Abstract
Pharmacological studies have suggested hypothalamic phosphodiesterase-3B to mediate leptin and insulin action in regulation of energy homeostasis. Whereas Pde3b-null mice show altered energy homeostasis, it is unknown whether this is due to ablation of Pde3b in the hypothalamus. Thus, to address the functional significance of hypothalamic phosphodiesterase-3B, we used Pde3b flox/flox and Nkx2.1-Cre mice to generate Pde3b Nkx2.1KD mice that showed 50% reduction of phosphodiesterase-3B in the hypothalamus. To determine the effect of partial ablation of phosphodiesterase-3B in the hypothalamus on energy and glucose homeostasis, males and females were subjected to either a low- or high-fat diet for 19–21 weeks. Only female but not male Pde3b Nkx2.1KD mice on the low-fat diet showed increased body weight from 13 weeks onward with increased food intake, decreased fat pad weights and hypoleptinemia. Glucose tolerance was improved in high-fat diet-fed male Pde3b Nkx2.1KD mice in association with decreased phosphoenolpyruvate carboxykinase-1 and glucose-6-phosphatase mRNA levels in the liver. Also, insulin sensitivity was increased in male Pde3b Nkx2.1KD mice on the low-fat diet. Changes in body weight or in glucose homeostasis were not associated with any alteration in hypothalamic proopiomelanocortin, neuropepide Y and agouti-related peptide mRNA levels. These results suggest that partial loss of phosphodiesterase-3B in the hypothalamus produces a sex-specific response in body weight and glucose homeostasis, and support a role, at least in part, for hypothalamic phosphodiesterase-3B in regulation of energy and glucose homeostasis in mice.
Introduction
Hypothalamus is the critical site of integration for the central and peripheral signals in regulation of energy and glucose homeostasis. Leptin and insulin are the two most important peripheral signals that play obligatory role in body weight regulation and glucose homeostasis by acting at the level of the hypothalamus (Schwartz et al. 2000, Sahu 2003, 2004, Morton et al. 2006, Myers & Olson 2012, Timper & Bruning 2017). Thus, signaling molecules that mediate actions of leptin and/or insulin in the hypothalamus are expected to play a significant role in energy and glucose homeostasis. In this regard, phosphatidylinositol-3 kinase (PI3K)-Akt pathway (Niswender et al. 2003) and several signaling molecules downstream of Akt – including the mammalian target of rapamycin/S6 kinase (Avruch et al. 2006, Manning & Cantley 2007) and forkhead box O1 (FoxO1) (Accili & Arden 2004) – have been implicated for insulin signaling in the hypothalamus and energy homeostasis (Kim et al. 2006, Kitamura et al. 2006, Ono et al. 2008, Woods et al. 2008, Watterson et al. 2013). On the other hand, leptin action in the hypothalamus is mediated through several intracellular signaling pathways including Jak2-Stat3, PI3K and mTOR-S6K pathways (Vaisse et al. 1996, Niswender et al. 2001, Zhao et al. 2002, Myers et al. 2008, Woods et al. 2008, Rahmouni et al. 2009). However, our laboratory has demonstrated that, as shown in peripheral tissues, particularly in the adipose tissue and liver (Zhao et al. 2000, Shakur et al. 2001, Bender & Beavo 2006, Conti & Beavo 2007, Degerman et al. 2011), leptin and insulin signaling in the hypothalamus is also mediated through an activation of phosphodiesterase-3B (PDE3B) and regulation of cAMP (Zhao et al. 2002, Sahu 2011, Sahu et al. 2017).
Cyclic nucleotide phosphodiesterases are a large superfamily of enzymes, encoded by at least 21 different genes sub-grouped into 11 families (Bender & Beavo 2006, Conti & Beavo 2007). PDE3B, one of the two members of the type 3 PDE genes, exhibits high affinities for both cAMP and cGMP, with the former being the preferred substrate. Thus, increased PDE3B activity decreases cAMP levels by degradation of cAMP to 5’-AMP (Bender & Beavo 2006, Conti & Beavo 2007). Accordingly, we have shown that leptin- and insulin-induced PDE3B activity was associated with decreased cAMP levels in the hypothalamus (Zhao et al. 2002, Sahu et al. 2017). PDE3B, initially identified in adipose tissue and liver, was subsequently found in a variety of tissues, including the hypothalamus. Specifically, we have demonstrated that (i) PDE3B is expressed in the hypothalamic arcuate nucleus, ventromedial nucleus, dorsomedial nucleus, lateral hypothalamic areas, paraventricular nucleus and perifornical hypothalamic areas (Sahu 2003, Sahu et al. 2011) that are involved in energy and glucose homeostasis; (ii) PDE3B is expressed in proopiomelanocortin (Pomc)- and neuropeptide Y (Npy)/agouti-related peptide (Agrp)-expressing neurons (Sahu et al. 2011) that are the targets of both leptin and insulin signaling (Schwartz et al. 2000, Sahu 2003, 2004, Morton et al. 2006, Myers & Olson 2012, Timper & Bruning 2017); (iii) both leptin and insulin increase the activity of PDE3B in the hypothalamus (Zhao et al. 2002, Sahu 2011, Sahu et al. 2017); and (iv) prior administration of a specific PDE3 inhibitor cilostamide reverses the anorectic and body weight-reducing effects of leptin and insulin (Zhao et al. 2002, Sahu 2011, Sahu et al. 2017). Whereas these findings suggest a potential role for the PDE3B in mediating leptin and insulin signaling in the hypothalamus in the regulation of energy homeostasis, the physiological role of hypothalamic PDE3B in energy and glucose homeostasis is yet to be established.
Notably, alteration in regulation of energy homeostasis along with metabolic dysregulation, including systemic insulin resistance, has been reported in Pde3b-null mice (Choi et al. 2006). However, because PDE3B is expressed in variety of tissues including adipocytes, liver, pancreatic beta cells and the hypothalamus (Zhao et al. 2000, Shakur et al. 2001, Bender & Beavo 2006, Conti & Beavo 2007, Degerman et al. 2011, Sahu et al. 2011), that have been implicated in energy and glucose homeostasis, it is unknown whether the phenotype of Pde3b-null mice were due to Pde3b deficiency in specific tissues. Thus, to begin to address the functional significance of Pde3b in vivo in a tissue-specific manner, in the present study we generated hypothalamus-specific PDE3B conditional knockout mice using the Cre-loxP system. First, we generated transgenic mice with a floxed PDE3B allele (Pde3b fl/fl ). Then, we generated mice with knockdown of PDE3B specifically in the hypothalamus, referred to as Pde3bfl/fl Nkx2.1-cre (Pde3b Nkx2.1KD) mice. We have analyzed the phenotype of this model at the level of energy and glucose homeostasis and here, we report sex-specific changes in these processes.
