Abstract
Glucagon promotes hepatic glucose production maintaining glucose homeostasis in the fasting state. Glucagon maintains at high level in both diabetic animals and human, contributing to hyperglycemia. Mitochondria, a major place for glucose oxidation, are dysfunctional in diabetic condition. However, whether hepatic mitochondrial function can be affected by glucagon remains unknown. Recently, we reported that FOXO1 is an important mediator in glucagon signaling in control of glucose homeostasis. In this study, we further assessed the role of FOXO1 in the action of glucagon in the regulation of hepatic mitochondrial function. We found that glucagon decreased the heme production in a FOXO1-dependent manner, suppressed heme-dependent complex III (UQCRC1) and complex IV (MT-CO1) and inhibited hepatic mitochondrial function. However, the suppression of mitochondrial function by glucagon was largely rescued by deleting the Foxo1 gene in hepatocytes. Glucagon tends to reduce hepatic mitochondrial biogenesis by attenuating the expression of NRF1, TFAM and MFN2, which is mediated by FOXO1. In db/db mice, we found that hepatic mitochondrial function was suppressed and expression levels of UQCRC1, MT-CO1, NRF1 and TFAM were downregulated in the liver. These findings suggest that hepatic mitochondrial function can be impaired when hyperglucagonemia occurs in the patients with diabetes mellitus, resulting in organ failure.
Introduction
Glucagon secreted from the α-cells of pancreatic islets is a predominant counter regulatory hormone to the action of insulin in control of blood glucose homeostasis (Habegger et al. 2010). This 29 animo acid peptide hormone is generated from a proglucagon peptide through posttranslational procession (Baggio et al. 2007). Glucagon plays its primary function in the liver to maintain euglycemia during the fasting state, by promoting hepatic glucose output via increasing glycogenolysis and gluconeogenesis (Jiang et al. 2003). However, the glucagon concentration or the ratio of glucagon to insulin is elevated in both type I and II diabetes mellitus, including animals and humans (Unger et al. 1978). Chronic hyperglucagonemia results in excess hepatic glucose production, enhancing blood glucose in patients with type 2 diabetes (T2D) (Consoli 1992). Inactivation of glucagon receptor is associated with significant improvement of blood glucose in diabetic mice (Lee et al. 2011). Therefore, glucagon is important in control of glucose metabolism in both healthy and pathological conditions.
FOXO1 is a member of the O class of forkhead/winged helix transcription factors and plays an important role in multiple metabolic actions including glucose and lipid metabolism (Zhang et al. 2006, Lee et al. 2017). Our early study demonstrated that FOXO1 is a substrate for AKT in the insulin signaling cascade, and FOXO1 is phosphorylated at T24, S256 and S319 by AKT. The phosphorylation of FOXO1 by AKT in insulin signaling cascades leads to ubiquitin-mediated FOXO1 degradation (Rena et al. 1999). Subsequently, expression levels of FOXO1 target genes, such as G6pc and Pck, are suppressed and hepatic glucose production inhibited (Nakae et al. 1999, Schmoll et al. 2000). During the fasting period, expression levels of FOXO1 target genes increase for promotion of gluconeogenesis, maintaining a normal blood glucose (Lu et al. 2012). Inactivation of FOXO1 in liver reduces blood glucose (Montgomery et al. 2015).
Mitochondrial dysfunction has been implicated in the development of insulin resistance and it is reported that FOXO1 stimulates gene expression of heme-oxygenase 1 (Hmox1), a key enzyme controlling the mitochondrial biogenesis and function. Moreover, a constitutively active FOXO1 disrupts hepatic mitochondrial function and biogenesis in T2D, suggesting that FOXO1 is also a key factor integrating insulin signaling and mitochondrial function in the liver (Cheng et al. 2009). Recently, we have just demonstrated that FOXO1 is a mediator in the glucagon signaling in control of glucose homeostasis (Wu et al. 2018). In this study, we further examined whether glucagon regulates mitochondrial function involving in FOXO1 in liver.
