Abstract
Cold exposure of mice is a common method to stimulate brown adipose tissue (BAT) activity and induce browning of white adipose tissue (WAT) that has beneficial effects on whole-body lipid metabolism, including reduced plasma triglyceride (TG) concentrations. The liver is a key regulatory organ in lipid metabolism as it can take up as well as oxidize fatty acids. The liver can also synthesize, store and secrete TGs in VLDL particles. The effects of cold exposure on murine hepatic lipid metabolism have not been addressed. Here, we report the effects of 24-h exposure to 4°C on parameters of hepatic lipid metabolism of male C57BL/6J mice. Cold exposure increased hepatic TG concentrations by 2-fold (P < 0.05) but reduced hepatic lipogenic gene expression. Hepatic expression of genes encoding proteins involved in cholesterol synthesis and uptake such as the LDL receptor (LDLR) was significantly increased upon cold exposure. Hepatic expression of Cyp7a1 encoding the rate-limiting enzyme in the classical bile acid (BA) synthesis pathway was increased by 4.3-fold (P < 0.05). Hepatic BA concentrations and fecal BA excretion were increased by 2.8- and 1.3-fold, respectively (P < 0.05 for both). VLDL-TG secretion was reduced by approximately 50% after 24 h of cold exposure (P < 0.05). In conclusion, cold exposure has various, likely intertwined effects on the liver that should be taken into account when studying the effects of cold exposure on whole-body metabolism.
Introduction
Two different types of adipose tissues are found in mammals: white adipose tissue (WAT) and brown adipose tissue (BAT). BAT plays an important role in thermogenesis by oxidizing fatty acids in order to generate heat instead of ATP molecules. A crucial player in thermogenesis is uncoupling protein-1 (UCP1), which uncouples ATP synthesis from oxidative phosphorylation. Instead, it redirects protons generated in the latter process directly back across the inner mitochondrial membrane, generating heat (Cannon & Nedergaard 2004, Kajimura et al. 2015). Recently it has become evident that certain WAT depots can gain BAT-like characteristics due to the appearance of brown adipocytes (Wu et al. 2012). Activation of BAT and ‘browning’ of WAT are both considered to increase whole-body energy expenditure, possibly leading to a reduction in body weight, which in turn may have a beneficial effect on obesity-related metabolic disorders such as diabetes mellitus type 2. The most relevant physiological way to activate BAT and induce ‘browning’ of WAT is by exposing animals to cold, resulting in an enhanced activity of the sympathetic nerves innervating BAT and WAT, thereby enhancing expression of proteins involved in thermogenesis and stimulating lipolysis (Himms-Hagen 1972).
Cold exposure in rodents has been shown to have profound effects on whole-body lipid metabolism. In particular, cold exposure lowers plasma triglyceride (TG) concentrations by enhancing lipolytic clearance of VLDL TG by BAT (Bartelt et al. 2011, Khedoe et al. 2015). Recently, it has been shown that cold exposure also affects whole-body cholesterol metabolism, for instance by inducing the reverse cholesterol transport by HDL particles (Bartelt et al. 2017) and by increasing the conversion of cholesterol to bile acids (BAs) (Worthmann et al. 2017).
Of interest, the liver is the main metabolic organ that controls whole-body TG, cholesterol and BA metabolism. With respect to TG homeostasis, the liver is able to take up fatty acids, oxidize fatty acids, synthesize fatty acids and TG de novo, and secrete TG in VLDL particles. Disturbances in the balance between these four pathways can result in an increased hepatic TG concentration (Willebrords et al. 2015). The liver is also crucial in maintaining cholesterol homeostasis since it can take up cholesterol from lipoprotein (remnants) by receptors such as the receptor (LDLR). In addition, the liver can synthesize cholesterol, convert cholesterol into BAs and excrete cholesterol via bile and in VLDL particles.
Despite the evident crucial role of the liver in controlling lipid metabolism, the effect of cold exposure on hepatic lipid metabolism has sparsely been addressed. Here, we report the effects of exposure to 4°C on various aspects of hepatic lipid metabolism in male mice.
Materials and methods
Animals
For the short-term cold exposure experiments, male C57Bl/6J mice were obtained from Charles River Laboratories at the age of 8 weeks and were acclimatized for 1 week under standard housing conditions before entering an experimental set-up. For the long-term cold exposure experiments, purebred 3- to 4-month old male C57Bl/6J mice were used that were obtained by in-house breeding. All animal experiments were performed with the approval of the Animal Ethics Committees of the Erasmus MC, Rotterdam, the Netherlands, or the Wageningen University, the Netherlands.
Cold exposure experiments
For the short-term cold exposure experiments, mice were individually housed in a temperature-controlled climate chamber (Bronson, Nieuwkuijk, the Netherlands) with a normal light/dark cycle at 23°C or 4°C for 24 h. At the end of this period, mice were terminated by cardiac puncture under isoflurane anesthesia between 13:00 h and 15:00 h and blood and various tissues were collected and snap-frozen in liquid nitrogen or fixed in 4% paraformaldehyde. Feces was collected during the 24-h period.
For the long-term cold exposure experiment, mice were individually housed at 28°C (thermoneutral temperature) or 4°C with a normal light/dark cycle for a period of 10 days. At the end of this period, mice were terminated with isoflurane and blood was collected. Following cervical dislocation, several tissues were collected and snap-frozen in liquid nitrogen. In a separate set of mice, blood was drawn via the tail vein at different days during the 10-day cold exposure for plasma TG measurements.
Treatment with CL316,243
To acutely activate BAT other than by cold exposure, mice were injected intraperitoneally with 1 mg/kg of the β3-adrenoreceptor agonist CL316,243 (Tocris Bioscience, Bristol, UK) dissolved in PBS or with PBS alone at 13:00 h, 17:00 h and 9:00 h. Five hours after the last injection, the mice were terminated by cardiac puncture under isoflurane anesthesia and blood and various tissues were collected.
VLDL-TG secretion experiments
To study VLDL-TG secretion, mice were deprived of food for the last 5 h in the climate chamber (i.e., from 09:00 h to 14:00 h) after which they were lightly sedated with isoflurane and an orbital blood sample was taken. Next, the mice received an orbital injection of 100 µL with 12.5% of the lipoprotein lipase inhibitor triton WR-1339 (Sigma-Aldrich) dissolved in PBS. Orbital blood samples were taken under light isoflurane sedation 30, 60, 120 and 180 min after the triton WR-1339 injection. Mice were returned to the temperature-controlled climate chamber (23°C or 4°C) in between blood draws. The mice were terminated by cardiac puncture under isoflurane anesthesia directly after the last blood draw.
Plasma and hepatic lipid analysis and plasma T3 analysis
Plasma TG, cholesterol, alanine transaminase (ALT) and aspartate transaminase (AST) concentrations were measured with commercial available kits (ABX Pentra, Horiba, Irvine, CA). Hepatic concentrations of TGs and cholesterol were measured using commercial available kits (ABX Pentra) after lipid extraction according to Bligh and Dyer (Bligh & Dyer 1959). Plasma 3,3′,5-triiodothyronine (T3) concentrations were determined by radioimmunoassay as previously described (Friedrichsen et al. 2003).
Plasma and hepatic catecholamines
Livers and BAT were homogenized on ice in a glutathione buffer (60 mg/mL L-glutathione (Sigma-Aldrich) and 250 IU/mL heparin (LEO Pharma, Ballerup, Denmark) in water). Plasma was diluted 1:1 in glutathione buffer. Catecholamine extraction was performed according to the method followed by van der Hoorn et al. (van der Hoorn et al. 1989) with some modifications. To measure both norepinephrine and epinephrine, 50–200 µL liver homogenate was used. To control for equal recovery, alpha-methyl-norepinephrine (Sigma-Aldrich) was added as an internal standard to all samples. After extraction and derivatization with the fluorogenic agent 1,2-diphenylethylenediamine (Sigma-Aldrich), the samples were analyzed by HPLC with fluorometric detection (Shimadzu, 's Hertogenbosch, the Netherlands).
Hepatic glycogen and glucose-6-phosphate analysis
Hepatic glycogen concentrations were determined as described earlier (Feillet et al. 2016). In short, ~25 mg of liver was lysed in 0.5 M KOH at 95°C after which 25 μL 6% Na2SO4 and 750 μL methanol were added. Next, samples were split into 2 aliquots and glycogen was precipitated overnight at −80°C followed by centrifugation at 550 g for 30 min. Glycogen was either suspended in 200 μL 2 mg/mL amyloglucosidase (Sigma-Aldrich) in 50 mM sodium acetate (pH 4.8) or in 200 μL 50 mM sodium acetate (pH 4.8), incubated for 1 h at 37°C and centrifuged at 21,000 g for 1 min. The glucose concentration of 5 μL 2-fold diluted supernatant was measured using a glucose assay kit (Glucose LiquiColor, InstruChemie, Delfzijl, the Netherlands) according to the manufacturer’s protocol. Glucose coming from glycogen was calculated as (total glucose) − (free glucose) for each sample.