Materials and methods
Animals
Mice with loxP-flanked Pde3b alleles (Pde3b fl/fl ) were generated as described below. Nkx2.1-Cre mice, which are known to drive Cre expression in the hypothalamus and not in more caudal region of the brain (Xu et al. 2008), were obtained from the Jackson Laboratory. Mice were housed in a light- (lights on 06:00 –18:00 h) and temperature (22°C)-controlled room. Mice were placed on standard laboratory chow (Prolab RMH 2000; TestDiet, St Louis, MO, USA) at weaning and water was available ad libitum. Both males and females were used in this study unless indicated otherwise. All procedures were approved by the Institutional Animal Care and Use Committee of the University of Pittsburgh.
Generation of Pde3bflox/flox mice and hypothalamus-specific Pde3b-KO mice
To address the question whether loss-of-function of PDE3B in hypothalamic neurons modifies energy balance and glucose homeostasis, we used Cre-loxP technology, in which Pde3b fl/fl mice when crossed with mice carrying the appropriate Cre gene deletes exon 4 of the Pde3b gene (Fig. 1A). The deletion of exon 4 removes 140 nucleotides from the transcript. To generate Pde3b fl/fl mice, the Pde3b-targeting vector (PRPGS00 067 A D07 CSD) was purchased from CHORI (Children’s Hospital Oakland Research Institute, Oakland, CA) and the Mouse Biology Program (MBP) at UC Davis made a targeting B6 ES clone (Pde3b-2A11). The UC Davis MBP facility performed blastocyst injection. One founder male was bred with B6 females and produced eight pups, of which two males were heterozygous (Pde3b neo-flox/+ ). We bred Pde3b neo-flox/+ male mice with transgenic females carrying the Actin-FLPe transgene (B6.CgTg(ACTFLPe) 9205Dym/J; the Jackson Laboratory) to remove the frt-flanked Pgk-NEO cassette. Subsequently, we bred Pde3b flox/+ males and females and generated mice homozygous for a floxed Pde3b allele (Pde3b fl/fl ). Pde3b fl/fl mice were bred with C57Bl/6J mice (the Jackson Laboratory) for at least three generations before crossing with Cre-expressing mice. We crossed Pde3b fl/fl mice with the mice transgenic for Nkx2.1-Cre mice to generate Pde3b fl/+ and Pde3b fl/+ Nkx2.1-cre mice, which were subsequently crossed to generate Pde3b fl/fl littermate controls and Pde3b Nkx2.1KO mice for our studies.
Strategy for conditional inactivation of the Pde3b gene in specific neurons. (A) Schematic representation of the Pde3b-targeted ES clone with conditional Pde3b allele (Pde3b flox-neo ) (a), the conditional Pde3b allele after excision of the En2SA-Neo cassette by FLP recombinase (b), and the null Pde3b allele after Cre-mediated deletion (c). Legend: Boxes (E): coding exons. (B) Confirmation of the floxed Pde3b allele in DNA prepared from tail clips of pups obtained from breeding Pde3b fl/+ mice. MW: 100-bp ladder; WT: wild-type (~218 bp); fl/+:Pde3b fl/+ (~315 bp); fl/fl: Pde3b fl/fl littermates. (C) Pde3b deletion by Nkx2.1-cre: Ethidium bromide staining of 1% agarose gel showing delta band (~405 bp) and loxP (fl/fl; ~315 bp) bands in Pde3b Nkx2.1KD (Cre +) and fl/fl (Cre −) mice. Total RNA was isolated from tissues followed by reverse transcription and 40 cycles of PCR followed by electrophoresis in agarose gel. Delta bands were only seen in the medial basal hypothalamus (MBH) and cortex (Cort, very faint band), but not in other tissues. Cereb, cerebellum; BStem, brain stem; WAT, gonadal fat; MW, 100-bp ladder. 100 ng of cDNA was used for PCR. A full colour version of this figure is available at https://doi.org/10.1530/JOE-18-0304.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
We genotyped mice by PCR from DNA extracted from tail clips. Primer sequences used for genotyping of Pde3b fl/fl and Nkx2.1-Cre mice were as follows: Pde3b fl/fl , GTTGCAAGGAGC-TCTGAAGG (forward, PD5-fl-F); and AAAATGGTCGTGGACAGGAG (reverse, PD-w5-R); Nkx2.1-Cre, CCACAGGCACCCCACAAAAATG (forward) and GCCTGGCGATCCC-TGAACAT (reverse). Amplicon sizes for Pde3b fl/fl , WT and Nkx2.1-Cre were ~315, ~218 and ~666 bp, respectively.
Mouse studies
At 4 weeks of age, both male and female KO mice and their WT littermates were placed on either a diet of standard mouse chow (low-fat diet; LFD) (6% kcal as fat; F6 rodent diet, #8664; Harlan Teklad, Madison, WI, USA) or a HFD (58% kcal as fat; #D12331; Research Diets Inc.) for 19–21 weeks. Body weights were measured twice per week. Glucose and insulin tolerance tests were carried out between 13 and 16 weeks of dieting. Mice at 15–17 weeks of dieting were fasted overnight and blood was collected from tail bleeding to measure glucose levels (using Precision Xtra Strips, Abbott Diabetes are Inc., Alameda, CA, USA) and plasma levels of insulin. Food intake was measured during the last week of the study in animals that were individually housed for at least 1 week before the study. At the end of the study, fed glucose level was measured in blood collected from the tail using Precision Xtra Strips, and then the mice were killed by decapitation. The brains were removed immediately and medial basal hypothalamus (MBH) tissue was dissected out, frozen in liquid nitrogen and kept at −80°C until processed. Trunk blood was collected to determine circulating leptin levels. Epididymal fat (WAT), gonadal fat pad (in female), retroperitoneal fat (RP-fat), brown adipose tissue (BAT) and liver were dissected out, weighed, frozen in liquid nitrogen and kept at −80°C until processed.
In another cohort of mice, overnight-fasted males that were on a standard laboratory chow (Prolab RMH 2000) were killed by decapitation. The MBH and liver were dissected out, frozen in liquid nitrogen and kept at −80°C until processed for RNA and protein extraction as appropriate.
Metabolic measurements
Glucose was measured in blood collected from the tail using Precision Xtra Strips. Leptin and insulin levels were determined with ELISA kits (mouse insulin ELISA kit, Mercodia AB, Uppsala, Sweden; mouse/rat leptin Quantikine ELISA kit, R&D Systems Inc.). To measure glucose and insulin in fasting condition, blood was collected by tail bleeding in animals that were fasted for 16 h. For the fed animals, glucose was measured in the blood collected from the tail, and leptin was measured in the trunk blood. For glucose tolerance test (GTT), overnight-fasted mice were injected with d-glucose (2 g/kg body weight, i.p.) and glucose was measured before and 15, 30, 45, 60 and 120 min after injection. For insulin tolerance test (ITT), mice were fasted for 2 h and injected with human regular insulin (Humulin, 0.75 mIU/g body weight, i.p.; Eli Lilly and Company, Indianapolis, IN, USA). Blood glucose levels were measured before and at 15, 30, 45, 60 and 120 min after injection.
