Abstract
Fibroblast growth factor 21 (FGF21) is a metabolic regulator of energy and lipid metabolism. FGF21 is highly expressed in liver while FGF21 receptors (beta-klotho (KLB) and FGFR1c) are highly expressed in white adipose tissues (WATs). Plasma FGF21 has been shown to be increased after 7–10 days of fasting but oppositely plasma FGF21 is also increased in obesity. The aim of this study was to measure the effect of 60 h of fasting on plasma FGF21 levels in obese and lean subjects and to determine the gene expression of KLB and FGFR1c in the subcutaneous WAT before, during and after 60 h of fasting. Eight obese (BMI >30 kg/m2) and seven lean subjects (BMI <25 kg/m2) were fasted for 60 h and blood samples were taken at time 0 and after 12, 36 and 60 h of fasting. A biopsy from the subcutaneous WAT was taken at time 0, 12 and 60 h of fasting. FGF21 was measured in plasma by an ELISA and mRNA expression of KLB and FGFR1c was measured in WAT by quantitative PCR (qPCR). The fast significantly decreased plasma FGF21 in obese subjects while no change in plasma FGF21 was observed in lean subjects. Interestingly, KLB was significantly decreased in WAT in response to fasting in both lean and obese subjects indicating a potential important adaptive regulation of KLB in response to fasting.
Introduction
Fibroblast growth factor 21 (FGF21) was identified by Nishimura in 2000 (Nishimura et al. 2000) and is mainly expressed in liver and pancreas (Fon Tacer et al. 2010). FGF21 belongs to the FGF19 subfamily of endocrine FGFs (Fukumoto 2008). FGF21 binds the FGF receptor (FGFR) 1c and 3c but only in the presence of the co-receptor beta-klotho (KLB) (Suzuki et al. 2008) and tissue-specific expression of KLB determines the metabolic activity (Ogawa et al. 2007, Suzuki et al. 2008). The FGF21 receptors KLB and FGFR1c are highly expressed in the adipose tissue (Fon Tacer et al. 2010) and in very specific regions of the CNS (Bookout et al. 2013). FGF21 produces strong anti-diabetic, lipid-lowering and weight-reducing effects in pre-clinical models of type 2 diabetes and obesity (Kharitonenkov et al. 2005, 2007, Xu et al. 2009, Veniant et al. 2012). These findings have led to a significant interest in FGF21 as a therapeutic target for treatment of type 2 diabetes and obesity as reviewed in (Kharitonenkov & Adams 2014, Sonoda et al. 2017). However, the physiological role of FGF21 is still not fully understood.
In mice, plasma FGF21 has been found to be increased in response to fasting (Inagaki et al. 2007) and ketogenic diet (Badman et al. 2007) and FGF21 was therefore originally proposed to be the missing link in starvation by inducing lipolysis and ketogenesis (Reitman 2007). Adipocyte-derived free fatty acids (FFA) are strong inducers of hepatic Fgf21 expression via activation of peroxisome proliferator-activated receptor α (PPARα) and a feed forward loop was therefore suggested. In contrast, FGF21 has also been suggested to be involved in a negative feedback loop inhibiting lipolysis and in agreement with this hypothesis FGF21-knockout mice have increased lipolytic activity in response to fasting (Hotta et al. 2009) and growth hormone-induced lipolysis (Chen et al. 2011). Furthermore, in response to injection of FGF21 plasma FFA is acutely decreased in mice (Li et al. 2009). Plasma FGF21 is increased while FGF21 receptors in the adipose tissue have been shown to be decreased in obese mice (Fisher et al. 2010) in alignment with poor metabolic control and increased flux of FFA in obese mice. Interestingly, FGF21 receptors in adipose tissue have been shown to be decreased in northern elephant seals in response to fasting (Suzuki et al. 2015).
