptides (i.e. SST/sst1–5 (Luque et al. 2004a , Cordoba-Chacon et al. 2012a ), and as occurs in the present study; GHRH/GHRH-R and ghrelin/GHS-R (Luque et al. 2004b , Cordoba-Chacon et al. 2012a ). In fact, upregulation of GPCR107 in response to NST treatment was also observed in pancreatic cell cultures (Elrick et al. 2016). Noteworthy is the observation that NST, but not SST, exerted a heterologous regulation on the expression of key receptors for somatotrope (GHS-R) and gonadotrope (Kiss1-R) function. These results may be (patho)physiologically relevant in humans in that we have previously shown that the hormonal/clinical control of patients with different endocrine pathologies (i.e. pituitary adenomas, neuroendocrine and thyroid tumors, etc.) that are treated with SST analogues is directly associated with the amount of and ratio between the expression of pituitary sst-subtypes (Taboada et al. 2007, Puig-Domingo et al. 2014, Luque et al. 2015, Sampedro-Nunez et al. 2016). Most importantly, this report demonstrated for the first time that NST inhibited basal GH and LH release and that NST augmented the inhibitory action of SST on basal GH release which provide a potentially useful tool to develop new therapeutic targets to treat patients with pituitary tumors (i.e. combination of SSAs with NST or NST-analogues). In any case, our current data further extend those original observations, suggesting that the physiological actions of NST might include a pituitary site of action as well. In fact, based on the results of the present study as well as on previous results demonstrating that the actions of multiple peptides acting at the pituitary level are similar when tested in vivo and in vitro (Brazeau et al. 1973, Cordoba-Chacon et al. 2011, Kineman & Luque 2007, Luque et al. 2014, Vazquez-Borrego et al. 2017), it is tempting to speculate that NST would exert its pituitary actions on selected pituitary cell types through different, at least partially dissimilar, mechanisms and/or signaling pathways than those involved in the effects of SST.
Summary
This study supplies the first evidence that NST can directly control pituitary function. The actions of NST are distinct from its older sibling peptide, SST, in that the inhibitory actions of NST are isolated to inhibition of basal GH and LH release, whereas SST has a more broad impact on basal and stimulated pituitary hormone release and gene expression. These actions of NST may be exerted via GPCR107, based on the previous reports (Yosten et al. 2012, Elrick et al. 2016), as well as on the current finding that GPCR107 is highly expressed in the primate pituitary and is regulated by NST. Although NST and SST may signal through different receptors to suppress GH and LH release, the downstream intracellular signals required for these actions may be in large part mediated via AC/PKA, MAPK and extra-/intracellular Ca2+ mobilization. Given these effects on NST were observed in a primate model, that could be readily translated to human patho(physiology), these results lay a solid foundation to pursue question related to the importance of NST on somatotrope and gonadotrope development and adult function and if alterations in NST production or signaling play a significant role in control of hormone release from pituitary adenomas.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was funded by the following grants: Junta de Andalucía (CTS-1406, BIO-0139, to R M L), Instituto de Salud Carlos III, co-funded by European Union (ERDF/ESF, ‘Investing in your future’) (PI16/00264, to R M L), CIBERobn (to R M L), Department of Veterans Affairs, Office of Research and Development Merit Award BX001114 (to R D K). Ciber is an initiative of Instituto de Salud Carlos III, Ministerio de Sanidad, Servicios Sociales e Igualdad, Spain.
Acknowledgements
The authors would like to thank the veterinarian staff of the University of Illinois at Chicago, Biological Resource Center, for its invaluable help, and give special thanks to Lisa Halliday.
References
Andersen B & Rosenfeld MG 2001 POU domain factors in the neuroendocrine system: lessons from developmental biology provide insights into human disease. Endocrine Reviews 22 2–35. (https://doi.org/10.1210/edrv.22.1.0421)
Ben-Shlomo A & Melmed S 2010 Pituitary somatostatin receptor signaling. Trends in Endocrinology and Metabolism 21 123–133. (https://doi.org/10.1016/j.tem.2009.12.003)
Brazeau P, Vale W, Burgus R, Ling N, Butcher M, Rivier J & Guillemin R 1973 Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone. Science 179 77–79.