RNA extraction and real-time PCR
RNAs from the MBH, liver and BAT were extracted from male and female Pde3b Nkx2.1KO and control mice for Pomc, Npy and Agrp gene expression in the MBH, uncoupling protein 1 (Ucp1) gene expression in the BAT, and phosphoenolpyruvate carboxykinase 1 (Pck1) and glucose-6-phosphatase (G6pc) gene expression in the liver. In addition, Pde3b gene expression was examined in all tissues. Total RNA was extracted using TRIzol reagent (Life Technologies) and subjected to DNase treatment using RNase-Free DNase (Promega) according to the manufacturer’s protocol and re-extracted with TRIzol. Total RNA (1 µg) was reverse transcribed using a High Capacity cDNA RT Kit (Life Technologies). Real-time PCR with diluted cDNA (50 ng) was performed in duplicate using 2X Power SYBR Green PCR master mix (Life Technologies) containing 500 nm each primer and run on the Applied Biosystems Prism 7900HT real-time PCR machine at 95°C for 10 min followed by 40 cycles of 95°C (15 s) and 60°C (60 s). The primer sequences are as follows: Pomc (forward, atgccgagattctgctacagtc; reverse, ttcatctccgttgccaggaaacac); Npy (forward, cagaaaacgcccccagaa; reverse, aaaagtcggggaacaagtttcatt); Agrp (forward, cggaggtgctagatccacaga; reverse, aggactcgtgcagccttacac); Ucp1 (forward, aactgtacagcggtctgcct; reverse, taagccggctgagatcttgtt); Pck1 (forward, atgacaactgttggctggct; reverse, ctgaggccagttttggggat); G6pc (forward, gctggagtcttgtcaggcat; reverse, atccaagcgcgaaaccaaac); Pde3b (forward, atcgcagcagtggtaagagg; reverse, aaaggcccatttaggtggca); and Cyclophilin (forward, aaggtgaaagaaggcatgaac; reverse, agctgtccacagtcggaaatg). The relative quantification of mRNA levels (fold change) normalized to cyclophilin was calculated using the ΔΔCT method from the Ct (threshold cycle) values obtained from ABI SDS software package.
Tissue RT-PCR
To demonstrate Pde3b deletion in specific tissue, various tissues (hypothalamus, cortex, cerebellum, brainstem, liver and gonadal fat (WAT)) were dissected out from age-matched male Pde3b fl/fl and Pde3b Nkx2.1KO mice. Total RNA was isolated using TRIzol according to manufacturer instruction (Life Technologies). RNA was digested with RQ1-DNAse (Promega) followed by re-extraction with TRIzol. cDNA was synthesized from total RNA using a High Capacity RT-PCR kit (Life Technologies). cDNA (100 ng) was used for PCR to detect delta and fl/fl alleles using Pde3b fl/fl reverse primer (CATGCATCTGAAAACCCACA, PD-w3-R) in combination with two other Pde3b fl/fl primers (PD5-fl-F, PD-w5-R) as mentioned above.
Protein extraction and Western blotting
The tissues were lysed with a 1× lysis buffer (Cell Signaling) supplemented with phenyl-methylsulfonyl fluoride and a cocktail of protease and phosphatase inhibitors (Roche Diagnostics). Total protein concentration was determined using a BCA Protein Assay Kit (Pierce). Fifty micrograms of protein, unless indicated otherwise, were separated by SDS-PAGE (8% gel) and transferred to polyscreen polyvinylidene difluoride membranes. The membranes were then incubated overnight with anti-rabbit PDE3B antibody (3B N-T, dilution 1:1000, provided by Dr V C Manganiello, NIH, Choi et al. 2006) at 4°C followed by incubation for 60 min with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) at room temperature. Immunoreactive bands were visualized by Western Lightning chemoluminescence Reagent Plus-ECL as described by the manufacturer (Perkin Elmer). The membranes were stripped and then blotted with a monoclonal anti-β-actin antibody (dilution 1:40,000, Sigma). Images of the bands were scanned and analyzed using NIH IMAGE software (NIH). PDE3B levels were normalized to β-actin.
Statistical analyses
Values are given as means ± s.e.m. Statistical significance in body weight, GTT and ITT data was determined using repeated-measures two-way ANOVA with post hoc testing using Fisher’s least significant difference (LSD) (protected t-tests). All other data were analyzed by randomized one-way ANOVA followed by Fisher’s LSD (protected t-tests) to compare three or more groups or Student’s t test to compare two groups. All statistical analyses were done using GB-Stat software for the Macintosh (Dynamic Microsystems, Inc., Silver Spring, MD, USA). A P value of <0.05 was considered statistically significant.
Results
Generation of mice with specific disruption of Pde3b in Nkx2.1 neurons
To clarify the role of PDE3B in the hypothalamus in energy homeostasis and glucose homeostasis, we generated a conditional null allele by crossing Pde3b fl/fl with Nkx2.1-Cre mice. The resulting Pde3b fl/+ Nkx2.1-cre mice were crossed to Pde3b fl/fl mice, yielding Pde3b Nkx2.1KO, Pde3b fl/+ Nkx2.1-cre (heterozygous) and Pde3b fl/fl (control, hereafter termed wild-type or WT) mice. Finally, Pde3b Nkx2.1KO and Pde3b fl/fl mice that were used in the study were obtained by crossing each other. In mice, Nkx2.1-Cre has been shown to express mostly in the hypothalamus and very less in the cortex and lung (Xu et al. 2008). Although we did not include the lung in our screening, reverse transcription of RNA isolated from central and peripheral tissues followed by PCR amplification of the resulting cDNA revealed Nkx2.1-Cre expression mostly in the hypothalamus and some in cortex but not in other parts of the brain (cerebellum, brain stem) or in liver or WAT (Fig. 1). qPCR data showed ~50% decrease in Pde3b gene expression in the hypothalamus of Pde3b Nkx2.1KO mice as compared to control mice (Fig. 2A), but there was no change in Pde3b mRNA levels in the liver (Fig. 2B). Similarly, Western blotting with PDE3B-specific antibody showed ~50% decrease in PDE3B protein levels in the hypothalamus of Pde3b Nkx2.1KO mice (Fig. 2C and D). These results suggest a partial (50%) deficiency of Pde3b in the hypothalamus of Pde3b Nkx2.1KO mice; therefore, these mice were termed as Pde3b Nkx2.1KD (KD) mice indicating Pde3b knockdown instead of Pde3b knockout in the hypothalamus.