Experimental procedures
Animals
Liver-specific Foxo1-knockout mice (L-F1KO) were previously described in a mixed genetic background with C57B6/J and 129 (Zhang et al. 2012). The db/db mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). Mice were housed with ad libitum chow diet and all animal procedures were performed at Texas A&M University and approved by the Texas A&M Health Science Center Institutional Animal Care and Use Committee.
Real-time PCR analysis of gene expression
RNA was extracted from livers in 18-h fasted or random-fed male mice, 18-h fasted db/db male mice and primary hepatocytes using TRIzol reagent according to manufacturer instructions (Sigma-Aldrich). The quantitative PCR (qPCR) primer sequences used are listed in the Table 1.
Primers for quantitative PCR (qPCR).
| Gene name | Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) |
|---|---|---|
| Mouse | ||
| Foxo1 | AGGAACTGAGGAGCAGTCCA | ATGATTCCCAATGGCACAGT |
| Fxn | TTGAAGACCTCGCAGACAAGC | AGGCCAATGAAGACAAGTCCA |
| Urod | TTTGCACTGCCCTACATTCGT | AGCCGACCGATCTCTTCCTCA |
| Mt-nd6 | CACAACTATATATTGCCGCTACC | GCTACTGAGGAATATCCAGAGAC |
| Sdha | TGCTGGAGAAGAATCGGTTATG | ACAGCATCAGATTCTGCAGCTCC |
| Uqcrc1 | ACCAGTGCTACAGAGAGTGAGG | AGCATCTGGGCATCCACCTCCTG |
| Mt-co1 | GTCTGATCCGTACTTATTACAG | GCTCATACTATTCCTATATAGCCG |
| Atp5a | GAGACTGGGCGTGTGTTAAGCA | CATTACCGAGGGCGTCAACCAC |
| Nrf1 | CAGACGACGCAAGCATCAGAG | GCTCCGACGGCTGCTGCGGTTTC |
| Tfam | GCACTGGTAAAGAGAAGAGAAT | TCCTATCATCTTTAGCAAGCTG |
| Vlcad | CCTTGGTGTTAGCGTTACCCT | GGCTACATCGGATCCACTCG |
| Cpt1a | GCCGATCATGGTTAACAGCAACT | AGACCTTGAAGTAACGGCCTC |
| Hadha | CGTATGCCATGACTGTCCCA | CCAAATTTCTGCGATTCAGCAAG |
| Acadm | TTCATTGTGGAAGCCGACACC | TCCTATCCAGGGCATACTTCG |
| Fis1 | CCGGCTCAAGGAATATGAAA | CCATGCCTACCAGTCCATCT |
| Drp1 | CGGTTCCCTAAACTTCACGA | GCACCATTTCATTGTCACG |
| Mfn1 | TCTCCAGCCCAACATCTTCA | ACTCCGGCTCCGAAGCA |
| Mfn2 | GGGGCCTACATCCAAGAGAG | GCAGAACTTTGTCCCAGAGC |
| Sirt1 | ACTTGCCATCATGAAGCCAGA | TATTTGAGGCACTTCATGGGGTA |
| Ppargc1a | CTACCGTTACACCTGTGACG | AGTTGGTATCTGAATCTGCA |
| 18s | AGCCTGCGGCTTAATTTGAC | CAACTAAGAACGGCCATGCA |
| Human | ||
| FXN | CCAAACAAGCAAATCTGGCTA | GGGCATCAAGCATCTTTTCCG |
| UROD | TTTGCACTGCCTTACATCCGT | AACTGCCCGATCTCCTCCTCA |
Western blotting
Antibodies against MT-CO1 (Abcam), UQCRC1, FOXO1, NRF1 and TFAM (Cell Signaling Technology) were used according to the manufacturer’s instructions. Protein densitometry was performed and analyzed using ImageJ.