In humans, several studies have shown that 3 days of fasting does not alter plasma FGF21 in healthy lean subjects (Dushay et al. 2010, Andersen et al. 2011), while 7-day fast in patients with rheumatoid arthritis demonstrated a modest 74% increase in FGF21 levels (Galman et al. 2008). Moreover, a prolonged fasting of 10 days caused an approximately 3-fold increase in plasma FGF21 in normal to slightly overweight subjects (Galman et al. 2008, Fazeli et al. 2015). However, the increase in plasma FGF21 observed in response to 10 days of fasting did not increase thermogenic genes in the adipose tissue and a decrease in the metabolic rate and plasma adiponectin were observed (Fazeli et al. 2015). Noteworthy, a decrease in KLB in the adipose tissue was observed in response to the prolonged fast (Fazeli et al. 2015). Plasma FGF21 is also increased in obese and insulin-resistant subjects (Zhang et al. 2008, Chavez et al. 2009) and a correlation between FGF21 and the homeostatic model assessment for insulin resistance (HOMA-IR) has been observed in several studies (Zhang et al. 2008, Fazeli et al. 2015). Therefore, the regulation of plasma FGF21 is rather complex as plasma FGF21 is both increased in response to fasting and in obesity, and it is therefore unknown whether 3 days of fasting change plasma FGF21 in obese subjects. Furthermore, the potential regulation of FGF21 receptors in the adipose tissue in response to fasting in both lean and obese subjects has not previously been studied.
The aim of this study was to elucidate the effect of 60 h of fasting on plasma FGF21 in lean and obese subjects and to elucidate if the fast changes the expression of FGF21 receptors (BKL and FGFR1c) in subcutaneous white adipose tissue (WAT).
Materials and methods
The study was part of a previous study (Rasmussen et al. 2003). All subjects gave informed consent before participating. The study protocol was reviewed and approved by the Ethics Committee of Copenhagen County and was in compliance with the Declaration of Helsinki.
Subjects
Eight obese (BMI >30 kg/m2) and seven lean subjects (BMI <25 kg/m2) male volunteers participated in the study. All subjects were in good health, as assessed by medical history and physical examination and had maintained a stable weight for at least 6 months prior to the study. None of the study participants had diabetes or were taking any medication. The obese subjects tended to have higher fasting insulin levels and had significantly higher systolic blood pressure than the lean subjects (Rasmussen et al. 2003).
Sample collection
The day before the fasting was initiated, a plasma sample was collected 2 h after last meal (time 0 h). The next day, the prolonged fasting was initiated, and plasma was sampled in the morning after overnight fast (12 h), after 36 h and after 60 h of fasting. Subjects were instructed to avoid all food and drink except water, to avoid excessive exercise and smoking and to come to the laboratory by car or by bus. On each study day, the subjects rested for at least 15 min before samples were obtained. At time 0, 12 and 60 h of fasting, a percutaneous abdominal subcutaneous fat sample was obtained under local anesthesia (1% lidocaine without adrenaline) using a liposuction cannula (Tulip 4 mm, 30 cm; RMI B.V., Breda, The Netherlands). Approx. 150 mg of adipose tissue was obtained on each occasion. Samples were frozen in liquid nitrogen within 30 s of removal and were stored at −80°C until assayed.
Measurement of plasma FGF21
FGF21 plasma levels were measured using a commercial FGF21-specific human ELISA kit (BioVendor, Prague, Czech Republic). Plasma samples were diluted 1:1 and analyzed according to manufacturer’s instructions. The sensitivity was 7.0 pg/mL and both the intra-assay and interassay variability was 4.0%. For unknown reasons, one obese subject had no measurable FGF21 in any of the plasma samples and was therefore excluded from all data sets.
Quantitative real-time PCR
Total RNA was extracted from the adipose tissue using TRIzol (Invitrogen) and RNeasy mini kit (Qiagen) according to manufacturer’s instructions. cDNA was synthesized using iScript reverse transcription kit (BioRad). Quantitative real-time PCR was performed on an ABI 7900 Sequence Detection System (Applied Biosystems) using a LNA probe-based system from Roche. Primers were designed using Primer3 software (Table 1). All samples were run in triplicates and expression was calculated using the ΔΔCT method. Samples were normalized to the mean expression of GAPDH, 18S and Cyclophilin B (CYPB) expression.