Partial Pde3b deletion by Nkx2.1-cre in the medial basal hypothalamus (MBH, A, B and C) but not in the liver (D). (A) Representative PDE3B and β-actin Western blots obtained from the hypothalamic extract. (B) Densitometric analysis of the immunoreactive bands for PDE3B. The values for PDE3B were expressed as ratio of β-actin. (C and D) Changes in Pde3b mRNA levels in the MBH (C) and liver (D) of male WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice as determined by qPCR. Values represent the mean ± s.e.m. for the number animals per group as indicated in parentheses. *P = 0.0073, **P < 0.0001 vs WT control group.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Changes in body weight (BW), tissue weight and metabolic parameters
Analyses with two-way ANOVA with repeated measures showed that in male Pde3b Nkx2.1KD mice on a LFD, BW was significantly higher than that of WT mice at 4–6 weeks of age but not thereafter (Fig. 3A). However, on a HFD, there was no significant difference in BW between the genotypes at any time points during the 18 weeks of dieting (Fig. 3B). In addition, we did not observe any difference in food intake or in fat or liver weights between the genotypes on a LFD or HFD (Fig. 4).
Changes in body weight in male and female WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice fed with a low-fat F6 diet (LFD) or a high-fat diet (HFD) for 17–18 weeks. Mice were exposed to LFD or HFD at the age of 4 weeks. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses. *P < 0.05, **P < 0.01 vs WT control group.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Changes in food intake and plasma glucose levels, and in fat pad and liver weights in male WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice fed with a LFD or HFD for 17–18 weeks. Mice were exposed to a LFD or HFD at the age of 4 weeks. (A) Food intake; (B) epididymal fat (WAT) weights; (C) retroperitoneal (RP)-fat weights, (D) brown adipose tissue (BAT) weight; (E) liver weights, and (F) fed plasma glucose levels in LFD-fed mice (n = 8 for WT and 10 for KD mice per group). (G) Food intake; (H) WAT weights; (I) RP-fat weights, (J) BAT weights; (K) liver weights, and (L) fed plasma glucose levels in HFD-fed mice (n = 8 for WT and 5 for KD mice per group). Values represent the mean ± s.e.m.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
In contrast, female Pde3b Nkx2.1KD mice on the LFD had significantly higher BW from 13 weeks of age onward (Fig. 3C), and although this was accompanied by increased food intake (Fig. 5A), the weights of fat, particularly that of WAT and BAT, but not the liver, were significantly decreased in these mice as compared to WT mice (Fig. 5C, D, F and G). In addition, Pde3b Nkx2.1KD mice on the HFD had significantly higher BW from 15 weeks of age onward (i.e. after approximately 11 weeks on the HFD) as compared to WT mice (Fig. 3D), which was however not associated with any change in food intake or tissue weights (Fig. 5J, K, L, M and N).
Changes in food intake and plasma glucose levels, and in fat pad and liver weights in female WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice fed with a LFD or HFD for 17–18 weeks. Mice were exposed to a LFD or HFD at the age of 4 weeks. (A) Food intake; (B) food intake per gram body weight (BW); (C) gonadal fat pad weights; (D) gonadal fat pad weight per gram BW; (E) RP-fat weights; (F) BAT weight; (G) BAT weight per gram BW; (H) liver weights, and (I) fed plasma glucose levels in LFD-fed mice (n = 11–12 for WT and 13 for KD mice per group). (J) Food intake; (K) gonadal fat pad weights; (L) RP-fat weights, (M) BAT weight; (N) liver weights, and (O) fed plasma glucose levels in HFD-fed mice (n = 8 for WT and 7 for KD mice per group). Values represent the mean ± s.e.m.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Because Pde3b-null mice show impaired glucose homeostasis (Choi et al. 2006), we performed a number of in vivo studies in Pde3b Nkx2.1KD mice and in control WT mice to assess whether partial ablation of PDE3B in hypothalamic neurons could lead to abnormalities in glucose homeostasis. First, we measured fed and fasted (16 h) glucose levels in the mice that were on either a LFD or HFD. Results showed that in males on the LFD, fed glucose levels were significantly increased (P = 0.0468) in Pde3b Nkx2.1KD mice as compared to WT mice (Fig. 4F). In females on the LFD, however, ad libitum-fed glucose levels were significantly decreased (P = 0.0481) in Pde3b Nkx2.1KD mice as compared to WT mice (Fig. 5I). In the HFD-fed animals, there was no change in fed glucose levels between the groups of either sex (Figs 4L and 5O). Also, there was no change in fasting glucose levels between genotypes of either sex on the LFD or HFD (Fig. 6). Second, we performed GTT and ITT in males and females. In males on the LFD, clearance of glucose during GTT was similar between genotypes (Fig. 7A), and those on the HFD, clearance of glucose was increased in the Pde3b Nkx2.1KD mice at 45, 60 and 120 min of i.p. glucose injection (Fig. 7D), which was confirmed with area under the curve analysis of the GTT (GTT-AUC) showing significant decrease (P = 0.0356) in GTT-AUC in these mice (Fig. 7E). In addition, in LFD-fed male mice, ITT showed that i.p. injection of insulin was more effective in reducing blood glucose levels at 15–60 min post injection in Pde3b Nkx2.1KD than in control WT mice (Fig. 7B). However, although area under the curve analysis for ITT (ITT-AUC) showed a trend toward a decrease in ITT-AUC (Fig. 7C), it was not statistically significant (P = 0.0734). In HFD-fed male mice, ITT did not reveal a significant difference between genotypes (Fig. 7F and G), except at 15 min post insulin injection when decrease in blood glucose level was significantly more in Pde3b Nkx2.1KD mice (P < 0.05) than in control mice (Fig. 7F). In female mice on the LFD or HFD, there was no change in either GTT or ITT between genotypes (Fig. 8).
Changes in blood glucose levels in overnight-fasted WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice on a LFD or HFD. (A and B) Glucose levels in males on the LFD (16 week) or HFD (16.5 week), respectively. (C and D) Glucose levels in females on the LFD (17 week) or HFD (15 week), respectively. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Changes in glucose tolerance (GTT) and insulin tolerance (ITT) in male WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice fed with a on a LFD or HFD. (A) GTT in overnight-fasted mice at 13 week on the diet. (B) ITTs in 2-h fasted mice at 14 week on the diet. (C) Area under the curve (AUC) for ITT in animals on LFD. (D) GTTs in overnight-fasted mice that were on the HFD for 15 week. (E) Area under the curve (AUC) for GTT in animals on the HFD. (F) ITTs in 2-h fasted mice at 14 week on the diet. (G) AUC for the ITT in the HFD-fed mice. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses. *P < 0.05, **P < 0.01 vs KD group.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Changes in glucose tolerance (GTT) and insulin tolerance (ITT) in female WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice fed with a LFD or HFD. (A) GTTs in overnight-fasted mice at 15 week on the diet. (B) ITTs in 2-h fasted mice at 16 week on the diet. (C) GTTs in overnight-fasted mice that were on the HFD for 13 week. (D) ITTs in 2-h fasted mice at 14 week on the diet. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Fasting plasma insulin levels measured from tail blood did not show any difference between Pde3b Nkx2.1KD and control mice of either sex on the LFD or HFD (Fig. 9). Fed plasma leptin levels, measured in trunk blood, were significantly decreased (P < 0.01) in LFD-fed female Pde3b Nkx2.1KD mice than in control WT mice (Fig. 10A). However, there was no change between genotypes in plasma leptin levels in females on the HFD (Fig. 10B) or in males on the LFD (Fig. 10C) or HFD (Fig. 10D).