Hepatic glucose-6-phosphate (G6P) concentrations were determined in ~50 mg liver tissue. Tissue samples were lysed by sonication in 750 μL ice-cold 5% HClO4 after which proteins were precipitated by centrifugation at 18,000 g for 5 min. To 400 μL supernatant, 150 μL 0.3 M MOPS in 2 M KOH was added, followed by centrifugation at 18,000 g for 5 min. Of the supernatant, 125 μL was mixed with 125 μL 0.4 M triethanolamine buffer, pH 7.6 enriched with 400 μM NADP+ (Sigma-Aldrich) and 20 μM MgCl in a white 96-well plate, and the fluorescent signal was determined at 255 nm excitation, 460 nm emission. Ten minutes after the addition of 3 μL 20 U/mL Leuconostoc mesenteroides glucose-6-phosphate dehydrogenase (Sigma-Aldrich), the fluorescent signal was determined again. Next, 2 μL 1 mM D-glucose 6-phosphate disodium salt hydrate (Sigma-Aldrich) was added and the fluorescent signal was determined 10 min later. The increase in fluorescence upon the last addition was used to calculate the amount of G6P in the tissues.
Plasma and hepatic bile acids
Plasma BAs were measured using a colorimetric assay kit (Diazyme Laboratories, Poway, CA). For hepatic BA measurements, 120 μL of a 15% liver homogenate in saline was added to 140 μL methanol and 12 μL 10 M NaOH. This mixture was heated at 80°C for 2 h, cooled to room temperature, combined with 1 mL water and centrifuged at 670 g for 10 min. The BAs in the supernatant were determined using the colorimetric assay kit.
Fecal bile acids
Feces was air-dried, weighed, crushed and homogenized. To determine the fecal BA concentration, 100 mg pulverized feces was added to 2 mL 0.1 M NaOH and incubated at 60°C for 1 h. After cooling, 4 mL water was added and the mixture was homogenized and centrifuged at 20,000 g for 20 min. The supernatant was loaded onto a reverse-phase 30 mg SPE cartridge (Chromabond C18 cartridges, Macherey-Nagel, Düren, Germany; 30 μm bed size), pre-conditioned with consecutively 5 mL methanol and 5 mL water. Next, the cartridge was rinsed consecutively with 20 mL water, 10 mL hexane and again 20 mL water. Next, BAs were eluted with 5 mL methanol and this fraction was dried at 50°C under N2. The samples were dissolved in 150 μL methanol and the BA concentration measured using the colorimetric assay kit.
VLDL isolation and determination of lipid composition
Nascent VLDL particles were isolated from plasma obtained by cardiac puncture after the VLDL secretion experiment. For this, 300 µL plasma was added to 3700 µL PBS and centrifuged at 160,000 g for 17 h, and the top layer containing the VLDL fraction was collected. The concentrations of TG, total cholesterol, free cholesterol and phospholipids in the isolated VLDL fractions were measured using commercial available kits (ABX Pentra for TG, DiaSys for cholesterol and phospholipids). The VLDL size was calculated using the formula of Fraser (Fraser 1970) modified by Harris et al. (Harris et al. 1997): Diameter(nm) = 60 × ((0.211 × TG/PL) + 0.27). In this formula, TG is the relative TG concentration and PL the relative phospholipid concentration.
Volumes of VLDL containing equal amounts of TG were extracted with methanol and cold ether to remove lipids. The remaining VLDL proteins were dissolved in Laemmli sample buffer (Bio-Rad Laboratories) supplemented with 100 mM Dithiothreitol (Sigma-Aldrich), boiled for 10 min, subjected to electrophoresis on 4.5% SDS gels and blotted onto a nitrocellulose membrane. Membranes were blocked in PBS containing 3% nonfat powdered skim milk before an overnight incubation at 4°C with an antibody against apolipoprotein B raised in rabbit (NB200-527; Novus Biologicals, Abingdon, Oxon, UK) in PBS containing 0.1% tween 20 and 3% nonfat powdered skim milk. Next, membranes were washed and incubated for 1 h at room temperature with a goat-anti-rabbit IRDye 800 secondary antibody (LI-COR, Leusden, The Netherlands) in PBS containing 0.1% tween 20 and 3% nonfat powdered skim milk.
Gene expression analysis
Total RNA isolation from mouse tissues and subsequent DNAse treatment and reverse transcription was performed as described previously (van den Beukel et al. 2014). Gene expression was measured using quantitative RT-PCR with SYBRgreen master mix (Applied Biosystems) and an ABI Prism 7900 Sequence Detection System (Applied Biosystems). The housekeeping genes 18S ribosomal RNA (Rn18s) and β2-microglobulin (B2m) for BAT and WAT or Rn18s and β-actin (Actb) for liver were used to normalize expression levels using the 2–ΔΔCt method (Livak & Schmittgen 2001). Expression of the housekeeping genes was not influenced by housing temperature. Primer sequences used for all target genes are listed in Table 1.
Sequences of primers.
| Gene | Accession no. | Forward primer | Reverse primer |
|---|---|---|---|
| Abcg5 | NM_031884 | TGGCCCTGCTCAGCATCT | ATTTTTAAAGGAATGGGCATCTCTT |
| Abcg8 | XM_006524826 | AAGACGGGCTGTACACTGCT | AGTAGATGGGCATCGCGTAG |
| Acaca | XM_006531958 | GGATGTGGATGATGGTCTGA | AGGCCTTGATCATCACTGGA |
| Actb | NM_007393 | AAGGCCAACCGTGAAAAGAT | GTGGTACGACCAGAGGCATAC |
| Apob | NM_009693 | AAACATGCAGAGCTACTTTGGAG | TTTAGGATCACTTCCTGGTCAAA |
| B2m | NM_009735 | ATCCAAATGCTGAAGAACGG | CAGTCTCAGTGGGGGTGAAT |
| Chrebp | NM_021455 | CACTCAGGGAATACACGCCTAC | ATCTTGGTCTTAGGGTCTTCAGG |
| Chrebpb | JQ437838 | TCTGCAGATCGCGTGGAG | CTTGTCCCGGCATAGCAAC |
| Cpt1a | NM_009948 | TGCCTTTACATCGTCTCCAA | GGCTCCAGGGTTCAGAAAGT |
| Cyp7a1 | NM_007824 | CTGTCATACCACAAAGTCTTATGTCA | ATGCTTCTGTGTCCAAATGCC |
| Cyp7b1 | NM_007825 | CCTCTTTCCTCCACTCATACACAA | GAAGCGATCGAACCTAAATTCCTT |
| Cyp8b1 | NM_010012 | TCCTCAGGGTGGTACAGGAG | GATAGGGGAAGAGAGCCACC |
| Cyp27a1 | NM_024264 | TACACCAATGTGAATCTGGC | TAACCTCGTTTAAGGCATCC |
| Elovl3 | NM_007703 | TCCGCGTTCTCATGTAGGTCT | GGACCTGATGCAACCCTATGA |
| Elovl6 | NM_130450 | CAGCAAAGCACCCGAACTA | AGGAGCACAGTGATGTGGTG |
| Fasn | NM_007988 | GCTGCTGTTGGAAGTCAGC | AGTGTTCGTTCCTCGGAGTG |
| Fgf21 | NM_020013 | CTGGGGGTCTACCAAGCATA | CACCCAGGATTTGAATGACC |
| Gpat1 | NM_008149 | AGCAAGTCCTGCGCTATCAT | CTCGTGTGGGTGATTGTGAC |
| Hmgcr | NM_008255 | CCGGCAACAACAAGATCTGTG | ATGTACAGGATGGCGATGCA |
| Ldlr | NM_010700 | GCATCAGCTTGGACAAGGTGT | GGGAACAGCCACCATTGTTG |
| Lpin2 | NM_001164885 | CTGCTTATCTTGCCACCTC | CTGCTTATCTTGCCACCTC |
| Mcad | NM_007382 | GATCGCAATGGGTGCTTTTGATAGAA | AGCTGATTGGCAATGTCTCCAGCAAA |
| Mttp | NM_008642 | CGAGTGAAAAATCGGGTGGC | GGCTTCAGCCTTGTCCATCT |
| Nrg4 | NM_032002 | CCCAGCCCATTCTGTAGGTG | ACCACGAAAGCTGCCGACAG |
| Pcsk9 | NM_153565 | CACCATCACCGACTTCAACA | GTCACACTTGCTCGCCTGT |
| Pklr | NM_013631 | GGGGTGACCTTGGCATTGAG | TTACAGCCTCCACGGGGAAA |
| Plin5 | NM_001077348 | TCCTGCCCGTCAAAGGGATCTGA | GGACATTCTGCTGTGTGGCGCT |
| Ppara | NM_011144 | GCCTTCCCTGTGAACTGACG | AGAGCGCTAAGCTGTGATGA |
| Ppargc1a | NM_008904 | CCCTGCCATTGTTAAGACC | TGCTGCTGTTCCTGTTTTC |
| Rn18s | NR_003278 | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
| Scd1 | NM_009127 | AGATCTCCAGTTCTTACACGACCAC | GACGGATGTCTTCTTCCAGGTG |
| Srebp1c | XM_006532716 | GGAGCCATGGATTGCACATT | CCTGTCTCACCCCCAGCATA |
| Srebp2 | NM_033218 | CCAAAGAAGGAGAGAGGCGG | CGCCAGACTTGTGCATCTTG |
| St3gal5 | NM_001035228 | GGTGTTGAGGTGGGAGGAGAG | GATGGACTAGCAGAAAGGGGTTATGAA |
| Thrsp | NM_009381 | ATGCAAGTGCTAACGAAACGC | CCTGCCATTCCTCCCTTGG |
| Ucp1 | NM_009463 | GGCCTCTACGACTCAGTCCA | TAAGCCGGCTGAGATCTTGT |
Histology and immunohistochemistry
For hematoxylin and eosin staining, 4 and 8 μm sections of liver and BAT fixed in paraformaldehyde and embedded in paraffin were used. Sections were mounted on microscope slides (Thermo Scientific) and kept overnight at 37°C, deparaffinized in xylene and subsequently stained. For immunohistochemistry, sections were mounted on superfrost plus microscope slides (Thermo Scientific), kept at 37°C for at least 10 h before staining for extra adherence. Sections were kept at 60°C for 1 h and subsequently deparaffinized in xylene for 6 min, rinsed twice in 100% EtOH, put in methanol containing 3% H2O2 to block endogenous peroxidase activity and rinsed in demineralized water. Heat-induced antigen retrieval in NaOH buffered citric acid (pH 6.0) was applied. Sections were blocked with 5% normal goat serum (Dako) in PBS for 5 min, rinsed in PBS and then incubated overnight with either an antibody directed against glutamine synthase (GS; 1:100; BD Biosciences, Breda, the Netherlands) or an antibody against perilipin-2 (Pln2; 1:200; Novus Biologicals) at 4°C. BrightVision-poly-HRP-anti mouse/rabbit/rat IgG (Immunologic, Duiven, the Netherlands) in a 1:2 dilution in PBS was added for 30 min at room temperature as secondary antibody and peroxidase activity was developed with 0.07% 3,3-diaminobenzidine-tetrahydrochloride (Sigma-Aldrich) with subsequent counterstaining with hematoxylin.