Carlini VP, Ghersi M, Gabach L, Schioth HB, Perez MF, Ramirez OA, Fiol de Cuneo M & de Barioglio SR 2011 Hippocampal effects of neuronostatin on memory, anxiety-like behavior and food intake in rats. Neuroscience 197 145–152. (https://doi.org/10.1016/j.neuroscience.2011.09.040)
Comuzzie AG, Cole SA, Martin L, Carey KD, Mahaney MC, Blangero J & VandeBerg JL 2003 The baboon as a nonhuman primate model for the study of the genetics of obesity. Obesity Research 11 75–80. (https://doi.org/10.1038/oby.2003.12)
Cordoba-Chacon J, Gahete MD, Pozo-Salas AI, Martinez-Fuentes AJ, de Lecea L, Gracia-Navarro F, Kineman RD, Castano JP & Luque RM 2011 Cortistatin is not a somatostatin analogue but stimulates prolactin release and inhibits GH and ACTH in a gender-dependent fashion: potential role of ghrelin. Endocrinology 152 4800–4812. (https://doi.org/10.1210/en.2011-1542)
Cordoba-Chacon J, Gahete MD, Castano JP, Kineman RD & Luque RM 2012a Homologous and heterologous in vitro regulation of pituitary receptors for somatostatin, growth hormone (GH)-releasing hormone, and ghrelin in a nonhuman primate (Papio anubis). Endocrinology 153 264–272. (https://doi.org/10.1210/en.2011-1677)
Cordoba-Chacon J, Gahete MD, Culler MD, Castano JP, Kineman RD & Luque RM 2012b Somatostatin dramatically stimulates growth hormone release from primate somatotrophs acting at low doses via somatostatin receptor 5 and cyclic AMP. Journal of Neuroendocrinology 24 453–463. (https://doi.org/10.1111/j.1365-2826.2011.02261.x)
Dun SL, Brailoiu GC, Tica AA, Yang J, Chang JK, Brailoiu E & Dun NJ 2010 Neuronostatin is co-expressed with somatostatin and mobilizes calcium in cultured rat hypothalamic neurons. Neuroscience 166 455–463. (https://doi.org/10.1016/j.neuroscience.2009.12.059)
Eigler T & Ben-Shlomo A 2014 Somatostatin system: molecular mechanisms regulating anterior pituitary hormones. Journal of Molecular Endocrinology 53 R1–R19. (https://doi.org/10.1530/JME-14-0034)
Elrick MM, Samson WK, Corbett JA, Salvatori AS, Stein LM, Kolar GR, Naatz A & Yosten GLC 2016 Neuronostatin acts via GPR107 to increase cAMP-independent PKA phosphorylation and proglucagon mRNA accumulation in pancreatic alpha-cells. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 310 R143–R155. (https://doi.org/10.1152/ajpregu.00369.2014)
Evans JJ 1999 Modulation of gonadotropin levels by peptides acting at the anterior pituitary gland. Endocrine Reviews 20 46–67. (https://doi.org/10.1210/edrv.20.1.0355)
Hua Y, Ma H, Samson WK & Ren J 2009 Neuronostatin inhibits cardiac contractile function via a protein kinase A- and JNK-dependent mechanism in murine hearts. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 297 R682–R689. (https://doi.org/10.1152/ajpregu.00196.2009)
Kineman RD & Luque RM 2007 Evidence that ghrelin is as potent as growth hormone (GH)-releasing hormone (GHRH) in releasing GH from primary pituitary cell cultures of a nonhuman primate (Papio anubis), acting through intracellular signaling pathways distinct from GHRH. Endocrinology 148 4440–4449. (https://doi.org/10.1210/en.2007-0441)
Luque RM, Park S, Peng X-D, Delgado E, Gracia-Navarro F, Kineman RD, Malagon MM & Castano JP 2004a Homologous and heterologous in vitro regulation of pig pituitary somatostatin receptor subtypes, sst1, sst2 and sst5 mRNA. Journal of Molecular Endocrinology 32 437–448. (https://doi.org/10.1677/jme.0.0320437)