Mouse primary hepatocyte isolation and cell culture
Primary mouse hepatocytes were isolated from 8–12 weeks old, random-fed mice and cultured in DMEM with 10% FBS as previously described (Zhang et al. 2012). HepG2 cells were cultured with DMEM supplemented with 10% FBS and 1% antibiotics in 37°C incubator with 5% CO2. HepG2 cells transfection was performed by lipofectamine 3000 reagent according to the manufacturer’s instructions (Thermo Fisher).
Quantification of mtDNA copy number by qPCR
Total DNA was extracted from primary hepatocytes treated with 100 nM glucagon for 10 h by DNeasy Blood and tissue kit (QIAGEN). qPCRs were carried out by using COX3 and β2 microglobulin (β2m) primers as described previously (Khiati et al. 2015).
Mitochondrial stress test in primary hepatocytes and HepG2 cells
Primary hepatocytes (8000 cells/well) and HepG2 cells (20,000 cells/well) were seeded into the XF96 microplates. After treating with 100 nM glucagon, culturing DMEM medium was changed with XF base medium supplied with 1mM pyruvate, 2 mM glutamine and 10 mM glucose. Then microplate was placed in non-CO2 37°C incubator for 1 h before loading to the XF96 Extracellular Flux Analyzer (Seahorse Bioscience). Oxygen consumption rate was measured in Analyzer. All measurements were performed following manufacturer’s instructions and protocols. The results were normalized by the total proteins each well.
Fatty acid oxidation analysis
Isolated primary hepatocytes were seeded into the XF96 cell culture microplate, as mentioned above. 24 h prior to the assay, replace growth medium with substrate-limited medium (DMEM with 0.5 mM glucose, 1mM GlutaMAX, 0.5 mM carnitine and 1% FBS). 45 min before the assay, wash cells and replace with FAO assay medium (111 mM NaCl, 4.7 mM KCl, 1.25 mM CaCl2, 2 mM MgSO4, 1.2 mM NaH2PO4, 2.5 mM glucose, 0.5 mM carnitine and 5 mM HEPES) and incubate in a non-CO2 incubator for 30–45 min at 37°C. Prior to the assay, add 30 μL XF Palmitate-BSA FAO substrate or BSA to the appropriate wells. Then immediately insert the XF cell culture microplate into the XF96 Analyzer and run the XF Cell Mito Stress Test. The results were normalized by the total proteins each well.
Heme measurement
25 mg liver tissues were collected form 18 h fasted control and db/db mice and then homogenized in 400 μL 1% TBST. The heme level was measured by Heme Assay Kit (Sigma-Aldrich).
Affymetrix GeneChip analysis
Gene expression was determined on MG4302.0 GeneChip (Affymetrix). Livers in control and L-F1KO mice fasted for 18 h were collected (n = 2/group). RNA was extracted by using TRIzol (Invitrogen). 15 μg of each RNA sample was used for labeling and hybridization which was performed at the Harvard Medical School Children’s Hospital Boston Genetic Core Facility. Affymetrix microarray Suite 5.0 was used to generate cell intensity files that were analyzed by Transcriptome Analysis Console 4.0 (Zhang et al. 2012).
ATP measurement
Primary mouse hepatocytes were seeded into 96-well plate in DMEM medium with 10% FBS and 1% penicillin/streptomycin at 10,000 cells/well. After fasting 3 h, primary mouse hepatocytes were treated with 100 nM glucagon for 10 h. The amount of ATP was measured by ATPlite Luminescence ATP Detection Assay System (PerkinElmer) according to the instruction.
Hepatic metabolite analysis
The liver samples from 8- to 12-week-old random-fed control and L-F1KO mice intraperitoneally injected with or without 16 μg/kg glucagon for 1 h were collected (n = 8). The global metabolic profiles in livers from different treatments were examined by Metabolon Inc. (Durham, NC, USA). Samples were prepared using the automated MicroLab STAR system from Hamilton Company. Samples were measured by ultrahigh performance liquid chromatography-tandem mass spectroscopy (UPLC-MS/MS) and gas chromatography-mass spectroscopy (GC-MS).