Statistical analysis
Statistics were performed with GraphPad Prism (Version 5, GraphPad Software, Inc.). The two groups of mice were compared using an unpaired t-test. P < 0.05 was considered statistically significant. For the plasma TG concentrations during the 10 days of exposure to 4°C, a one-way ANOVA was performed and differences between all time points were studied with Tukey’s post hoc test in which P < 0.05 was considered significant.
Results
Cold exposure activates BAT and stimulates browning of inguinal WAT
Exposure to 4°C is a common method to activate BAT and stimulate browning of WAT depots in mouse models. Exposure of male C57Bl/6J mice to 4°C for 24 h did not affect the weight of the interscapular BAT and inguinal and gonadal WAT depots, but resulted in a significant reduction in body weight, despite a 1.54 ± 0.09 fold increase in food intake (Table 2). As expected, 24-h exposure to 4°C significantly induced interscapular BAT mRNA expression of peroxisome proliferator-activated receptor-gamma co-activator 1a (Ppargc1a) and Ucp1, genes associated with more active BAT (Fig. 1A).
Exposure to 4°C for 24 h activates BAT, induces ‘browning’ of WAT and reduces plasma TG concentrations. Data from 24-h cold-exposed male C57Bl/6J mice. (A) Relative interscapular BAT mRNA expression normalized to Rn18s and B2m with data from mice kept at 23°C defined as ‘1’. (B) Representative H&E staining of the interscapular BAT, original magnification 200×. (C) Relative inguinal WAT mRNA expression normalized to Rn18s and B2m with data from mice kept at 23°C defined as ‘1’. (D) Representative H&E staining of the inguinal WAT, original magnification 200×. (E) Plasma TG concentrations. (F) Plasma cholesterol concentrations. Values are averages ± s.e.m.; n = 6; *P < 0.05 vs. 23°C. Nrg4, neuregulin-4; Ppargc1a, proliferator-activated receptor-gamma co-activator 1a; Ucp1, uncoupling protein-1.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Effect of 24-h exposure to 4°C on body weight, food intake, blood glucose and adipose tissue weight.
| 23°C | 4°C | |
|---|---|---|
| Body weight before (g) | 25.0 ± 0.7 | 26.6 ± 0.8 |
| Body weight after (g) | 25.0 ± 0.7 | 25.7 ± 0.6 |
| Delta body weight (g) | 0.0 ± 0.1 | −0.9 ± 0.2* |
| Food intake (g) | 3.4 ± 0.2 | 5.3 ± 0.3* |
| Relative food intake (mg/g BW) | 137 ± 6 | 206 ± 13* |
| Blood glucose (mM) | 6.1 ± 0.1 | 6.2 ± 0.5 |
| iBAT weight (mg) | 110 ± 8 | 117 ± 5 |
| Relative iBAT weight (% BW) | 0.44 ± 0.03 | 0.46 ± 0.02 |
| iWAT weight (mg) | 200 ± 12 | 183 ± 8 |
| Relative iWAT weight (%) | 0.81 ± 0.06 | 0.71 ± 0.03 |
| gWAT weight (mg) | 367 ± 23 | 348 ± 21 |
| Relative gWAT weight (%) | 1.46 ± 0.07 | 1.35 ± 0.05 |
Data from 24-h cold-exposed male C57Bl/6J mice. Values are averages ± s.e.m.; n = 6.
*P < 0.05 vs. 23°C.
iBAT, interscapular brown adipose tissue; iWAT, inguinal white adipose tissue; gWAT, gonadal white adipose tissue.
We also examined the BAT expression of neuregulin-4 (Nrg4) since this member of the epidermal growth factor family has been shown to be secreted by BAT and to regulate hepatic lipid metabolism in an endocrine fashion (Wang et al. 2014). Our results show that cold exposure induced a rapid increased in Nrg4 mRNA expression in BAT (Fig. 1A).
The increased BAT activity upon cold exposure was also evident by the denser appearance of interscapular BAT in mice kept at 4°C (Fig. 1B). Similar effects were observed in the inguinal WAT depot upon cold exposure (Fig. 1C and D). Cold exposure reduced plasma TG concentrations by 55 ± 6% (P < 0.05) but had no effect on plasma cholesterol concentrations (Fig. 1E and F).
Cold exposure increases hepatic triglycerides predominantly in the periportal zone while reducing hepatic glycogen content
Upon 24-h cold exposure, the hepatic TG concentration was significantly increased by 2.2 ± 0.4 fold (Table 3). This accumulation of hepatic TGs did not provoke an elevation in the plasma concentrations of AST and ALT, indicating an absence of actual liver injury (Table 3). Hepatic cholesterol concentrations were not changed by cold exposure. Hepatic glycogen concentrations were reduced by 87 ± 6% (P < 0.05), while hepatic glucose-6-phosphate (G6P) concentrations were not affected (Table 3).
Effect of 24-h exposure to 4°C on liver weight, hepatic biomarkers and hepatic metabolites.
| 23°C | 4°C | |
|---|---|---|
| Liver weight (mg) | 1247 ± 42 | 1347 ± 31 |
| Relative liver weight (% BW) | 4.98 ± 0.06 | 5.25 ± 0.03* |
| Plasma ALT (U/L) | 54 ± 16 | 32 ± 4 |
| Plasma AST (U/L) | 79 ± 3 | 74 ± 8 |
| Hepatic triglycerides (nmol/mg) | 8.8 ± 0.8 | 19.1 ± 3.4* |
| Hepatic free cholesterol (nmol/mg) | 3.7 ± 0.1 | 3.8 ± 0.2 |
| Hepatic cholesteryl esters (nmol/mg) | 1.2 ± 0.2 | 1.4 ± 0.1 |
| Hepatic glycogen (nmol/mg) | 367 ± 74 | 47 ± 21* |
| Hepatic G6P (nmol/mg) | 0.53 ± 0.08 | 0.38 ± 0.06 |
Data from 24-h cold-exposed male C57Bl/6J mice. Values are averages ± s.e.m.; n = 6.
*P < 0.05 vs. 23°C.
ALT, alanine transaminase; AST, aspartate transaminase; G6P, glucose-6-phosphate.
We investigated in which hepatic zone(s) TGs accumulated upon cold exposure. Since glutamine synthetase (Gs) is only present in the pericentral zone (Stanulović et al. 2007), Gs immunohistochemistry was used to identify this region of the liver. Immunohistochemistry for both Gs and the lipid droplet protein perilipin-2 (Plin2) revealed that 24-h cold exposure resulted in increased Plin2 protein staining predominantly but not exclusively in the periportal zone (Fig. 2).
A predominant increase of perilipin-2 protein in the periportal zone of livers from mice exposed to 4°C for 24 h. Representative glutamine synthase (Gs) and perilipin-2 (Plin2) expression in livers of 24-h cold-exposed male C57Bl/6J mice. Top row: Plin2 immunohistochemical staining (original magnification 200×) outlining the locations of the periportal and pericentral pictures. The insets show Gs immunohistochemical staining (original magnification 200×) of the same livers used to localize the periportal and the pericentral zones. Middle row: Plin2 immunohistochemical staining of the periportal zone, original magnification 400×. Arrows indicate examples of lipid droplets with Plin2 protein expression on the surface. Bottom row: Plin2 immunohistochemical staining of the pericentral zone, original magnification 400×.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Cold exposure reduces hepatic lipogenic gene expression
Next, we studied whether the increased hepatic TG content might be the result of reduced fatty acid oxidation and/or increased fatty acid synthesis. For fatty acid oxidation, we determined the expression of genes controlled by the major regulators of fatty acid oxidation, namely the nuclear receptors peroxisome proliferator-activated receptor-α (Pparα) and Pparβ/δ. With respect to Pparα target genes, 24-h cold exposure induced the expression of the gene encoding carnitine palmitoyltransferase-1a (Cpt1a) by 1.8 ± 0.3 fold (P < 0.05) while decreasing expression of the gene encoding fibroblast growth factor-21 (Fgf21) by 69 ± 10% (P < 0.05) (Fig. 3A). The hepatic mRNA expression of the Pparβ/δ target genes encoding for perilipin-5 (Plin5) and ST3 β-galactoside α-2,3-sialyltransferase 5 (St3gal5) was significantly induced upon 24-h exposure to 4°C (Fig. 3B).