Primer sequences used for quantitative real-time PCR.
| Gene | 5′–3′ sequencesa |
|---|---|
| KLB | F: ACGGCCATCTACATGATGAAR: CGTATTTCATCTAACCTTATTGCTTG |
| FGFR1c | F: ACAACCTGCCTTATGTCCAGAR: TCCATCTCTTTGTCGGTGGT |
| FGF21 | F: ATGGGGCCCTGTATGGATR: AAACATTGTATCCGTCCTCAAGA |
| GAPDH | F: AGCCACATCGCTCAGACACR: GCCCAATACGACCAAATCC |
| 18S | F:GCAATTATTCCCCATGAACGR: GGGACTTAATCAACGCAAGC |
| CYPB | F: CCCAGTTCTTCATCACGACAR: GTCTTGGTGCTCTCCACCTT |
aF, forward primer; R, reverse primer.
Statistical analysis
Statistical analyses of plasma FGF21 as well as BKL and FGFR1c mRNA expression were performed using SAS/STAT 14.3. Data were analyzed by a repeated-measures analysis with fixed effects of time, BMI status (obese, lean) and interaction between the two factors. An unstructured 4 × 4 covariance matrix was modeled. For each BMI status, the difference between time 60 and baseline (time 0) was estimated, and the difference in change from baseline was compared between BMI status. For additional information, the difference between time 36 and baseline and between time 12 and baseline were also estimated and compared between BMI statuses. Tissue samples were missing from 1 to 2 subjects in each group (varies between subjects and time points), which was taken into account using SAS/STAT 14.3. FGF21 and FFA plasma correlations were analyzed by Pearson correlation test using GraphPad Prism version 7 (GraphPad Software). Data analysis of plasma glucose, C-peptide, triglycerides (TGs) and FFA was performed with repeated-measures ANOVA with Dunnett’s post hoc test using GraphPad Prism, version 7. Significance was compared with the corresponding group and time point 0. Data are presented as means ± s.e.m., lean n = 6–7, obese n = 6–7, and the results were considered statistically significant for *P < 0.05, **P < 0.01, ***P < 0.005.
Results
The changes in plasma glucose, C-peptide, TG and FFA in response to the 60 h of fasting in lean and obese subjects can be seen in Table 2. The prolonged fasting caused a gradual decrease in blood glucose in both lean and obese subjects (Rasmussen et al. 2003). Plasma FFA and beta-hydroxybutyrate were increased in both lean and obese subjects; however, a greater increase was observed in the lean subjects (Rasmussen et al. 2003).
Metabolic changes in plasma in response to 60-h fasting in lean and obese subjects.
| 0 h | 12 h | 36 h | 60 h | |
|---|---|---|---|---|
| Lean subjects | ||||
| Age 29.3 ± 3.6 years BMI 22.8 ± 0.6 kg/m2 | ||||
| Glucose (mM) | 4.6 ± 0.3 | 4.4 ± 0.2 | 3.9 ± 0.1 | 3.2 ± 0.2*** |
| C-peptide (pM) | 953 ± 169 | 374 ± 47* | 207 ± 64*** | 223 ± 46*** |
| NEFA (mM) | 0.20 ± 0.04 | 0.34 ± 0.03* | 0.97 ± 0.16** | 1.31 ± 0.15*** |
| Triglycerides (mM) | 1.3 ± 0.2 | 1.1 ± 0.2 | 0.8 ± 0.1* | 0.9 ± 0.1 |
| Obese subjects | ||||
| Age 29.8 ± 2.9 years BMI 33.4 ± 1.0 kg/m2 | ||||
| Glucose (mM) | 5.2 ± 0.4 | 4.6 ± 0.3* | 4.5 ± 0.3* | 3.6 ± 0.2*** |
| C-peptide (pM) | 1333 ± 216 | 674 ± 77* | 499 ± 71** | 390 ± 57** |
| NEFA (mM) | 0.38 ± 0.08 | 0.55 ± 0.08 | 0.87 ± 0.03*** | 1.15 ± 0.07*** |
| Triglycerides (mM) | 1.9 ± 0.2 | 1.60 ± 0.3 | 1.4 ± 0.2 | 1.1 ± 0.2* |
Results are mean ± s.e.m., n = 7. Significance is compared with the corresponding group and time 0 h, *P < 0.05, **P < 0.01, ***P < 0.005 (repeated-measures ANOVA with Dunnett’s post hoc test).