Electron microscopy
Random-fed control and L-F1KO mice were injected with 16 μg/kg glucagon for 1 h. The livers collected were perfused with 2% paraformaldehyde solution containing 2.5% glutaraldehyde. The perfused livers were cut into small pieces (1 × 1 × 2 mm) and were fixed in 5% glutaraldehyde at 4°C overnight. Then, they were fixed in 1% osmium teroxide for 1 h at 25°C, stained in 2% uranyl acetate and dehydrated in a series of ethanol dilution (50–100%), finally embedded in epoxy resin. The sections (70 μm) were stained with 2% uranyl acetate and lead citrate.
Statistical analysis
Results are presented as the mean ± s.e.m. Data for two groups were analyzed by two-tailed Student’s t test to determine P values. ANOVA was used to determine P values for data with three or more groups. P < 0.05 was considered statistically significant.
Results
FOXO1 is required for the effect of glucagon on hepatic mitochondrial function
We firstly assessed the role of glucagon in hepatic mitochondrial oxidative phosphorylation in hepatocytes. HepG2 cells were pretreated with 100 nM glucagon for 2, 6 and 10-h, respectively. Subsequently, oligomycin, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP) and antimycin A (AA) were added, then oxygen consumption rate measured by the Seahorse XFe96 Analyzer. At the basal level, oxygen consumption rate was reduced by 15, 25 and 30%, respectively, in HepG2 cells when treated with glucagon for 2, 6 and 10-h (P < 0.01). Moreover, compared with the vehicle group, 2, 6 and 10-h treatments of glucagon resulted in 18, 27 and 35% decrease in FCCP-induced maximum oxygen consumption rate in HepG2 cells, respectively (P < 0.05; Fig. 1A).
Glucagon decreases mitochondrial function and oxygen consumption via FOXO1. (A) Oxygen consumption rate (OCR) was measured in HepG2 cells treated with 100 nM glucagon. HepG2 cells were cultured in DMEM medium supplied with 10% FBS and 1% P/S. Cells were treated with 100 nM glucagon for 2, 6, and 10 h. OCR was then measured. **P < 0.01 vs vehicle; #P < 0.05, ##P < 0.01 vs vehicle; $P < 0.05, $$P < 0.01 vs vehicle, n = 4. (B) ATP production was measured in control (CNTR) and L-F1KO primary mouse hepatocytes cultured in DMEM medium with 10% FBS and 1% P/S. Cells were treated with 100 nM glucagon for 10 h and ATP production measured by the ATP lite Luminescence, *P < 0.05 vs CNTR-Vehicle; #P < 0.05 vs CNTR-Glucagon, n = 5. (C) OCR was measured in the control primary mouse hepatocytes treated with or without 100 nM glucagon. Hepatocytes were cultured in DMEM medium supplied with 10% FBS and 1% P/S. The control hepatocytes were treated with or without 100 nM Glucagon for 10 h and OCR measured by seahorse analyzer. *P < 0.05, **P < 0.01 vs CNTR-Glucagon. (D) Basal respiration, maximal respiration, ATP production, and respiration capacity were calculated by OCR in control hepatocytes. *P < 0.05, **P < 0.01 vs CNTR-Vehicle, n = 3–5. (E) OCR was measured in L-F1KO hepatocytes with or without glucagon. L-F1KO hepatocytes were cultured in DMEM medium supplied with 10% FBS and 1% P/S, then treated with or without 100 nM glucagon for 10 h and OCR measured. (F) Basal respiration, maximal respiration, ATP production, and respiration capacity were calculated by OCR in L-F1KO hepatocytes. (G) OCR was measured in the control and db/db primary mouse hepatocytes. Hepatocytes were cultured in DMEM medium supplied with 10% FBS and 1% P/S, then OCR measured by seahorse analyzer. *P < 0.05, **P < 0.01 vs CNTR, n = 4–7. (H) Basal respiration, maximal respiration, ATP production, and respiration capacity were calculated by OCR in control and db/db hepatocyte. *P < 0.05, **P < 0.01 vs CNTR, n = 4–7. A full colour version of this figure is available at https://doi.org/10.1530/JOE-19-0081.