Exposure to 4°C for 24 h reduces hepatic lipogenic gene expression. Relative hepatic mRNA expression of 24-h cold-exposed male C57Bl/6J mice. (A) Expression of Pparα and its target genes. (B) Expression of Pparβ/δ target genes. (C) Expression of genes involved in fatty acid and TG synthesis. (D) Expression of Lxr target genes. (E) Expression of Chrebp and its target genes. Hepatic mRNA expression is normalized to Rn18s and Actb with data from mice kept at 23°C defined as ‘1’. Values are averages ± s.e.m.; n = 6; *P < 0.05 vs. 23°C. Abcg5, ATP-binding cassette G5; Abcg8, ATP-binding cassette G8; Acaca, acetyl-coenzyme A carboxylase alpha; Chrebp, carbohydrate-response-element binding protein; Cpt1a, palmitoyltransferase-1a; Cyp7a1, cytochrome P450 7A1; Elovl3, Elongation of long-chain fatty acid family member 3; Elovl6, Elongation of long-chain fatty acid family member 6; Fasn, fatty acid synthase; Fgf21, fibroblast growth factor-21; Gpat1, glycerol-3-phosphate acyltransferase-1; Lpin2, lipin-2; Lxr, liver X receptor; Mcad, medium-chain acyl-CoA dehydrogenase; Pklr, pyruvate kinase liver and red blood cells; Plin5, perilipin-5; Pparα; peroxisomal proliferator-activated receptor-α; Pparβ/δ, peroxisomal proliferator-activated receptor-β/δ; Scd1, stearoyl-coenzyme A desaturase-1; Srebp-1c, sterol-regulatory element-binding protein-1c; St3gal5, ST3 β-galactoside α-2,3-sialyltransferase 5.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Expression of genes involved in hepatic fatty acid synthesis, such as the major lipogenic transcription factor sterol-regulatory element-binding protein-1c (Srebp-1c) and its target genes encoding acetyl-coenzyme A carboxylase alpha (Acaca) and stearoyl-coenzyme A desaturase-1 (Scd1) were all significantly reduced upon cold exposure (Fig. 3C). Since transcription of Srebp-1c and hence its target genes is regulated by liver X receptor (Lxr) (Schultz et al. 2000), the reduced hepatic mRNA expression of these genes might reflect reduced Lxr signaling. Therefore, we also determined the expression of the non-lipogenic Lxr target genes Abcg5, Abcg8 and Cyp7a1 that encode ATP-binding cassette G5, -G8 and cytochrome P450 7A1, respectively (Fig. 3D). Cold exposure for 24 h significantly reduced hepatic expression of Abcg5 and Abcg8 by 42 ± 10% and 50 ± 8%, respectively. In contrast, hepatic Cyp7a1 mRNA expression was significantly increased by 330 ± 100%.
Most lipogenic genes controlled by Srebp-1c are also regulated by the carbohydrate responsive element-binding protein (Chrebp) (Ishii et al. 2004) whose expression is also suggested to be controlled by Lxr (Cha & Repa 2007). Cold exposure strongly reduced hepatic Chrebp mRNA expression and the Chrebp target genes Chrebpb and Pklr, encoding the protein pyruvate kinase liver and red blood cells, albeit that the latter reduction failed to reach statistical significance (Fig. 3E).
Cold exposure increases the hepatic bile acid concentration
Twenty-four hour exposure to 4°C suppressed transcriptional activity of the lipogenic transcription factors Srebp-1c, Lxr and Chrebp, indicative of reduced Lxr activity. In contrast, expression of the Lxr target gene Cyp7a1 was increased by more than 4-fold. Cyp7a1 is the rate-limiting enzyme in the classical BA synthesis pathway. However, other enzymes also contribute to the classical and the alternative BA synthesis pathway (Russell 2003). We therefore explored the effect of cold exposure on the hepatic mRNA expression of these enzymes and on hepatic, fecal and plasma BAs. Cold exposure significantly reduced the expression of Cyp27a1 by 44 ± 3% (Fig. 4A), while hepatic BA concentrations and fecal BA excretion were increased 2.8- and 1.3-fold (P < 0.05 for both), respectively (Fig. 4B and C). Plasma BA concentrations were reduced, but this effect failed to reach significance (Fig. 4D).
Elevated hepatic bile acids upon exposure to 4°C for 24 h. Data from 24-h cold-exposed male C57Bl/6J mice. (A) Relative hepatic mRNA expression of genes encoding enzymes involved in bile acid (BA) synthesis. Expression is normalized to Rn18s and Actb with data from mice kept at 23°C defined as ‘1’. (B) Hepatic BA concentrations. (C) Fecal BA excretions. (D) Plasma BA concentrations. Values are averages ± s.e.m.; n = 5–6; *P < 0.05 vs. 23°C. Cyp7b1, cytochrome P450 7A1; Cyp8b1, cytochrome P450 8B1; Cyp27a1, cytochrome P450 27A1.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Reduced VLDL secretion in cold-exposed mice
Previous studies have demonstrated that both Chrebp and Lxr activity as well as BAs affect VLDL secretion (Grefhorst et al. 2002, Elzinga et al. 2003, Watanabe et al. 2004, Grefhorst & Parks 2009, Wu et al. 2015). We therefore also determined the VLDL-TG secretion rates of cold-exposed mice using the lipoprotein lipase (Lpl) inhibitor triton WR-1339. VLDL-TG secretion was reduced significantly by approximately 50% after 24 h of cold exposure (Fig. 5A and B). Analysis of the lipid composition of nascent VLDL particles revealed that cold exposure reduced the relative TG content and elevated the relative cholesterol content of the VLDL particles without affecting VLDL particle size (Table 4). The latter is in line with the fact that cold exposure did not affect the relative apolipoprotein B (ApoB) protein concentration of the VLDL fraction (Fig. 5C). The expression of genes encoding important regulators of VLDL secretion, e.g., ApoB and microsomal TG transfer protein (Mttp), was not affected by cold exposure (Fig. 5D). VLDL-TG secretion is not only suppressed by BAs but also by catecholamines (Rasouli & Zahraie 2006) and thyroid hormone 3,3′,5-triiodothyronine (T3) (Wilcox & Heimberg 1991). Cold exposure did not affect hepatic and plasma catecholamine concentrations (Fig. 6A and 6B) but did increase plasma T3 concentrations by 2.2 ± 0.1 fold (P < 0.05) (Fig. 6C). In agreement, cold exposure enhanced hepatic expression of the T3 target gene Thrsp (Zilz 1990), encoding thyroid hormone responsive (Fig. 6D).
Exposure to 4°C results in a reduced VLDL-TG secretion. Data from 24-h cold-exposed male C57Bl/6J mice. Mice were fasted for 5 h prior to triton WR-1339 injection. (A) Plasma TG concentrations before and at indicated time points after injection of triton WR-1339. (B) VLDL-TG secretion rates calculated from the plasma TG vs. time curve. (C) Immunoblot of apoB in nascent VLDL. For this, blood was collected 2 h after triton WR-1339 and VLDL was isolated from plasma by ultracentrifugation. Equal amounts of TG were loaded per well. (D) Relative hepatic mRNA expression of genes encoding proteins involved in VLDL secretion. Expression is normalized to Rn18s and Actb with data from mice kept at 23°C defined as ‘1’. Values are averages ± s.e.m.; n = 6; *P < 0.05 vs. 23°C. ApoB, apolipoprotein B; Mttp, microsomal TG transfer protein.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Exposure to 4°C for 24 h results in elevated plasma T3 concentrations. Data from 24-h cold-exposed male C57Bl/6J mice. (A) Hepatic catecholamine (norepinephrine and epinephrine) contents. (B) Plasma catecholamine (norepinephrine and epinephrine) concentrations. (C) Plasma 3,3′,5-triiodothyronine (T3) concentrations. (D) Relative hepatic Thrsp mRNA expression encoding thyroid hormone responsive. Expression is normalized to Rn18s and Actb with data from mice kept at 23°C defined as ‘1’. Values are averages ± s.e.m.; n = 6; *P < 0.05 vs. 23°C.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Effect of 24-h exposure to 4°C on lipid composition and size of nascent VLDL particles.
| 23°C | 4°C | |
|---|---|---|
| Triglycerides (% lipid) | 74.9 ± 0.7 | 72.0 ± 1.0* |
| Phospholipids (% lipid) | 15.8 ± 0.6 | 16.1 ± 0.6 |
| Free cholesterol (% lipid) | 8.3 ± 0.3 | 10.1 ± 0.6* |
| Cholesteryl esters (% lipid) | 0.9 ± 0.2 | 1.8 ± 0.2* |
| Calculated diameter (nm) | 76.6 ± 2.9 | 72.3 ± 2.8 |
Data from nascent VLDL collected from 24-h cold-exposed male C57Bl/6J mice. The mice were fasted for 5 h prior to injection with triton WR-1339. Two hours after injection, blood was collected and VLDL was isolated from plasma by ultracentrifugation. The lipid concentrations are expressed as percentage relative to the total lipid concentration. VLDL diameter was calculated using the formula diameter (nm) = 60 × ((0.211 × TG/PL) + 0.27) in which TG is the relative TG concentration and PL the relative phospholipid concentration. Values are averages ± s.e.m.; n = 6.
*P < 0.05 vs. 23°C.