Luque RM, Kineman RD, Park S, Peng X-D, Gracia-Navarro F, Castano JP & Malagon MM 2004b Homologous and heterologous regulation of pituitary receptors for ghrelin and growth hormone-releasing hormone. Endocrinology 145 3182–3189. (https://doi.org/10.1210/en.2003-1626)
Luque RM, Gahete MD, Valentine RJ & Kineman RD 2006 Examination of the direct effects of metabolic factors on somatotrope function in a non-human primate model, Papio anubis. Journal of Molecular Endocrinology 37 25–38. (https://doi.org/10.1677/jme.1.02042)
Luque RM, Cordoba-Chacon J, Gahete MD, Navarro VM, Tena-Sempere M, Kineman RD & Castano JP 2011 Kisspeptin regulates gonadotroph and somatotroph function in nonhuman primate pituitary via common and distinct signaling mechanisms. Endocrinology 152 957–966. (https://doi.org/10.1210/en.2010-1142)
Luque RM, Cordoba-Chacon J, Ibanez-Costa A, Gesmundo I, Grande C, Gracia-Navarro F, Tena-Sempere M, Ghigo E, Gahete MD, Granata R, et al.2014 Obestatin plays an opposite role in the regulation of pituitary somatotrope and corticotrope function in female primates and male/female mice. Endocrinology 155 1407–1417. (https://doi.org/10.1210/en.2013-1728)
Luque RM, Ibanez-Costa A, Neto LV, Taboada GF, Hormaechea-Agulla D, Kasuki L, Venegas-Moreno E, Moreno-Carazo A, Galvez MA, Soto-Moreno A, et al.2015 Truncated somatostatin receptor variant sst5TMD4 confers aggressive features (proliferation, invasion and reduced octreotide response) to somatotropinomas. Cancer Letters 359 299–306. (https://doi.org/10.1016/j.canlet.2015.01.037)
McClure HM 1984 Nonhuman primate models for human disease. Advances in Veterinary Science and Comparative Medicine 28 267–304. (https://doi.org/10.1016/B978-0-12-039228-5.50014-0)
Milosevic V, Nestorovic N, Filipovic B, Velkovski S & Startcevic V 2004 Centrally applied somatostatin influences morphology of pituitary FSH cells but not FSH release. General Physiology and Biophysics 23 375–380. (https://doi.org/10.3181/00379727-214-44073)
Neto LV, Machado E de O, Luque RM, Taboada GF, Marcondes JB, Chimelli LMC, Quintella LP, Niemeyer PJ, de Carvalho DP, Kineman RD, et al.2009 Expression analysis of dopamine receptor subtypes in normal human pituitaries, nonfunctioning pituitary adenomas and somatotropinomas, and the association between dopamine and somatostatin receptors with clinical response to octreotide-LAR in acromegaly. Journal of Clinical Endocrinology and Metabolism 94 1931–1937. (https://doi.org/10.1210/jc.2008-1826)
Puig-Domingo M, Luque RM, Reverter JL, Lopez-Sanchez LM, Gahete MD, Culler MD, Diaz-Soto G, Lomena F, Squarcia M, Mate JL, et al.2014 The truncated isoform of somatostatin receptor5 (sst5TMD4) is associated with poorly differentiated thyroid cancer. PLoS ONE 9 e85527. (https://doi.org/10./journal.pone.0085527)
Salvatori AS, Elrick MM, Samson WK, Corbett JA & Yosten GLC 2014 Neuronostatin inhibits glucose-stimulated insulin secretion via direct action on the pancreatic alpha-cell. American Journal of Physiology: Endocrinology and Metabolism 306 E1257–E1263. (https://doi.org/10.1152/ajpendo.00599.2013)
Sampedro-Nunez M, Luque RM, Ramos-Levi AM, Gahete MD, Serrano-Somavilla A, Villa-Osaba A, Adrados M, Ibanez-Costa A, Martin-Perez E, Culler MD, et al.2016 Presence of sst5TMD4, a truncated splice variant of the somatostatin receptor subtype 5, is associated to features of increased aggressiveness in pancreatic neuroendocrine tumors. Oncotarget 7 6593–6608. (https://doi.org/10.18632/oncotarget.6565)