Changes in circulating insulin levels in overnight-fasted WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice on a LFD or HFD. (A and B) Plasma insulin levels in females on a LFD (17 week) or HFD (15 week), respectively. (C and D) Plasma insulin levels in males on a LFD (16 week) or HFD (16.5 week), respectively. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Changes in circulating leptin levels in ad libitum fed WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice on a LFD or HFD. (A and B) Plasma leptin levels in females on a LFD or HFD, respectively. (C and D) Plasma leptin levels in males on a LFD or HFD, respectively. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Changes in gene expression of hypothalamic Npy, Agrp and Pomc, liver Pck1 and G6pc, and in BAT Ucp1
Because PDE3B is expressed in hypothalamic NPY/AgRP and POMC neurons that are known to mediate leptin and insulin action in regulation of energy and glucose homeostasis (Schwartz et al. 1992, Benoit et al. 2002, Morton et al. 2006, Sahu et al. 2011, Myers & Olson 2012, Timper & Bruning 2017), we measured gene expression of these neuropeptides. There was no change in hypothalamic Npy, Agrp or Pomc mRNA levels between genotypes of either sex on the LFD or HFD (Figs 11A, C and 12A, C). Although there was a tendency of an increase in Pomc mRNA levels in female Pde3b Nkx2.1KD mice fed with the HFD, it did not reach significannce (P = 0.0798, Fig. 12C). There was also no change in Npy or Pomc gene expression between genotypes in the hypothalamus of standard chow-fed males under fasting condition (Fig. 13A). However, Agrp gene expression was increased (P = 0.0567) in standard chow-fed male Pde3b Nkx2.1KD mice under fasting condition compared with WT mice (Fig. 13A).
Changes in hypothalamic Agrp, Npy and Pomc mRNA levels (A and C) and in liver Pck1 and G6pc mRNA levels (B and D) in male ad libitum fed WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice on a LFD (A and B) or HFD (C and D) as determined by qPCR. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Changes in hypothalamic Agrp, Npy and Pomc mRNA levels (A) and in liver Pck1 and G6pc mRNA levels (B) in female ad libitum fed WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice on a LFD (A and B) or HFD (C and D) as determined by qPCR. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
Changes in hypothalamic Agrp, Npy and Pomc mRNA levels (A) and in liver Pck1 and G6pc mRNA levels (B) in male ad libitum fed WT (fl/fl) and KD (Pde3b Nkx2.1KD) mice on a standard chow RMH diet as determined by qPCR. Values represent the mean ± s.e.m. for the number of animals per group as indicted in parentheses.
Citation: Journal of Endocrinology 239, 1; 10.1530/JOE-18-0304
To address if gluconeogenic gene expression was altered following partial ablation of Pde3b in the hypothalamus, we examined Pck1 and G6pc gene expression in the liver. In male LFD-fed group, there was no change in Pck1 or G6pc mRNA levels between genotypes (Fig. 11B). In male HFD-fed group, however, both Pck1 (P = 0.0086) and G6pc (P = 0.03) mRNA levels were significantly decreased in Pde3b Nkx2.1KD liver as compared to control liver (Fig. 11D). In females, there was no change in either Pck1 or G6pc mRNA levels in the liver between genotypes (Fig. 12B and D). Since UCP1 is involved in thermogenesis and energy expenditure (Inokuma et al. 2006, Sugimoto et al. 2014), we examined if Ucp1 gene expression was altered in BAT of female Pde3b Nkx2.1KD mice, which could explain increased BW (Fig. 3C and D) and food intake (Fig. 5A and B) seen in these animals. There was, however, no difference in Ucp1 mRNA levels in the BAT between genotypes (Fig. 12B and D).
Discussion
The PDE3B pathway has been demonstrated to mediate both leptin and insulin signaling in the hypothalamus (Zhao et al. 2002, Sahu 2011, Sahu et al. 2017); yet, the physiological role of this pathway in regulation of energy homeostasis is completely unknown. To this end, in the present study, we aimed to unravel the in vivo metabolic consequences of disrupting PDE3B signaling in the hypothalamus. For this purpose, we employed the Cre-loxP strategy and crossed Pde3b fl/fl mice, which have loxP sites flanking exon 3 of the Pde3b gene, with Nkx2.1-Cre mice that mainly express Cre recombinase in the hypothalamic neurons (Xu et al. 2008). Thus, resulting Pde3b Nkx2.1KO mice should specifically lack Pde3b in the hypothalamus. Unexpectedly, PCR and Western blot analysis of Pde3b Nkx2.1KO hypothalamus showed only ~50% decrease in Pde3b gene expression and PDE3B protein levels in the hypothalamus, suggesting a partial ablation of Pde3b in these mice and therefore we named these mice as Pde3b Nkx2.1KD mice indicating Pde3b knockdown in the hypothalamus. Notably, a previous study using Nkx2.1-Cre mice reported ~75% decrease in FoxO1 in FoxO1fl/fl Nkx2.1-cre mice (Heinrich et al. 2014). The reason of different degree of Cre recombination between the studies is unknown, but it could be due to strain differences. Also, the partial PDE3B knockdown could be due to the possibility that there are non-Nkx2.1-Cre-expressing PDE3B neurons or PDE3B is expressed non-neuronal population such as glia in the hypothalamus. The later possibility is unlikely, because glial population in the hypothalamus do not express PDE3B (Sahu & Sahu 2015). Notably, Nkx2.1-Cre mice have been used in combination with specific floxed mice to knockout various signals such as leptin receptor (Ring & Zeltser 2010) and FoxO1 (Heinrich et al. 2014) in the hypothalamus.