To investigate the link between activated BAT, increased plasma T3 and reduced VLDL-TG secretion in more detail, we activated BAT by treating mice with the β3-adrenoreceptor agonist CL316,243. As expected, CL316,243 treatment enhanced BAT activity, as reflected by the increased BAT Ucp1 mRNA expression (Fig. 7A). In contrast to cold exposure, CL316,243 treatment did not increase BAT Ppargc1a and Nrg4 mRNA expression. CL316,243-treatment also did not affect hepatic mRNA expression of the studied genes, apart from inductions in Elovl6, Cyp7a1 and Apob (Table 5). Treatment with the β3-adrenoreceptor agonist resulted in a massive hepatic TG accumulation from 7.9 ± 0.7 in control mice to 58.3 ± 6.7 nmol/mg in CL316,243-treated mice (P < 0.05) (Fig. 7B). In contrast to cold exposure, CL316,243 treatment reduced plasma T3 concentrations (Fig. 7C). Nevertheless, CL316,243-activation of BAT still coincided with a strongly reduced VLDL-TG secretion (Fig. 7D).
Treatment with the β3-adrenoreceptor agonist CL316,243 stimulates BAT, induces hepatic TG concentrations and reduces VLDL-TG secretion despite reduced plasma T3 concentrations. Data from male mice treated with or without 3 times 1 mg CL316,243 per kg bodyweight. (A) Relative interscapular BAT mRNA expression normalized to Rn18s and B2m with data from control mice defined as ‘1’. (B) Hepatic TG concentrations. (C) Plasma 3,3′,5-triiodothyronine (T3) concentrations. (D) VLDL-TG secretion rates calculated from the plasma TG vs. time curve from samples collected after injection of Triton WR-1339. Values are averages ± s.e.m.; n = 6; *P < 0.05 vs. control mice. Nrg4, neuregulin-4; Ppargc1a, proliferator-activated receptor-gamma co-activator 1a; Ucp1, uncoupling protein-1.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Effect of treatment with the β3-adrenoreceptor agonist CL316,243 on hepatic gene expression.
| Control | CL316,243 | |
|---|---|---|
| Pparα and its target genes | ||
| Cpt1a | 1.00 ± 0.23 | 1.60 ± 0.56 |
| Fgf21 | 1.00 ± 0.18 | 4.72 ± 2.49 |
| Mcad | 1.00 ± 0.18 | 4.22 ± 2.08 |
| Ppara | 1.00 ± 0.29 | 2.43 ± 1.68 |
| Pparβ/δ target genes | ||
| Lpin2 | 1.00 ± 0.19 | 1.96 ± 0.74 |
| Plin5 | 1.00 ± 0.33 | 1.58 ± 0.57 |
| St3gal5 | 1.00 ± 019 | 1.38 ± 0.46 |
| Fatty acid and TG synthesis | ||
| Acaca | 1.00 ± 0.15 | 1.49 ± 0.17 |
| Elovl3 | 1.00 ± 0.18 | 0.93 ± 0.15 |
| Elovl6 | 1.00 ± 0.15 | 1.93 ± 0.38* |
| Fasn | 1.00 ± 0.35 | 0.94 ± 0.50 |
| Gpat1 | 1.00 ± 0.18 | 1.65 ± 0.55 |
| Scd1 | 1.00 ± 0.19 | 0.56 ± 0.28 |
| Srebp1c | 1.00 ± 0.27 | 0.69 ± 0.07 |
| Chrebp and its target genes | ||
| Chrebp | 1.00 ± 0.19 | 0.57 ± 0.15 |
| Chrebpb | 1.00 ± 0.12 | 0.70 ± 0.14 |
| Pklr | 1.00 ± 0.28 | 0.85 ± 0.15 |
| Lxr target genes | ||
| Abcg5 | 1.00 ± 0.15 | 1.34 ± 0.41 |
| Abcg8 | 1.00 ± 0.24 | 1.45 ± 0.33 |
| Cyp7a1 | 1.00 ± 0.13 | 2.06 ± 0.33* |
| BA synthesis | ||
| Cyp7b1 | 1.00 ± 0.24 | 0.86 ± 0.21 |
| Cyp8b1 | 1.00 ± 0.25 | 0.95 ± 0.21 |
| Cyp27a1 | 1.00 ± 0.33 | 0.97 ± 0.17 |
| VLDL secretion | ||
| Apob | 1.00 ± 0.08 | 2.25 ± 0.63 |
| Mttp | 1.00 ± 0.19 | 3.35 ± 1.88 |
| T3 target gene | ||
| Thrsp | 1.00 ± 0.14 | 0.73 ± 0.05 |
Hepatic gene expression of male mice treated with or without 3 times 1 mg CL316,243 per kg bodyweight. Results were normalized to Rn18s and Actb mRNA expression with data from control mice defined as ‘1’. Values are averages ± s.e.m.; n = 6.
*P < 0.05 vs. control mice.
Remodeling of hepatic cholesterol metabolism upon cold exposure
Our results so far suggest that cold exposure stimulated hepatic BA synthesis, which might affect cholesterol concentrations. However, hepatic cholesterol concentrations were not affected, suggesting changes in the regulation of cellular cholesterol homeostasis in cold-exposed mice. Therefore, we investigated the transcriptional activity of sterol-regulatory element-binding protein-2 (Srebp-2), the major regulator of hepatic cholesterol concentrations (Goldstein et al. 2006, Radhakrishnan et al. 2008). Although hepatic mRNA expression of Srebp2 was not significantly affected by 24-h cold exposure, the mRNA expression of the Srebp-2 target genes Hmgcr, Ldlr and Pcsk9 (encoding 3-hydroxy-3-methylglutaryl-CoA reductase, LDLR and proprotein convertase subtilisin/kexin type 9, respectively) were significantly upregulated (Fig. 8).
Modulation of Srebp-2 signaling in livers of mice exposed to 4°C for 24 h. Relative hepatic mRNA expression of Srebp-2 and its target genes of 24-h cold-exposed male C57Bl/6J mice. Expression is normalized to Rn18s and Actb with data from mice kept at 23°C defined as ‘1’. Values are averages ± s.e.m.; n = 6; *P < 0.05 vs. 23°C. Hmgcr, 3-hydroxy-3-methylglutaryl-CoA reductase; Ldlr, LDL receptor; Pcsk9, proprotein convertase subtilisin/kexin type 9; Srebp-2, sterol-regulatory element-binding protein-2.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Preserved effects of cold exposure on hepatic lipogenic gene expression
To study whether the changes in hepatic gene expression persisted upon prolonged cold exposure, mice were kept at 28°C or 4°C for 10 days. During the cold exposure, the plasma TG concentrations declined (one-way ANOVA: F(4,72) = 0.932, P < 0.05) and remained reduced after 10-day exposure to 4°C (Fig. 9A). Also upon prolonged cold exposure, the mRNA expression levels of genes reflecting BAT activity were increased (Fig. 9B). Likewise, prolonged cold exposure resulted in a modest but statistically significant elevation of the hepatic TG content, while hepatic cholesterol concentrations were not affected (Fig. 9C). Hepatic mRNA expression analysis showed that prolonged cold reduced mRNA expression of the Pparα target genes Fgf21 and Mcad by 97.9 ± 0.2% and 53 ± 8%, respectively (Fig. 9D). Also the Pparβ/δ target genes Lpin2 and St3gal5 and most Srebp-1c and Chrebp target genes were reduced by prolonged cold exposure (Fig. 9E and G). While Cyp7a1 mRNA expression was not affected by 10 days of 4°C (Fig. 9H), it increased the expression of Cyp7b1 and Cyp8b1 (Fig. 9I). In addition, we found that 10 days of 4°C reduced hepatic Apob mRNA expression and had no effect on hepatic Mttp mRNA expression (Fig. 9J). Of the Srebp-2 target genes, only Hmgcr mRNA expression was affected by exposure to 4°C for 10 days (Fig. 9K).
Increased hepatic TG content and lower hepatic lipogenic gene expression persist after 10 days of exposure to 4°C. Data from 10-day cold-exposed male C57Bl/6J mice. (A) Plasma TG concentrations during the 10-day exposure to 4°C. Values are averages ± s.e.m.; n = 9–19; *P < 0.05 in Tukey’s post hoc test after one-way ANOVA. (B) Relative interscapular BAT mRNA expression normalized to Rn18s and B2m with data from mice kept at 28°C defined as ‘1’. (C) Hepatic TG and cholesterol concentrations. (D) Relative hepatic mRNA expression of Pparα and its target genes. (E) Relative hepatic mRNA expression of Pparβ/δ target genes. (F) Relative hepatic mRNA expression of genes involved in fatty acid and TG synthesis. (G) Expression of Chrebp and its target genes. (H) Expression of Lxr target genes. (I) Relative hepatic mRNA expression of genes encoding enzymes involved in bile acid (BA) synthesis. (J) Relative hepatic mRNA expression of genes encoding proteins involved in VLDL secretion. (K) Relative hepatic mRNA expression of Srebp-2 and its target genes. Hepatic expression is normalized to Rn18s and Actb with data from mice kept at 28°C defined as ‘1’. Values are averages ± s.e.m.; n = 8–9; *P < 0.05 vs. 28°C. Abcg5, ATP-binding cassette G5; Abcg8, ATP-binding cassette G8; Acaca, acetyl-Coenzyme A carboxylase alpha; ApoB, apolipoprotein B; Chrebp, carbohydrate-response-element binding protein; Cpt1a, palmitoyltransferase-1a; Cyp7a1, cytochrome P450 7A1; Cyp7b1, cytochrome P450 7A1; Cyp8b1, cytochrome P450 8B1; Cyp27a1, cytochrome P450 27A1; Elovl3, Elongation of long-chain fatty acid family member 3; Elovl6, Elongation of long-chain fatty acid family member 6; Fasn, fatty acid synthase; Fgf21, fibroblast growth factor-21; Gpat1, glycerol-3-phosphate acyltransferase-1; Hmgcr, 3-hydroxy-3-methylglutaryl-CoA reductase; Ldlr, low-density lipoprotein receptor; Lpin2, lipin-2; Lxr, liver X receptor; Mcad, medium-chain acyl-CoA dehydrogenase; Mttp, microsomal TG transfer protein; Nrg4, neuregulin-4; Pcsk9, proprotein convertase subtilisin/kexin type 9; Pklr, pyruvate kinase liver and red blood cells; Plin5, perilipin-5; Ppargc1a, proliferator-activated receptor-gamma co-activator 1a; Pparα, peroxisomal proliferator-activated receptor-α; Pparβ/δ; peroxisomal proliferator-activated receptor-β/δ; St3gal5, ST3 β-galactoside α-2,3-sialyltransferase 5; Scd1, stearoyl-coenzyme A desaturase-1; Srebp-1c, sterol-regulatory element-binding protein-1c; Srebp-2, sterol-regulatory element-binding protein-2; Ucp1, uncoupling protein-1.