Samson WK, Zhang JV, Avsian-Kretchmer O, Cui K, Yosten GLC, Klein C, Lyu R-M, Wang YX, Chen XQ, Yang J, et al.2008 Neuronostatin encoded by the somatostatin gene regulates neuronal, cardiovascular, and metabolic functions. Journal of Biological Chemistry 283 31949–31959. (https://doi.org/10.1074/jbc.M804784200)
Sarmento-Cabral A, Peinado JR, Halliday LC, Malagon MM, Castano JP, Kineman RD & Luque RM 2017 Adipokines (leptin, adiponectin, resistin) differentially regulate all hormonal cell types in primary anterior pituitary cell cultures from two primate species. Scientific Reports 7 43537. (https://doi.org/10.1038/srep43537)
Su S-F, Yang A-M, Yang S-B, Wang N-B, Lu S-S, Wang H-H & Chen Q 2012 Intracerebroventricular administration of neuronostatin delays gastric emptying and gastrointestinal transit in mice. Peptides 35 31–35. (https://doi.org/10.1016/j.peptides.2012.03.013)
Taboada GF, Luque RM, Bastos W, Guimaraes RFC, Marcondes JB, Chimelli LMC, Fontes R, Mata PJP, Filho PN, Carvalho DP, et al.2007 Quantitative analysis of somatostatin receptor subtype (SSTR1-5) gene expression levels in somatotropinomas and non-functioning pituitary adenomas. European Journal of Endocrinology 156 65–74. (https://doi.org/10.1530/eje.1.02313)
Vazquez-Borrego MC, Gahete MD, Martinez-Fuentes AJ, Fuentes-Fayos AC, Castano JP, Kineman RD & Luque RM 2017 Multiple signaling pathways convey central and peripheral signals to regulate pituitary function: lessons from human and non-human primate models. Molecular and Cellular Endocrinology 463 4–22. (https://doi.org/10.1016/j.mce.2017.12.007)
Weeke J, Hansen AP & Lundaek K 1975 Inhibition by somatostatin of basal levels of serum thyrotropin (TSH) in normal men. Journal of Clinical Endocrinology and Metabolism 41 168–171. (https://doi.org/10.1210/jcem-41-1-168)
Wildt L, Hausler A, Marshall G, Hutchison JS, Plant TM, Belchetz PE & Knobil E 1981 Frequency and amplitude of gonadotropin-releasing hormone stimulation and gonadotropin secretion in the rhesus monkey. Endocrinology 109 376–385. (https://doi.org/10.1210/endo-109-2-376)
Yang A, Ge W, Lu S, Yang S, Su S, Mi Z & Chen Q 2011a Central administration of neuronostatin induces antinociception in mice. Peptides 32 1893–1901. (https://doi.org/10.1016/j.peptides.2011.07.010)
Yang A, Ji Y, Su S, Yang S, Lu S, Mi Z, Yang Q & Chen Q 2011b Intracerebroventricular administration of neuronostatin induces depression-like effect in forced swim test of mice. Peptides 32 1948–1952. (https://doi.org/10.1016/j.peptides.2011.08.012)
Yosten GLC, Pate AT & Samson WK 2011 Neuronostatin acts in brain to biphasically increase mean arterial pressure through sympatho-activation followed by vasopressin secretion: the role of melanocortin receptors. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 300 R1194–R1199. (https://doi.org/10.1152/ajpregu.00849.2010)
Yosten GLC, Redlinger LJ & Samson WK 2012 Evidence for an interaction of neuronostatin with the orphan G protein-coupled receptor, GPR107. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 303 R941–R949. (https://doi.org/10.1152/ajpregu.00336.2012)
Yu WH, Kimura M & McCann SM 1997 Effect of somatostatin on the release of gonadotropins in male rats. Proceedings of the Society for Experimental Biology and Medicine: Society for Experimental Biology and Medicine 214 83–86.