Fasting decreases plasma FGF21 in obese subjects
Plasma FGF21 was increased albeit not significantly (P = 0.07) in obese subjects compared to lean subjects at time point 0 (Fig. 1A). In response to fasting, no significant changes in plasma FGF21 was observed in lean subjects (Fig. 1B) while plasma FGF21 gradually declined in obese subjects 296 ± 29 pg/mL (0 h), 230 ± 43 pg/mL (12 h), 154 ± 21 pg/mL (36 h) and 128 ± 18 pg/mL (60 h) (Fig. 1C). The decline in plasma FGF21 was significantly decreased after 36 and 60 h of fasting. At 60 h of fasting, plasma FGF21 tended to be higher in lean subjects (205 ± 45 pg/mL) compared to obese subject (128 ± 18 pg/mL), but this was not statistically significant. Also, a trend toward an increase in plasma FGF21 was observed in the lean subjects from 36 h (145 ± 34 pg/mL) to 60 h (205 ± 45 pg/mL) of fasting. This was however driven by one subject in the lean group where FGF21 increased from 86 pg/mL at t = 0 h to 383 pg/mL after 60 h of fasting as seen in Fig. 1D. Individual graphs of plasma FGF21 during fasting in obese subjects are shown in Fig. 1E.
Changes in plasma FGF21 in lean and obese subjects during fasting. Plasma FGF21 in lean (open bars) and obese subjects (closed bars) at time point 0 h (A). Changes in plasma FGF21 during fasting in lean (B) and in obese (C) subjects. Individual plasma levels of FGF21 during fasting in lean (D) and obese (E) subjects. Results (A, B, and C) are mean ± s.e.m., analyzed by repeated-measures analysis, n = 7. * denotes statistically significant differences at **P < 0.01.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0002
Fasting decreases the expression of KLB and FGFR1c in subcutaneous WAT in lean and obese subjects
The mRNA expression of KLB and FGFR1c were similar between lean and obese subjects in the basal state (0 h). In both lean and obese subjects KLB mRNA expression significantly decreased with fasting (Fig. 2A and B). A five-fold decrease was observed after 60 h of fasting in obese subjects, while a six-fold decrease was observed in lean subjects. Fasting also caused a small decrease in FGFR1c expression in both lean and obese subjects (Fig. 2C and D), but the changes were only significant after 60 h of fasting. Almost none of the samples had any expression of FGF21 before, during or after the 60-h fast (data not shown).
Expression of BKL is downregulated in adipose tissue upon fasting. mRNA expression of Beta-klotho (KLB) in lean (A) and obese (B) subjects during fasting. Changes in fibroblast growth factor receptor-1c (FGFR1c) in lean (C) and obese (D) subjects during fasting. Results are mean ± s.e.m., analyzed by repeated-measures analysis, n = 5–7, * denotes statistically significant differences at *P < 0.05, **P < 0.01, ***P < 0.005.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0002
Plasma FGF21 correlations
As FGF21 has been proposed to be a negative regulator of FFA (Chen et al. 2011, Park et al. 2016), plasma FGF21 levels were correlated to plasma FFA at time 0, 12, 36 and 60 h of fasting. However, as seen in Fig. 3 no significant correlations between plasma FGF21 and FFA was found at any given time points in any of the groups. However, in general at t = 0 h higher FFA trended to correlate with higher FGF21, but this trend was lost during fasting and at 60 h of fasting an inverse correlation between FGF21 and FFA was seen in obese subjects (Fig. 3D), this did however not reach significance (P = 0.0788). Furthermore, no significant correlations were observed between plasma FGF21 and glucose, plasma FGF21 and C-peptide or plasma FGF21 and TG at any time points in lean or obese subjects (data not shown).
Plasma FGF21 and FFA correlation during fasting. Plasma FGF21 and FFA correlation at time 0 h (A), time 12 h (B), time 36 h (C) and time 60 h (D). Lean subjects (open circles) and obese subjects (close squares), n = 7. Data are analyzed with Pearsons correlations test.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0002
Discussion
This study shows that plasma FGF21 is differently regulated in lean and obese subjects upon short-term fasting. In agreement with previous studies, 3 days of fasting in humans did not change plasma FGF21 in lean subjects. However, in obese subjects, fasting decreased plasma FGF21 to the levels observed in lean subjects and at 60 h the plasma FGF21 levels were even slightly lower in the obese subjects compared to lean subjects. This seems however to be due to a slight increase in plasma FGF21 from time 36 to 60 h in the lean subjects but the increase was driven by one subject in the lean group.