Citation: Journal of Endocrinology 238, 2; 10.1530/JOE-18-0076
Discussion
Cold exposure is a common strategy to activate BAT in laboratory animals to determine the potentially positive effects of activated BAT on metabolism. Here, we describe that exposure to 4°C for 24 h has multiple, likely intertwined effects on the liver: it increases hepatic TG concentrations, reduces hepatic glycogen content, reduces hepatic lipogenic gene expression, lowers VLDL-TG secretion, stimulates BA synthesis, induces hepatic BA concentrations and modulates hepatic cholesterol homeostasis.
As has been reported in multiple studies (Bartelt et al. 2011, Khedoe et al. 2015, van den Beukel et al. 2015), activation of BAT by cold exposure reduces plasma TG concentrations. Although a recent study reported that the cold-induced decline in plasma TG is transient (Flachs et al. 2017), we found a persistent reduction in plasma TG during the 10-day cold exposure. An explanation for this difference between our study and the previous one could be the housing conditions. We choose to house the mice individually to prevent them from keeping each other warm, while Flachs et al. caged the mice in groups of 3–4 which might have resulted in a significantly reduced individual exposure to low temperatures (Flachs et al. 2017).
An increased hepatic TG content can be caused by increased hepatic fatty acid uptake, decreased fatty acid oxidation, increased hepatic fatty acid and TG synthesis, and/or decreased VLDL-TG secretion (Willebrords et al. 2015). Since cold exposure enhances WAT lipolysis (Himms-Hagen 1972), it is expected that this experimental strategy will also result in an increased fatty acid flux from WAT to the liver. Indeed, we found that cold exposure increased the hepatic expression of genes regulated by PPARβ/δ, a transcription factor activated by fatty acids derived from endogenous sources such as adipose tissue (Sanderson et al. 2009), reflecting increased hepatic fatty acid uptake. Moreover, we found that 24-h cold exposure resulted in a predominant but not exclusive accumulation of lipids in the periportal zone, the zone where fatty acid uptake and oxidation are mainly localized (Hijmans et al. 2014). Thus, a periportal accumulation also points toward an increased fatty acid uptake and/or reduced fatty acid oxidation. The latter seems not very likely, at least at the level of expression of genes encoding rate-limiting enzymes in fatty acid oxidation, such as Cpt1a and Mcad. In line, it has been shown that 10 days of cold exposure did not reduce but rather increased hepatic fatty acid oxidation in rats, likely in an attempt to enhance ATP production (Iossa et al. 1994).
Both short- and long-term cold exposure resulted in marked reductions in hepatic lipogenic gene expression. Thus, an increased hepatic fatty acid and TG synthesis is likely not responsible for the increased hepatic TG content. Reduced lipogenesis has been shown before in liver slices from rats exposed to cold that had a reduced ability to convert 14C-acetate into 14C-fatty acids (Masoro et al. 1957). Our data show that the reduced hepatic lipogenesis is the result of the reduced activities of the three major lipogenic transcription factors: Srebp-1c, Lxr and Chrebp. Although it has previously been shown that 4 h exposure to cold reduced hepatic Srebp-1c mRNA expression by 1.7-fold in mice (Goetzman et al. 2005), we here also show an effect on Chrebp signaling. The hepatic glycogen concentrations did drop by almost 90% upon 24 h cold exposure, which is in line with a previous study (Bobbioni-Harsch et al. 1994). This reduction in glycogen is likely the result of an increased hepatic glucose production necessary to sustain the increased whole-body energy demand to increase (non) shivering thermogenesis as suggested previously (Cunningham et al. 1985). It is to be expected that the elevated hepatic glucose production will result in a reduced flux through the pentose-5-phosphate pathway and hence a lower concentration of xylulose-5-phosphate. Both G6P and xylulose-5-phosphate are considered drivers of Chrebp transcriptional activity (Dentin et al. 2012). Thus, cold exposure increases hepatic glucose production, likely resulting in a reduced transcriptional activity of Chrebp.
A direct link between stimulation of BAT by cold exposure and the reduced hepatic lipogenic gene expression might be established by increased Nrg4 concentrations. Mice deficient for Nrg4 have elevated hepatic lipogenic gene expression due to enhanced translocation of Srebp-1c to the nucleus, likely due to higher Lxr activity (Wang et al. 2014). Our results show that cold exposure elevates BAT Nrg4 mRNA expression. Thus, the reduced hepatic Lxr-Srebp-1c transcriptional activity in cold-exposed mice could be due to increased secretion of Nrg4 by BAT.
A remarkable finding was the severe reduction of hepatic Fgf21 mRNA expression upon cold exposure for either 24 h or 10 days. Numerous factors have been reported to regulate Fgf21 mRNA expression, as recently reviewed (Strowski 2017). The reduced Fgf21 mRNA expression in our cold-exposed mice might be a reflection of the reduced transcriptional activity of Chrebp since this factor is among the regulators of Fgf21 transcription, at least in rat hepatocytes (Iizuka et al. 2009).
Exposure to 4°C for 24 h resulted in a severe reduction of VLDL-TG secretion. While cold exposure has been shown to reduce VLDL-TG secretion in rats (McBurney & Radomski 1969), to the best of our knowledge, the present study and our previous one (van den Beukel et al. 2015) are the only ones addressing effects of cold exposure on VLDL-TG secretion in mice. The reduced VLDL-TG secretion may contribute to the increased hepatic TG concentrations in cold-exposed mice. In 1969, McBurney and Radomski (1969) concluded from their experiments with rats that cold exposure resulted in a reduced utilization of fatty acids by the liver for VLDL production, which might result in elevated fatty acid storage as TG in the liver. Altogether, both increased fatty acid uptake and reduced VLDL-TG secretion likely contribute to the increased hepatic TG content in the cold-exposed mice.
VLDL-TG secretion has been reported to be reduced by BAs (Elzinga et al. 2003, Watanabe et al. 2004) and T3 (Wilcox & Heimberg 1991). Thus, the increased hepatic BA and plasma T3 concentrations in cold-exposed mice are in line with the observed reduced VLDL-TG secretion. Our data show that 24-h exposure to 4°C increased hepatic Cyp7a1 mRNA expression, suggesting an upregulation of the classical BA synthesis pathway and explaining the increased hepatic BA concentrations. Prolonged exposure to 4°C resulted in increased hepatic Cyp7b1 and Cyp8b1 mRNA expression, suggesting a switch from the classical to the alternative BA synthesis pathway when cold exposure persists. This latter observation is in agreement with a recent publication of Worthmann et al. (Worthmann et al. 2017) who showed that 7-day exposure of male mice to 6°C increased hepatic Cyp7b1 and Cyp8b1 but not Cyp7a1 mRNA expression. In contrast, Shore et al. (Shore et al. 2013) reported a 50- to 100-fold downregulation of hepatic Cyp7b1, Cyp8b1 and Cyp7a1 mRNA expression in female mice upon exposure to 8°C for 24 h. The difference in sex of the mice may explain these conflicting results. Female mice are known to have lower hepatic Cyp7b1 and Cyp8b1 mRNA expression (Zhang & Klaassen 2010) and higher hepatic Cyp7a1 mRNA expression (Lu et al. 2013). Studies in both male and female mice are warranted to identify potential sex differences in BA metabolism upon cold exposure.
T3 has been suggested to be a factor secreted by activated BAT (reviewed in (Villarroya et al. 2017)) due to elevated BAT deiodinase-2 activity. Deiodinase-2 is important for the conversion of 3,3′,5,5′-tetraiodothyronine (T4) into T3 and can be stimulated by BAs (Watanabe et al. 2006). The hypothalamic–pituitary–thyroid axis is stimulated by cold (Sotelo-Rivera et al. 2014) and T3 has been shown to induce hepatic Cyp7a1 mRNA expression (Bonde et al. 2012); thus, the increased hepatic BA concentrations could also be the result of the increased plasma T3 concentrations. The link between T3 and BA metabolism and their (combined) effect on lipid metabolism upon cold exposure require more detailed research. Since T3 has also been reported to suppress VLDL-TG secretion (Wilcox & Heimberg 1991), it might be that the increased plasma T3 in cold-exposed mice attributed to a lower VLDL-TG secretion. However, activation of BAT with CL316,243 reduced VLDL-TG secretion but did not elevate the plasma T3 concentrations. This suggests that the changed plasma T3 concentration in cold-exposed mice is likely not the sole factor reducing VLDL-TG secretion.