Our pharmacological studies with a specific PDE3 inhibitor, cilostamide, demonstrated a role for the PDE3B pathway in mediating anorectic and body weight-reducing effects of both leptin and insulin (Zhao et al. 2002, Sahu 2011, Sahu et al. 2017). In addition, Pde3b-null mice show increased bodyweight and impaired glucose homeostasis (Choi et al. 2006). Thus, despite having partial conditional knockout, we assessed whether Pde3b Nkx2.1KD mice might exhibit altered food intake, BW and glucose homeostasis. Our results demonstrate a sex-specific alteration in BW in that in males on the LFD, but not on the HFD, a small increase in BW was evident only at 4–6 weeks of age, and there was no difference in the BW thereafter. The mechanisms behind this early increase in BW in male Pde3b Nkx2.1KD mice are currently unknown, but it could be related to increased growth during this period. In females, however BW was significantly increased approximately at 13 weeks and 15 weeks of age in the LFD-fed and HFD-fed groups, respectively. Interestingly, although increase in BW in LFD-fed female Pde3b Nkx2.1KD mice was associated with an increase in food intake, fat pad weights were decreased in association with reduced circulating leptin levels. These results suggest the possibility of an increased lean mass in these mice, which however require further investigation. Other possibility of increased BW in female Pde3b Nkx2.1KD mice could be due to decreased energy expenditure in association with increased food intake. Since Ucp1 gene expression in the BAT of females on the LFD was not different between genotypes, it is likely that there was no change in energy expenditure, which needs to be confirmed using indirect calorimetry. It also remains to be determined if UCP1 protein level in the BAT was increased in the mutant, because UCP1 mRNA and protein levels may not always corroborate each other (Nedergaard & Cannon 2013). Notably, female Pde3b-null mice fed regular chow also show increased BW in association with decreased fat pads weight but without any change in circulating leptin levels (Choi et al. 2006). Thus, it is likely that changes in BW and fat pad weights seen in Pde3b-null mice could be, at least partly, due to a loss of Pde3b in the hypothalamus. On the other hand, increased BW in female Pde3b Nkx2.1KD mice fed HFD was not associated with any change in food intake, fat pad weight or circulating leptin levels. Because PDE3B pathway plays a significant role in mediating the actions of both leptin and insulin in the hypothalamus in regulation of BW and food intake (Zhao et al. 2002, Sahu 2011, Sahu et al. 2017), it is most likely that increased BW seen in females could be due to reduced leptin and/or insulin signaling through this pathway. Overall, increased BW in females is consistent with the notion that hypothalamic PDE3B pathway plays an important role in energy homeostasis. Our results also show a sex- and diet-specific response in BW changes in Pde3b Nkx2.1KD mice. Since estrogen is one of the major factors that act in the hypothalamus to regulate food intake and BW (Lopez & Tena-sempere 2015), we speculate that, like leptin and insulin, estrogen could also use PDE3B pathway to exert its effect on food intake and BW, and therefore, decrease in PDE3B could reduce the action of estrogen resulting in increased bodyweight and food intake seen specifically in female Pde3b Nkx2.1KD mice. Although both leptin and estrogen use hypothalamic STAT3 pathway to reduce food intake and BW (Gao et al. 2007, Gao & Horvath 2008), it remains to be determined if, estrogen, like leptin, also uses hypothalamic PDE3B-cAMP pathway to regulate energy homeostasis and whether ovariectomy modifies energy balance in Pde3b Nkx2.1KD mice.
A role of PDE3B in glucose homeostasis has been evident in vivo studies using Pde3b-null mice (Choi et al. 2006). The question of whether hypothalamic PDE3B plays any role in this process has not been addressed before. In this study, we attempted to address this issue in mice with partial ablation of Pde3b specifically in the hypothalamus. Our data suggest sex-specific changes in glucose homeostasis in that ad libitum-fed glucose levels were increased in male but decreased in female Pde3b Nkx2.1KD mice as compared to their respective WT mice. These changes were only evident when the mice were on the LFD but not HFD. It is also complicated by the fact that decreased glucose levels were associated with increased BW in females and increased glucose levels were associated with no change in BW in male Pde3b Nkx2.1KD mice. However, it remains to be determined whether a possible increase in lean mass due to association of increased BW and decreased fat mass in female Pde3b Nkx2.1KD mice could be involved in lowering glucose levels in ad libitum-fed animals. Nevertheless, the effect of PDE3B knockdown in the hypothalamus on glucose homeostasis was more apparent from GTT and ITT. Thus, clearance of glucose during GTT was significantly increased only in HFD-fed but not in LFD-fed male Pde3b Nkx2.1KD mice. Also, insulin’s effectiveness in reducing blood glucose levels during ITT was increased mainly in LFD-fed male Pde3b Nkx2.1KD mice. In male Pde3b-null mice, in contrast, insulin is reported to be much less effective in reducing blood glucose levels during ITT (Choi et al. 2006). The differences in insulin’s effectiveness in reducing blood glucose levels between Pde3b Nkx2.1KD and Pde3b-null mice are most likely due to the level of Pde3b deficiency with one specific to the hypothalamus and the other is whole body knockout including the liver and adipose tissue. On the other hand, female mice did not show any changes in glucose clearance during GTT or ITT. These results collectively suggest an improved glucose homeostasis in male but not in female Pde3b Nkx2.1KD mice. Specifically, glucose tolerance and insulin sensitivity were improved in male Pde3b Nkx2.1KD mice. This was also supported by decreased expression of gluconeogenic genes, Pck1 and G6pc, in the liver of HFD-fed male Pde3b Nkx2.1KD mice, without any change in female mice. Although hepatic insulin sensitivity was not directly examined, decreased Pck1 and G6pc mRNA levels suggest increased insulin sensitivity in the liver of HFD-fed male mice. Notably, LFD-fed male Pde3b Nkx2.1KD mice had no change in expression of either Pck1 or G6pc gene. Nevertheless, improved glucose homeostasis particularly in HFD-fed male Pde3b Nkx2.1KD mice is quite significant, because it suggests that glucose homeostasis could be improved in HFD-fed obese mice by manipulation of PDE3B in hypothalamic neurons and provides evidence in support of an important role for hypothalamic PDE3B in glucose homeostasis.
Among various signals that regulate energy and glucose homeostasis, AMP-activated protein kinase (AMPK) appears to be the most important sensor of cellular energy in various tissues including the hypothalamus (Lopez et al. 2016). Thus, increase in hypothalamic AMPK activity by orexigenic signals is associated with increased feeding and weight gain; and the signals, such as leptin, insulin, GLP-1, estradiol, etc., that decrease feeding and cause weight loss also decrease hypothalamic AMPK activity (Lopez et al. 2016). Recently, it has been reported that AMPK activity was increased in the adipocytes of Pde3b-null mice (Chung et al. 2017). Thus, it is tempting to speculate that decrease in PDE3B in Pde3b Nkx2.1KD mice could increase hypothalamic AMPK activity leading to increased food intake and BW seen in female Pde3b Nkx2.1KD mice and improved glucose tolerance and insulin sensitivity in male Pde3b Nkx2.1KD mice. Future studies should address if there is a connection between PDE3B and AMPK pathways in the hypothalamus in regulation of energy and glucose homeostasis.
A role of hypothalamic NPY, AgRP and POMC neurons, which also co-express PDE3B (Sahu et al. 2011), in energy homeostasis is well established (Schwartz et al. 2000, Sahu 2003, Morton et al. 2006, Myers & Olson 2012, Timper & Bruning 2017). Therefore, we investigated if there was any change in expression of Npy, Agrp and Pomc genes in the hypothalamus of Pde3b Nkx2.1KD mice. Our demonstration of no changes in expression of these genes between the genotypes of either sex when they were on the LFD or HFD suggest that changes in food intake and BW seen specifically in female Pde3b Nkx2.1KD mice were not due to changes in hypothalamic Npy, Agrp or Pomc gene expression. Under fasting condition however there was an increase in Agrp gene expression in the male Pde3b Nkx2.1KD mice that were on standard chow diet suggesting a role of PDE3B in AgRP neuronal activity. Because Pde3b was deleted only partially in the hypothalamus, future studies should address if greater deficiency of Pde3b in the hypothalamus could produce significant alteration in Npy, Agrp or Pomc gene expression resulting in different phenotypes or if deletion of Pde3b specifically in NPY/AgRP or POMC neurons could alter energy and glucose homeostasis differently than seen after partial ablation of Pde3b in the hypothalamus. Thus, to address further the role of hypothalamic PDE3B in energy and glucose homeostasis, it will be necessary to delete Pde3b in specific neurons such as NPY/AgRP, POMC or steroidogenic factor 1-positive neurons in the hypothalamus using Pde3b fl/fl and specific Cre-expressing mice or to generate conditional Pde3b knockdown in adult hypothalamus using tamoxifen-inducible Cre system or viral approaches to rule out any compensatory mechanism that might develop during the developmental period using the Cre-expressing animals. Availability of Pde3b fl/fl mice is therefore extremely valuable to pursue these future studies.