The decrease in plasma FGF21 in obese subjects may reflect an improvement in the metabolic status as observed during short-term fasting (Patterson & Sears 2017) or after bariatric surgery (Runkel & Brydniak 2016). In response to bariatric surgery, a decrease in fasting plasma FGF21 has also been described (Fjeldborg et al. 2017). The decrease in plasma FGF21 in our study occurs despite an approximately three-fold increase in FFA (Rasmussen et al. 2003) in obese subjects during the 60 h of fasting and indicate that other factors such as hepatic steatosis may regulate plasma FGF21 (Li et al. 2010, Yan et al. 2011). In agreement with this plasma TG, which must arise from the liver in the fasted state, are decreased approximately two-fold in the obese subjects while plasma triglycerides at the end of the fast are unchanged in the lean subjects. This study only included seven subjects in each group and no statistically significant correlations between FGF21 and FFA were observed at any time points. Additional studies are required to address if a potential correlation between FGF21 and FFA is altered by fasting in lean and obese subjects.
From this study, it was not possible to determine which tissue was responsible for the circulating FGF21, as liver biopsies were not obtained, but the liver has been shown to be the major contributor to plasma FGF21 (Markan et al. 2014). However, the increased fat mass, which has been shown to express FGF21 in obese subjects (Muise et al. 2008) may also have contributed to the decrease in plasma FGF21 levels, but like other studies (Vienberg et al. 2012), we were unable to detect any FGF21 mRNA expression in human WAT in the basal state (non-insulin stimulated), and this was independent of the time of sampling and BMI.
During starvation the human body primarily burns FFAs from body fat stores, along with small amounts of muscle tissue to provide energy for the brain. FGF21 has been suggested to be part of a negative feedback loop where FFA stimulates hepatic FGF21 expression and secondary FGF21 decreases lipolysis in adipose tissue (Chen et al. 2011); interestingly, a downregulation of KLB has been reported in fasting northern elephant seals (Suzuki et al. 2015) potentially diminishing the inhibitory effect of FGF21 on lipolysis. In this study, a significant downregulation of KLB was observed in response to 60 h of fasting independent of BMI indicating that regulation of FGF21 receptor BKL in WAT could play an important adaptive role in response to fasting in humans. Similar findings have previously been described in humans fasted for 10 days where a three-fold decrease in BKL was observed in WAT (Fazeli et al. 2015). In agreement with the down regulation of BKL, a decrease in thermogenesis and plasma adiponectin, pharmacological effects of FGF21, were observed (Fazeli et al. 2015). Fazeli et al. also showed that PGC-1α, a classical FGF21 target gene in WAT (Fisher et al. 2012), is downregulated in humans fasted for 10 days. A weakness of our study is the lack of FGF21 target genes measurements in the adipose tissue during fasting as this would have indicated whether the significant and time-dependent decrease in KLB had caused a decrease in FGF21 activity in the adipose tissue as observed in the study by Fazeli et al. (2015). Another weakness is lack of BKL protein determination in WAT, however, Markan et al. has previously shown that the mRNA expression of KLB correlated well with the protein level (Markan et al. 2017).
Collectively, downregulation of KLB during fasting might be seen as an adaptive mechanism adjusting energy homeostasis e.g. lipolysis to the fasting condition. The decrease in plasma FGF21 observed in the obese subjects during the 60 h of fasting may correlate to a decrease in plasma TG reflecting an improvement in hepatic TG content, but the exact mechanism for why short-term fasting decreases plasma FGF21 in obese subjects needs to be further elucidated.
Declaration of interest
B A is an employee and minor stock holder of Novo Nordisk A/S.
Funding
The original study was supported by grants from Niels and Desirè Ydes Foundation, Toyota Fonden, Denmark and the Novo Nordisk Foundation.
Author contribution statement
E B N performed the measurements, analyzed the data and wrote the manuscript. C Ø, T A and H V contributed to the design of the study and reviewed the manuscript. B A conceived the idea, performed the measurements, analyzed the data and wrote the manuscript.