Catecholamines might also regulate VLDL-TG secretion, although published data are conflicting. Hepatic denervation has been shown to result in a 99% reduction of hepatic catecholamine content and to enhance VLDL-TG secretion (Rasouli et al. 2012), while others found that selective denervation of the sympathetic input toward the liver resulted in decreased VLDL secretion in 19-h fasted but not in 4-h fasted rats (Bruinstroop et al. 2013). In our studies, an effect of catecholamines on VLDL-TG secretion upon cold exposure can be ruled out since both hepatic and plasma catecholamine concentrations were not affected. This is in line with a previous observation that exposure to 4°C for 3–6 h did not increase norepinephrine turnover in livers of rats (Teramura et al. 2014).
An intriguing observation was that 24-h exposure to 4°C increased hepatic Srebp-2 signaling. Since Srebp-2 transcriptional activity is negatively regulated by ER cholesterol concentrations (Goldstein et al. 2006, Radhakrishnan et al. 2008), it can be speculated that cold exposure resulted in a reduced ER cholesterol content. Interestingly, ER cholesterol content not only controls Srebp-2 activity but also is the source for VLDL cholesterol: a reduction in hepatic cholesterol content is associated with decreased VLDL secretion (Khan et al. 1990). Thus, a reduced ER cholesterol content might have contributed to the reduced VLDL secretion in the cold-exposed mice. This effect was likely temporarily since Srebp-2 signaling was normalized after 10-day exposure to 4°C.
In conclusion, we show that cold exposure has multiple, likely intertwined effects on the liver. Exposure to 4°C for 24 h resulted in elevated hepatic TG concentrations, almost diminished hepatic glycogen content, reduced hepatic lipogenic gene expression, reduced VLDL secretion and higher BA synthesis and hepatic BA concentrations. These effects of cold exposure on the liver should be taken into account when studying effects of cold exposure on metabolism since the liver is the main metabolic organ controlling whole-body TG, cholesterol and BA metabolism.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.
Author contribution statement
A G, S K, A P N T and J A V made contributions to the conception and design of the experiments. A G, J C B, W D and J S performed the research and were involved in acquisition of the data. A G, J S, G J V, S L, T J V and E C H F analyzed and interpreted the data. A G drafted the manuscript. All authors were involved in critical revision of the manuscript. All authors approved the final version of the manuscript.
References
Bartelt A, Bruns OT, Reimer R, Hohenberg H, Ittrich H, Peldschus K, Kaul MG, Tromsdorf UI, Weller H, Waurisch C, et al.2011 Brown adipose tissue activity controls triglyceride clearance. Nature Medicine 17 200–205. (https://doi.org/10.1038/nm.2297)
Bartelt A, John C, Schaltenberg N, Berbée JFP, Worthmann A, Cherradi ML, Schlein C, Piepenburg J, Boon MR, Rinninger F, et al.2017 Thermogenic adipocytes promote HDL turnover and reverse cholesterol transport. Nature Communications 8 15010. (https://doi.org/10.1038/ncomms15010)
Bligh EG & Dyer WJ 1959 A rapid method of total lipid extraction and purification. Canadian Journal of Biochemistry and Physiology 37 911–917. (https://doi.org/10.1139/y59-099)
Bobbioni-Harsch E, Assimacopoulos-Jeannet F & Jeanrenaud B 1994 Modifications of glucose and lipid metabolism in cold-acclimated lean and genetically obese rats. Journal of Applied Physiology 76 1106–1112. (https://doi.org/10.1152/jappl.1994.76.3.1106)
Bonde Y, Plösch T, Kuipers F, Angelin B & Rudling M 2012 Stimulation of murine biliary cholesterol secretion by thyroid hormone is dependent on a functional ABCG5/G8 complex. Hepatology 56 1828–1837. (https://doi.org/10.1002/hep.25861)
Bruinstroop E, la Fleur SE, Ackermans MT, Foppen E, Wortel J, Kooijman S, Berbée JFP, Rensen PCN, Fliers E & Kalsbeek A 2013 The autonomic nervous system regulates postprandial hepatic lipid metabolism. American Journal of Physiology – Endocrinology and Metabolism 304 E1089–E1096. (https://doi.org/10.1152/ajpendo.00614.2012)
Cannon B & Nedergaard J 2004 Brown adipose tissue: function and physiological significance. Physiological Reviews 84 277–359. (https://doi.org/10.1152/physrev.00015.2003)
Cha J-Y & Repa JJ 2007 The liver X receptor (LXR) and hepatic lipogenesis. Journal of Biological Chemistry 282 743–751. (https://doi.org/10.1074/jbc.M605023200)
Cunningham JJ, Gulino MA, Meara PA & Bode HH 1985 Enhanced hepatic insulin sensitivity and peripheral glucose uptake in cold acclimating rats. Endocrinology 117 1585–1589. (https://doi.org/10.1210/endo-117-4-1585)
Dentin R, Tomas-Cobos L, Foufelle F, Leopold J, Girard J, Postic C & Ferré P 2012 Glucose 6-phosphate, rather than xylulose 5-phosphate, is required for the activation of ChREBP in response to glucose in the liver. Journal of Hepatology 56 199–209. (https://doi.org/10.1016/j.jhep.2011.07.019)
Elzinga BM, Baller JFW, Mensenkamp AR, Yao Z, Agellon LB, Kuipers F & Verkade HJ 2003 Inhibition of apolipoprotein B secretion by taurocholate is controlled by the N-terminal end of the protein in rat hepatoma McArdle-RH7777 cells. Biochimica et Biophysica Acta 1635 93–103. (https://doi.org/10.1016/j.bbalip.2003.10.009)
Feillet C, Guérin S, Lonchampt M, Dacquet C, Gustafsson J-Å, Delaunay F & Teboul M 2016 Sexual dimorphism in circadian physiology is altered in LXRα deficient mice. PLOS ONE 11 e0150665. (https://doi.org/10.1371/journal.pone.0150665)
Flachs P, Adamcova K, Zouhar P, Marques C, Janovska P, Viegas I, Jones JG, Bardova K, Svobodova M, Hansikova J, et al.2017 Induction of lipogenesis in white fat during cold exposure in mice: link to lean phenotype. International Journal of Obesity 41 372–380. (https://doi.org/10.1038/ijo.2016.228)
Fraser R 1970 Size and lipid composition of chylomicrons of different Svedberg units of flotation. Journal of Lipid Research 11 60–65.
Friedrichsen S, Christ S, Heuer H, Schäfer MKH, Mansouri A, Bauer K & Visser TJ 2003 Regulation of iodothyronine deiodinases in the Pax8-/- mouse model of congenital hypothyroidism. Endocrinology 144 777–784. (https://doi.org/10.1210/en.2002-220715)
Goetzman ES, Tian L & Wood PA 2005 Differential induction of genes in liver and brown adipose tissue regulated by peroxisome proliferator-activated receptor-α during fasting and cold exposure in acyl-CoA dehydrogenase-deficient mice. Molecular Genetics and Metabolism 84 39–47. (https://doi.org/10.1016/j.ymgme.2004.09.010)
Goldstein JL, DeBose-Boyd RA & Brown MS 2006 Protein sensors for membrane sterols. Cell 124 35–46. (https://doi.org/10.1016/j.cell.2005.12.022)
Grefhorst A & Parks EJ 2009 Reduced insulin-mediated inhibition of VLDL secretion upon pharmacological activation of the liver X receptor in mice. Journal of Lipid Research 50 1374–1383. (https://doi.org/10.1194/jlr.M800505-JLR200)
Grefhorst A, Elzinga BM, Voshol PJ, Plösch T, Kok T, Bloks VW, Van Der Sluijs FH, Havekes LM, Romijn JA, Verkade HJ, et al.2002 Stimulation of lipogenesis by pharmacological activation of the liver X receptor leads to production of large, triglyceride-rich very low density lipoprotein particles. Journal of Biological Chemistry 277 34182–34190. (https://doi.org/10.1074/jbc.M204887200)
Harris WS, Hustvedt BE, Hagen E, Green MH, Lu G & Drevon CA 1997 N-3 fatty acids and chylomicron metabolism in the rat. Journal of Lipid Research 38 503–515.