In summary, our study shows a sex-specific response in BW and glucose homeostasis following Pde3b knockdown in the hypothalamus. Specifically, glucose homeostasis was improved in male and BW was increased in female mutants. Overall, these findings support a role, at least in part, for the hypothalamic PDE3B in regulation of energy and glucose homeostasis, and warrant future investigation with animals having complete knock out or greater deficiency in Pde3b specifically in the hypothalamus. Because Pde3b Nkx2.1KD mice are partial knockdown models of hypothalamic PDE3B, it could potentially underestimate the physiological role of hypothalamic PDE3B in energy and glucose homeostasis. Nevertheless, improved glucose homeostasis specifically in HFD-fed obese male Pde3b Nkx2.1KD mice signifies that targeting hypothalamic PDE3B could be a viable therapeutic approach to improve glucose homeostasis in diet-induced male obese individuals.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by NIH RO1 Grant DK78068 to A S. Thanks to Dr Vincent C Manganiello, National Heart Lung and Blood Institute, NIH, Bethesda, MD, for supplying PDE3B antibody used in this study.
References
Accili D & Arden KC 2004 FoxOs at the crossroads of cellular metabolism, differentiation, and transformation. Cell 117 421–426. (https://doi.org/10.1016/S0092-8674(04)00452-0)
Avruch J, Hara K, Lin Y, Liu M, Long X, Ortiz-Vega S & Yonezawa K 2006 Insulin and amino-acid regulation of mTOR signaling and kinase activity through the Rheb GTPase. Oncogene 25 6361–6372. (https://doi.org/10.1038/sj.onc.1209882)
Bender AT & Beavo JA 2006 Cyclic nucleotide phosphodiesterases: molecular regulation to clinical use. Pharmacological Review 58 488–520. (https://doi.org/10.1124/pr.58.3.5)
Benoit SC, Air EL, Coolen LM, Strauss R, Jackman A, Clegg DJ, Seeley RJ & Woods SC 2002 The catabolic action of insulin in the brain is mediated by melanocortins. Journal of Neuroscience 22 9048–9052. (https://doi.org/10.1523/JNEUROSCI.22-20-09048.2002)
Choi YH, Park S, Hockman S, Zmuda-Trzebiatowska E, Svennelid F, Haluzik M, Gavrilova O, Ahmad F, Pepin L, Napolitano M, et al.2006 Alterations in regulation of energy homeostasis in cyclic nucleotide phosphodiesterase 3B-null mice. Journal of Clinical Investigation 116 3240–3251. (https://doi.org/10.1172/JCI24867)
Chung YW, Ahmad F, Tang Y, Hockman SC, Kee JH, Berger K, Guirguis E, Choi YH, Schimel DM, Aponte AM, et al. 2017 White to beige conversion in PDE3B KO adipose tissue through activation of AMPK signaling and mitochondrial function. Scientific Reports 7 40445 (https://doi.org/10.1038/srep40445)
Conti M & Beavo JA 2007 Biochemistry and physiology of cyclic nucleotide phosphodiesterases: essential component in cyclic nucleotide signaling. Annual Review of Biochemistry 76 481–511. (https://doi.org/10.1146/annurev.biochem.76.060305.150444)
Degerman E, Ahmad F, Chung YW, Guirguis E, Omar B, Stenson L & Manganiello V 2011 From PDE3B to the regulation of energy homeostasis. Current Opinions in Pharmacology 11 676–682. (https://doi.org/10.1016/j.coph.2011.09.015)
Gao Q & Horvath TL 2008 Cross-talk between estrogen and leptin signaling in the hypothalamus. American Journal of Physiology: Endocrinology and Metabolism 294 E817–E826 (https://doi.org/10.1152/ajpendo.00733.2007)
Gao Q, Mezei G, Nie Y, Rao Y, Choi SC, Bechmann I, Leranth C, Toran-Allerand D, Priest CA, Roberts JL, et al. 2007 Anorectic estrogen mimics leptin’s effect on the rewiring of melanocortin cells and Stat3 signaling in obese animals. Nature Medicine 13 89–94 (https://doi.org/10.1038/nm1525)
Heinrich G, Meece K, Wardlaw SL & Accili D 2014 Preserved energy balance in mice lacking FoxO1 in neurons of Nkx2.1 lineage reveals functional heterogeneity of FoxO1 signaling within the hypothalamus. Diabetes 63 1572–1582. (https://doi.org/10.2337/db13-0651)
Inokuma K, Okamatsu-Ogura Y, Omachi A, Matsushita Y, Kimura K, Yamashita H & Saito M 2006 Indispensable role of mitochondrial UCP1 for antiobesity effect of beta3-adrenergic stimulation. American Journal of Physiology: Endocrinology and Metabolism 290 E1014–E1021. (https://doi.org/10.1152/ajpendo.00105.2005)
Kim MS, Pak YK, Jang PG, Namkoong C, Choi YS, Won JC, Kim KS, Kim SW, Kim HS, Park JY, et al. 2006 Role of hypothalamic Foxo1 in the regulation of food intake and energy homeostasis. Nature Neuroscience 9 901–906. (https://doi.org/10.1038/nn1731)
Kitamura T, Feng Y, Kitamura YI, Chua SC Jr, Xu AW, Barsh GS, Rossetti L & Accili D 2006 Forkhead protein FoxO1 mediates Agrp-dependent effects of leptin on food intake. Nature Medicine 12 534–540. (https://doi.org/10.1038/nm1392)
Lopez M & Tena-Sempere M 2015 Estrogens and the control of energy homeostasis: a brain perspective. Trends in Endocrinology and Metabolism 26 411–421 (https://doi.org/10.1016/j.tem.2015.06.003)
Lopez M, Nogueiras R, Tena-Sempere M & Diéguez C 2016 Hypothalamic AMPK: a canonical regulator of whole-body energy balance. Nature Review Endocrinology 12 421–432 (https://doi.org/10.1038/nrendo.2016.67)
Manning BD & Cantley LC 2007 AKT/PKB signaling: navigating downstream. Cell 129 1261–1274. (https://doi.org/10.1016/j.cell.2007.06.009)
Morton GJ, Cummings DE, Baskin DG, Barsh GS & Schwartz MW 2006 Central nervous system control of food intake and body weight. Nature 443 289–295. (https://doi.org/10.1038/nature05026)
Myers MG Jr & Olson DP 2012 Central nervous system control of metabolism. Nature 491 357–363. (https://doi.org/10.1038/nature11705)