Acknowledgements
Mads Rasmussen is acknowledged for conduction of the original study and to allow further analysis of the samples. Bettina Bonnichsen is acknowledged for her technical support. Søren Andersen is acknowledged for statistical analysis.
References
Andersen B, Beck-Nielsen H & Hojlund K 2011 Plasma FGF21 displays a circadian rhythm during a 72-h fast in healthy female volunteers. Clinical Endocrinology 75 514–519. (https://doi.org/10.1111/j.1365-2265.2011.04084.x)
Badman MK, Pissios P, Kennedy AR, Koukos G, Flier JS & Maratos-Flier E 2007 Hepatic fibroblast growth factor 21 is regulated by PPARalpha and is a key mediator of hepatic lipid metabolism in ketotic states. Cell Metabolism 5 426–437. (https://doi.org/10.1016/j.cmet.2007.05.002)
Bookout AL, de Groot MH, Owen BM, Lee S, Gautron L, Lawrence HL, Ding X, Elmquist JK, Takahashi JS, Mangelsdorf DJ, et al.2013 FGF21 regulates metabolism and circadian behavior by acting on the nervous system. Nature Medicine 19 1147–1152. (https://doi.org/10.1038/nm.3249)
Chavez AO, Molina-Carrion M, Abdul-Ghani MA, Folli F, Defronzo RA & Tripathy D 2009 Circulating fibroblast growth factor-21 is elevated in impaired glucose tolerance and type 2 diabetes and correlates with muscle and hepatic insulin resistance. Diabetes Care 32 1542–1546. (https://doi.org/10.2337/dbib9-0684)
Chen W, Hoo RL, Konishi M, Itoh N, Lee PC, Ye HY, Lam KS & Xu A 2011 Growth hormone induces hepatic production of fibroblast growth factor 21 through a mechanism dependent on lipolysis in adipocytes. Journal of Biological Chemistry 286 34559–34566. (https://doi.org/10.1074/jbc.M111.285965)
Dushay J, Chui PC, Gopalakrishnan GS, Varela-Rey M, Crawley M, Fisher FM, Badman MK, Martinez-Chantar ML & Maratos-Flier E 2010 Increased fibroblast growth factor 21 in obesity and nonalcoholic fatty liver disease. Gastroenterology 139 456–463. (https://doi.org/10.1053/j.gastro.2010.04.054)
Fazeli PK, Lun M, Kim SM, Bredella MA, Wright S, Zhang Y, Lee H, Catana C, Klibanski A, Patwari P, et al. 2015 FGF21 and the late adaptive response to starvation in humans. Journal of Clinical Investigation 125 4601–4611. (https://doi.org/10.1172/JCI83349)
Fisher FM, Chui PC, Antonellis PJ, Bina HA, Kharitonenkov A, Flier JS & Maratos-Flier E 2010 Obesity is a fibroblast growth factor 21 (FGF21)-resistant state. Diabetes 59 2781–2789. (https://doi.org/10.2337/db10-0193)
Fisher FM, Kleiner S, Douris N, Fox EC, Mepani RJ, Verdeguer F, Wu J, Kharitonenkov A, Flier JS, Maratos-Flier E, et al.2012 FGF21 regulates PGC-1alpha and browning of white adipose tissues in adaptive thermogenesis. Genes and Development 26 271–281. (https://doi.org/10.1101/gad.177857.111)
Fjeldborg K, Pedersen SB, Moller HJ & Richelsen B 2017 Reduction in serum fibroblast growth factor-21 after gastric bypass is related to changes in hepatic fat content. Surgery for Obesity and Related Diseases 13 1515–1523. (https://doi.org/10.1016/j.soard.2017.03.033)
Fon Tacer K, Bookout AL, Ding X, Kurosu H, John GB, Wang L, Goetz R, Mohammadi M, Kuro-o M, Mangelsdorf DJ, et al.2010 Research resource: comprehensive expression atlas of the fibroblast growth factor system in adult mouse. Molecular Endocrinology 24 2050–2064. (https://doi.org/10.1210/me.2010-0142)