Hijmans BS, Grefhorst A, Oosterveer MH & Groen AK 2014 Zonation of glucose and fatty acid metabolism in the liver: mechanism and metabolic consequences. Biochimie 96 121–129. (https://doi.org/10.1016/j.biochi.2013.06.007)
Himms-Hagen J 1972 Lipid metabolism during cold-exposure and during cold-acclimation. Lipids 7 310–323. (https://doi.org/10.1007/BF02532649)
Iizuka K, Takeda J & Horikawa Y 2009 Glucose induces FGF21 mRNA expression through ChREBP activation in rat hepatocytes. FEBS Letters 583 2882–2886. (https://doi.org/10.1016/j.febslet.2009.07.053)
Iossa S, Barletta A & Liverini G 1994 Different effects of cold exposure and cold acclimation on rat liver mitochondrial fatty acid oxidation and ketone bodies production. International Journal of Biochemistry 26 425–431. (https://doi.org/10.1016/0020-711X(94)90063-9)
Ishii S, IIzuka K, Miller BC & Uyeda K 2004 Carbohydrate response element binding protein directly promotes lipogenic enzyme gene transcription. PNAS 101 15597–15602. (https://doi.org/10.1073/pnas.0405238101)
Kajimura S, Spiegelman BM & Seale P 2015 Brown and beige fat: physiological roles beyond heat generation. Cell Metabolism 22 546–559. (https://doi.org/10.1016/j.cmet.2015.09.007)
Khan BV, Fungwe TV, Wilcox HG & Heimberg M 1990 Cholesterol is required for the secretion of the very-low-density lipoprotein: in vivo studies. Biochimica et Biophysica Acta 1044 297–304. (https://doi.org/10.1016/0005-2760(90)90073-7)
Khedoe PPSJ, Hoeke G, Kooijman S, Dijk W, Buijs JT, Kersten S, Havekes LM, Hiemstra PS, Berbée JFP, Boon MR, et al.2015 Brown adipose tissue takes up plasma triglycerides mostly after lipolysis. Journal of Lipid Research 56 51–59. (https://doi.org/10.1194/jlr.M052746)
Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25 402–408. (https://doi.org/10.1006/meth.2001.1262)
Lu Y-F, Jin T, Xu Y, Zhang D, Wu Q, Zhang Y-KJ & Liu J 2013 Sex differences in the circadian variation of cytochrome p450 genes and corresponding nuclear receptors in mouse liver. Chronobiology International 30 1135–1143. (https://doi.org/10.3109/07420528.2013.805762)
Masoro EJ, Felts JM & Panagos SS 1957 Effect of prolonged cold exposure on hepatic lipogenesis. American Journal of Physiology 189 479–482. (https://doi.org/10.1152/ajplegacy.1957.189.3.479)
McBurney LJ & Radomski MW 1969 Metabolism of serum free fatty acid and low-density lipoproteins in the cold-acclimated rat. American Journal of Physiology 217 19–23. (https://doi.org/10.1152/ajplegacy.1969.217.1.19)
Radhakrishnan A, Goldstein JL, McDonald JG & Brown MS 2008 Switch-like control of SREBP-2 transport triggered by small changes in ER cholesterol: a delicate balance. Cell Metabolism 8 512–521. (https://doi.org/10.1016/j.cmet.2008.10.008)
Rasouli M & Zahraie M 2006 Suppression of VLDL associated triacylglycerol secretion by both alpha- and beta-adrenoceptor agonists in isolated rat hepatocytes. European Journal of Pharmacology 545 109–114. (https://doi.org/10.1016/j.ejphar.2006.06.066)
Rasouli M, Mosavi-Mehr M & Tahmouri H 2012 Liver denervation increases the levels of serum triglyceride and cholesterol via increases in the rate of VLDL secretion. Clinics and Research in Hepatology and Gastroenterology 36 60–65. (https://doi.org/10.1016/j.clinre.2011.09.012)
Russell DW 2003 The enzymes, regulation, and genetics of bile acid synthesis. Annual Review of Biochemistry 72 137–174. (https://doi.org/10.1146/annurev.biochem.72.121801.161712)
Sanderson LM, Degenhardt T, Koppen A, Kalkhoven E, Desvergne B, Müller M & Kersten S 2009 Peroxisome proliferator-activated receptor beta/delta (PPARbeta/delta) but not PPARalpha serves as a plasma free fatty acid sensor in liver. Molecular and Cellular Biology 29 6257–6267. (https://doi.org/10.1128/MCB.00370-09)
Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, et al.2000 Role of LXRs in control of lipogenesis. Genes and Development 14 2831–2838. (https://doi.org/10.1101/gad.850400)
Shore AM, Karamitri A, Kemp P, Speakman JR, Graham NS & Lomax MA 2013 Cold-induced changes in gene expression in brown adipose tissue, white adipose tissue and liver. PLoS ONE 8 e68933. (https://doi.org/10.1371/journal.pone.0068933)
Sotelo-Rivera I, Jaimes-Hoy L, Cote-Vélez A, Espinoza-Ayala C, Charli J-L & Joseph-Bravo P 2014 An acute injection of corticosterone increases thyrotrophin-releasing hormone expression in the paraventricular nucleus of the hypothalamus but interferes with the rapid hypothalamus pituitary thyroid axis response to cold in male rats. Journal of Neuroendocrinology 26 861–869. (https://doi.org/10.1111/jne.12224)
Stanulović VS, Kyrmizi I, Kruithof-de Julio M, Hoogenkamp M, Vermeulen JLM, Ruijter JM, Talianidis I, Hakvoort TBM & Lamers WH 2007 Hepatic HNF4alpha deficiency induces periportal expression of glutamine synthetase and other pericentral enzymes. Hepatology 45 433–444. (https://doi.org/10.1002/hep.21456)
Strowski MZ 2017 Impact of FGF21 on glycemic control. Hormone Molecular Biology and Clinical Investigation 30. (https://doi.org/10.1515/hmbci-2017-0001)
Teramura Y, Terao A, Okada Y, Tomida J, Okamatsu-Ogura Y & Kimura K 2014 Organ-specific changes in norepinephrine turnover against various stress conditions in thermoneutral mice. Japanese Journal of Veterinary Research 62 117–127. (https://doi.org/10.14943/jjvr.62.3.117)
van den Beukel JC, Grefhorst A, Quarta C, Steenbergen J, Mastroberardino PG, Lombès M, Delhanty PJ, Mazza R, Pagotto U, van der Lely AJ, et al.2014 Direct activating effects of adrenocorticotropic hormone (ACTH) on brown adipose tissue are attenuated by corticosterone. FASEB Journal 28 4857–4867. (https://doi.org/10.1096/fj.14-254839)
van den Beukel JC, Boon MR, Steenbergen J, Rensen PCN, Meijer OC, Themmen APN & Grefhorst A 2015 Cold exposure partially corrects disturbances in lipid metabolism in a male mouse model of glucocorticoid excess. Endocrinology 156 4115–4128. (https://doi.org/10.1210/en.2015-1092)
van der Hoorn FA, Boomsma F, Man in ’t Veld AJ & Schalekamp MA 1989 Determination of catecholamines in human plasma by high-performance liquid chromatography: comparison between a new method with fluorescence detection and an established method with electrochemical detection. Journal of Chromatography 487 17–28. (https://doi.org/10.1016/S0378-4347(00)83003-0)
Villarroya F, Cereijo R, Villarroya J & Giralt M 2017 Brown adipose tissue as a secretory organ. Nature Reviews Endocrinology 13 26–35. (https://doi.org/10.1038/nrendo.2016.136)
Wang GX, Zhao XY, Meng ZX, Kern M, Dietrich A, Chen Z, Cozacov Z, Zhou D, Okunade AL, Su X, et al.2014 The brown fat-enriched secreted factor Nrg4 preserves metabolic homeostasis through attenuation of hepatic lipogenesis. Nature Medicine 20 1436–1443. (https://doi.org/10.1038/nm.3713)
Watanabe M, Houten SM, Wang L, Moschetta A, Mangelsdorf DJ, Heyman RA, Moore DD & Auwerx J 2004 Bile acids lower triglyceride levels via a pathway involving FXR, SHP, and SREBP-1c. Journal of Clinical Investigation 113 1408–1418. (https://doi.org/10.1172/JCI21025)
Watanabe M, Houten SM, Mataki C, Christoffolete MA, Kim BW, Sato H, Messaddeq N, Harney JW, Ezaki O, Kodama T, et al.2006 Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation. Nature 439 484–489. (https://doi.org/10.1038/nature04330)
Wilcox HG & Heimberg M 1991 Effects of hyperthyroidism on synthesis, secretion and metabolism of the VLDL apoproteins by the perfused rat liver. Biochimica et Biophysica Acta 1081 246–252. (https://doi.org/10.1016/0005-2760(91)90278-P)
Willebrords J, Pereira IVA, Maes M, Crespo Yanguas S, Colle I, Van Den Bossche B, Da Silva TC, de Oliveira CPMS, Andraus W, Alves VA, et al.2015 Strategies, models and biomarkers in experimental non-alcoholic fatty liver disease research. Progress in Lipid Research 59 106–125. (https://doi.org/10.1016/j.plipres.2015.05.002)
Worthmann A, John C, Rühlemann MC, Baguhl M, Heinsen F-A, Schaltenberg N, Heine M, Schlein C, Evangelakos I, Mineo C, et al.2017 Cold-induced conversion of cholesterol to bile acids in mice shapes the gut microbiome and promotes adaptive thermogenesis. Nature Medicine 23 839–849. (https://doi.org/10.1038/nm.4357)
Wu J, Boström P, Sparks LM, Ye L, Choi JH, Giang A-H, Khandekar M, Virtanen KA, Nuutila P, Schaart G, et al.2012 Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 150 366–376. (https://doi.org/10.1016/j.cell.2012.05.016)
Wu W, Tsuchida H, Kato T, Niwa H, Horikawa Y, Takeda J & Iizuka K 2015 Fat and carbohydrate in western diet contribute differently to hepatic lipid accumulation. Biochemical and Biophysical Research Communications 461 681–686. (https://doi.org/10.1016/j.bbrc.2015.04.092)
Zhang Y & Klaassen CD 2010 Effects of feeding bile acids and a bile acid sequestrant on hepatic bile acid composition in mice. Journal of Lipid Research 51 3230–3242. (https://doi.org/10.1194/jlr.M007641)
Zilz ND, Murray MB & Towle HC 1990 Identification of multiple thyroid hormone response elements located far upstream from the rat S14 promoter. Journal of Biological Chemistry 265 8136–8143.