Myers MG, Cowley MA & Munzberg H 2008 Mechanisms of leptin action and leptin resistance. Annual Review of Physiology 70 537–556. (https://doi.org/10.1146/annurev.physiol.70.113006.100707)
Nedergaard J & Cannon B 2013 UCP1 mRNA does not produce heat. Biochemica et Biophysica Acta 1831 943–949 (https://doi.org/10.1016/j.bbalip.2013.01.009)
Niswender KD, Morton GJ, Stearns WH, Rhodes CJ, Myers MG Jr & Schwartz MW 2001 Intracellular signalling. Key enzyme in leptin-induced anorexia. Nature 413 794–795. (https://doi.org/10.1038/35101657)
Niswender KD, Morrison CD, Clegg DJ, Olson R, Baskin DG, Myers MG Jr, Seeley RJ & Schwartz MW 2003 Insulin activation of phosphatidylinositol 3-kinase in the hypothalamic arcuate nucleus: a key mediator of insulin-induced anorexia. Diabetes 52 227–231. (https://doi.org/10.2337/diabetes.52.2.227)
Ono H, Pocai A, Wang Y, Sakoda H, Asano T, Backer JM, Schwartz GJ & Rossetti L 2008 Activation of hypothalamic S6 kinase mediates diet-induced hepatic insulin resistance in rats. Journal of Clinical Investigation 118 2959–2968. (https://doi.org/10.1172/JCI34277)
Rahmouni K, Sigmund CD, Haynes WG & Mark AL 2009 Hypothalamic ERK mediates the anorectic and thermogenic sympathetic effects of leptin. Diabetes 58 536–542. (https://doi.org/10.2337/db08-0822)
Ring LE & Zeltser LM 2010 Disruption of hypothalamic leptin signaling in mice leads to early-onset obesity, but physiological adaptations in mature animals stabilize adiposity. Journal of Clinical Investigation 120 2931–2941. (https://doi.org/10.1172/JCI41985)
Sahu A 2003 Leptin signaling in the hypothalamus: emphasis on energy homeostasis and leptin resistance. Frontiers in Neuroendocrinology 24 225–253. (https://doi.org/10.1016/j.yfrne.2003.10.001)
Sahu A 2004 Minireview: a hypothalamic role in energy balance with special emphasis on leptin. Endocrinology 145 2613–2620. (https://doi.org/10.1210/en.2004-0032)
Sahu A 2011 Intracellular leptin-signaling pathways in hypothalamic neurons: the emerging role of phosphatidylinositol-3 kinase-phosphodiesterase-3B-cAMP pathway. Neuroendocrinology 93 201–210. (https://doi.org/10.1159/000326785)
Sahu M & Sahu A 2015 Leptin receptor expressing neurons express phosphodiesterase-3B (PDE3B) and leptin induces STAT3 activation in PDE3B neurons in the mouse hypothalamus. Peptides 73 35–42. (https://doi:org/10.1016/j.peptides.2015.08.011)
Sahu M, Litvin DG & Sahu A 2011 Phosphodiesterase-3B is expressed in proopiomelanocortin and neuropeptide Y neurons in the mouse hypothalamus. Neuroscience Letters 505 93–97. (https://doi.org/10.1016/j.neulet.2011.09.068)
Sahu M, Anamthathmakula P & Sahu A 2017 Hypothalamic phosphodiesterase 3B pathway mediates anorectic and body weight-reducing effects of insulin in male mice. Neuroendocrinology 104 145–156. (https://doi.org/10.1159/000445523)
Schwartz MW, Sipols AJ, Marks JL, Sanacora G, White JD, Scheurink A, Kahn SE, Baskin DG, Woods SC, Figlewicz DP, et al. 1992 Inhibition of hypothalamic neuropeptide Y gene expression by insulin. Endocrinology 130 3608–3616. (https://doi.org/10.1210/endo.130.6.1597158)
Schwartz MW, Woods SC, Porte D Jr, Seeley RJ & Baskin DG 2000 Central nervous system control of food intake. Nature 404 661–671. (https://doi.org/10.1038/35007534)
Shakur Y, Holst LS, Landstrom TR, Movsesian M, Degerman E & Manganiello V 2001 Regulation and function of the cyclic nucleotide phosphodiesterase (PDE3) gene family. Progress in Nucleic Acid Research and Molecular Biology 66 241–277.
Sugimoto S, Nakajima H, Kodo K, Mori J, Matsuo K, Kosaka K, Aoi W, Yoshimoto K, Ikegaya H & Hosoi H 2014 Miglitol increases energy expenditure by upregulating uncoupling protein 1 of brown adipose tissue and reduces obesity in dietary-induced obese mice. Nutrition and Metabolism 11 14 (https://doi.org/10.1186/1743-7075-11-14)
Timper K & Brüning JC 2017 Hypothalamic circuits regulating appetite and energy homeostasis: pathways to obesity. Disease Models and Mechanisms 10 679–689. (https://doi.org/10.1242/dmm.026609)
Vaisse C, Halaas JL, Horvath CM, Darnell JE Jr, Stoffel M & Friedman JM 1996 Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nature Genetics 14 95–97. (https://doi.org/10.1038/ng0996-95)
Watterson KR, Bestow D, Gallagher J, Hamilton DL, Ashford FB, Meakin PJ & Ashford ML 2013 Anorexigenic and orexigenic hormone modulation of Mammalian target of rapamycin complex 1 activity and the regulation of hypothalamic agouti-related protein mRNA expression. Neurosignals 21 28–41. (https://doi.org/10.1159/000334144)
Woods SC, Seeley RJ & Cota D 2008 Regulation of food intake through hypothalamic signaling networks involving mTOR. Annual Review of Nutrition 28 295–311. (https://doi.org/10.1146/annurev.nutr.28.061807.155505)
Xu Q, Tam M & Anderson SA 2008 Fate mapping Nkx2.1 lineage cells in the mouse telencephalon. Journal of Comparative Neurology 506 16–29 (https://doi.org/10.1002/cne.21529)
Zhao AZ, Shinohara MM, Huang D, Shimizu M, Eldar-Finkelman H, Krebs EG, Beavo JA & Bornfeldt KE 2000 Leptin induces insulin-like signaling that antagonizes cAMP elevation by glucagon in hepatocytes. Journal of Biological Chemistry 275 11348–11354. (https://doi.org/10.1074/jbc.275.15.11348)
Zhao AZ, Huan JN, Gupta S, Pal R & Sahu A 2002 A phosphatidylinositol 3-kinase phosphodiesterase 3B-cyclic AMP pathway in hypothalamic action of leptin on feeding. Nature Neuroscience 5 727–728. (https://doi.org/10.1038/nn885)