Fukumoto S 2008 Actions and mode of actions of FGF19 subfamily members. Endocrine Journal 55 23–31. (https://doi.org/10.1507/endocrj.KR07E-002)
Galman C, Lundasen T, Kharitonenkov A, Bina HA, Eriksson M, Hafstrom I, Dahlin M, Amark P, Angelin B & Rudling M 2008 The circulating metabolic regulator FGF21 is induced by prolonged fasting and PPARalpha activation in man. Cell Metabolism 8 169–174. (https://doi.org/10.1016/j.cmet.2008.06.014)
Hotta Y, Nakamura H, Konishi M, Murata Y, Takagi H, Matsumura S, Inoue K, Fushiki T & Itoh N 2009 Fibroblast growth factor 21 regulates lipolysis in white adipose tissue but is not required for ketogenesis and triglyceride clearance in liver. Endocrinology 150 4625–4633. (https://doi.org/10.1210/en.2009-0119)
Inagaki T, Dutchak P, Zhao G, Ding X, Gautron L, Parameswara V, Li Y, Goetz R, Mohammadi M, Esser V, et al.2007 Endocrine regulation of the fasting response by PPARalpha-mediated induction of fibroblast growth factor 21. Cell Metabolism 5 415–425. (https://doi.org/10.1016/j.cmet.2007.05.003)
Kharitonenkov A & Adams AC 2014 Inventing new medicines: the FGF21 story. Molecular Metabolism 3 221–229. (https://doi.org/10.1016/j.molmet.2013.12.003)
Kharitonenkov A, Shiyanova TL, Koester A, Ford AM, Micanovic R, Galbreath EJ, Sandusky GE, Hammond LJ, Moyers JS, Owens RA, et al.2005 FGF-21 as a novel metabolic regulator. Journal of Clinical Investigation 115 1627–1635. (https://doi.org/10.1172/JCI23606)
Kharitonenkov A, Wroblewski VJ, Koester A, Chen YF, Clutinger CK, Tigno XT, Hansen BC, Shanafelt AB & Etgen GJ 2007 The metabolic state of diabetic monkeys is regulated by fibroblast growth factor-21. Endocrinology 148 774–781. (https://doi.org/10.1210/en.2006-1168)
Li X, Ge H, Weiszmann J, Hecht R, Li YS, Veniant MM, Xu J, Wu X, Lindberg R & Li Y 2009 Inhibition of lipolysis may contribute to the acute regulation of plasma FFA and glucose by FGF21 in ob/ob mice. FEBS Letters 583 3230–3234. (https://doi.org/10.1016/j.febslet.2009.09.012)
Li H, Fang Q, Gao F, Fan J, Zhou J, Wang X, Zhang H, Pan X, Bao Y, Xiang K, et al.2010 Fibroblast growth factor 21 levels are increased in nonalcoholic fatty liver disease patients and are correlated with hepatic triglyceride. Journal of Hepatology 53 934–940. (https://doi.org/10.1016/j.jhep.2010.05.018)
Markan KR, Naber MC, Ameka MK, Anderegg MD, Mangelsdorf DJ, Kliewer SA, Mohammadi M & Potthoff MJ 2014 Circulating FGF21 is liver derived and enhances glucose uptake during refeeding and overfeeding. Diabetes 63 4057–4063. (https://doi.org/10.2337/db14-0595)
Markan KR, Naber MC, Small SM, Peltekian L, Kessler RL & Potthoff MJ 2017 FGF21 resistance is not mediated by downregulation of beta-klotho expression in white adipose tissue. Molecular Metabolism 6 602–610. (https://doi.org/10.1016/j.molmet.2017.03.009)
Muise ES, Azzolina B, Kuo DW, El-Sherbeini M, Tan Y, Yuan X, Mu J, Thompson JR, Berger JP & Wong KK 2008 Adipose fibroblast growth factor 21 is up-regulated by peroxisome proliferator-activated receptor gamma and altered metabolic states. Molecular Pharmacology 74 403–412. (https://doi.org/10.1124/mol.108.044826)
Nishimura T, Nakatake Y, Konishi M & Itoh N 2000 Identification of a novel FGF, FGF-21, preferentially expressed in the liver. Biochimica et Biophysica Acta 1492 203–206. (https://doi.org/10.1016/S0167-4781(00)00067-1)
Ogawa Y, Kurosu H, Yamamoto M, Nandi A, Rosenblatt KP, Goetz R, Eliseenkova AV, Mohammadi M & Kuro-o M 2007 BetaKlotho is required for metabolic activity of fibroblast growth factor 21. PNAS 104 7432–7437. (https://doi.org/10.1073/pnas.0701600104)
Park JG, Xu X, Cho S, Hur KY, Lee MS, Kersten S & Lee AH 2016 CREBH-FGF21 axis improves hepatic steatosis by suppressing adipose tissue lipolysis. Scientific Reports 6 27938. (https://doi.org/10.1038/srep27938)
Patterson RE & Sears DD 2017 Metabolic effects of intermittent fasting. Annual Review of Nutrition 37 371–393. (https://doi.org/10.1146/annurev-nutr-071816-064634)
Rasmussen M, Almdal T, Bratholm P & Christensen NJ 2003 Elevated beta2-adrenoceptor protein concentration in adipose tissue from obese subjects is closely related to the body mass index and waist/hip ratio. Clinical Science 104 93–102. (https://doi.org/10.1042/cs1040093)
Reitman ML 2007 FGF21: a missing link in the biology of fasting. Cell Metabolism 5 405–407. (https://doi.org/10.1016/j.cmet.2007.05.010)
Runkel N & Brydniak R 2016 Surgical treatment of metabolic syndrome. Visceral Medicine 32 352–356. (https://doi.org/10.1159/000449110)
Sonoda J, Chen MZ & Baruch A 2017 FGF21-receptor agonists: an emerging therapeutic class for obesity-related diseases. Hormone Molecular Biology and Clinical Investigation 30 20170002. (https://doi.org/10.1515/hmbci-2017-0002)
Suzuki M, Uehara Y, Motomura-Matsuzaka K, Oki J, Koyama Y, Kimura M, Asada M, Komi-Kuramochi A, Oka S & Imamura T 2008 betaKlotho is required for fibroblast growth factor (FGF) 21 signaling through FGF receptor (FGFR) 1c and FGFR3c. Molecular Endocrinology 22 1006–1014. (https://doi.org/10.1210/me.2007-0313)
Suzuki M, Lee AY, Vazquez-Medina JP, Viscarra JA, Crocker DE & Ortiz RM 2015 Plasma FGF21 concentrations, adipose fibroblast growth factor receptor-1 and beta-klotho expression decrease with fasting in northern elephant seals. General and Comparative Endocrinology 216 86–89. (https://doi.org/10.1016/j.ygcen.2015.03.009)
Veniant MM, Komorowski R, Chen P, Stanislaus S, Winters K, Hager T, Zhou L, Wada R, Hecht R & Xu J 2012 Long-acting FGF21 has enhanced efficacy in diet-induced obese mice and in obese rhesus monkeys. Endocrinology 153 4192–4203. (https://doi.org/10.1210/en.2012-1211)
Vienberg SG, Brons C, Nilsson E, Astrup A, Vaag A & Andersen B 2012 Impact of short-term high-fat feeding and insulin-stimulated FGF21 levels in subjects with low birth weight and controls. European Journal of Endocrinology 167 49–57. (https://doi.org/10.1530/EJE-12-0039)
Xu J, Lloyd DJ, Hale C, Stanislaus S, Chen M, Sivits G, Vonderfecht S, Hecht R, Li YS, Lindberg RA, et al.2009 Fibroblast growth factor 21 reverses hepatic steatosis, increases energy expenditure, and improves insulin sensitivity in diet-induced obese mice. Diabetes 58 250–259. (https://doi.org/10.2337/db08-0392)
Yan H, Xia M, Chang X, Xu Q, Bian H, Zeng M, Rao S, Yao X, Tu Y, Jia W, et al.2011 Circulating fibroblast growth factor 21 levels are closely associated with hepatic fat content: a cross-sectional study. PLoS ONE 6 e24895. (https://doi.org/10.1371/journal.pone.0024895)
Zhang X, Yeung DC, Karpisek M, Stejskal D, Zhou ZG, Liu F, Wong RL, Chow WS, Tso AW, Lam KS, et al.2008 Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes 57 1246–1253. (https://doi.org/10.2337/db07-1476)