Citation: Journal of Endocrinology 241, 3; 10.1530/JOE-19-0081
Glucagon suppressed the oxygen consumption rate in HepG2 cells in a time-dependent manner. Therefore, we treated mouse primary hepatocytes with glucagon for 10 h to assess the effect of glucagon on hepatic mitochondrial function. ATP production was measured in primary hepatocytes and the result showed that glucagon reduced ATP production by 35% in the control hepatocytes (P < 0.05). However, the suppression of ATP level by glucagon treatment was abolished in the L-F1KO hepatocytes (Fig. 1B). Oxygen consumption rate was further analyzed in primary hepatocytes. The control hepatocytes treated with glucagon exhibited significant reduction in oxygen consumption rate compared with that of vehicle group at different time points (P < 0.05; Fig. 1C). Further analysis showed that glucagon decreased the basal respiration, maximal respiration level, ATP production and spare respiration by 34, 39, 44 and 45%, respectively, in control hepatocytes (P < 0.05, Fig. 1D).
However, L-F1KO hepatocytes treated with and without glucagon exhibited comparable oxygen consumption rate at different time points (Fig. 1E). Likewise, L-F1KO hepatocytes showed no significant differences between the vehicle and glucagon treatment group in the basal respiration, the maximal respiration, ATP production and the spare respiration levels (Fig. 1F). In the primary hepatocytes of diabetic model db/db mice, oxygen consumption rate was decreased significantly in both basal level and FCCP-induced level (P < 0.05; Fig. 1G). Moreover, compared with control hepatocytes, db/db hepatocytes showed 42, 44, 54 and 57% decrease in the basal respiration, maximal respiration level, ATP production and spare respiration, respectively (P < 0.05; Fig 1H). Taken together, the data suggest that FOXO1 mediates the negative role of glucagon in hepatic mitochondrial oxygen consumption and oxidative phosphorylation.
FOXO1 regulates expression of heme biosynthesis genes
We then detected the effect of glucagon on the expression of FOXO1 in mouse primary hepatocytes. The results showed that glucagon significantly increased the expression of FOXO1 in both mRNA and protein level (P < 0.05; Fig. 2A and B). To explore the downstream genes responsible for mitochondrial dysfunction, the transcription profiles in the liver of control and L-F1KO mice were analyzed by the GeneChip microarray. About 2129 genes were differentially expressed between the livers of control and L-F1KO mice (Fig. 2C). Pathway analysis showed that differential expression genes were located at insulin signal pathways, which is consistent with the function of FOXO1 in the glucose metabolism. Further function analysis revealed that the differential expression genes were clustered to acetylation, transcription regulation, mitochondrial and heme biosynthesis (Fig. 2D). Fifty-four differential expression genes were associated with mitochondrial functions, which include the heme biosynthesis genes, Frataxin (Fxn) and uroporphyrinogen decarboxylase (Urod). Then we verified the expression of Fxn and Urod responsible for heme biosynthesis in the liver of control and L-F1KO mice by qPCR. The expression of Foxo1 was reduced by 80% in the liver of fasted L-F1KO mice compared with that in control mice (P < 0.01). The L-F1KO livers exhibited 1.6-fold increase in Fxn and two-fold upregulation in Urod compared with the control counterpart (P < 0.01; Fig. 2E). Thus, FOXO1 plays a role in suppression of heme biosynthetic genes Fxn and Urod.
Heme biogenesis genes, Fxn and Urod, are regulated by FOXO1 in the liver. (A) Relative mRNA level of Foxo1 was determined by qPCR in control primary mouse hepatocytes treated with or without 100 nM glucagon. *P < 0.05, **P < 0.01 vs 0 min treatment, n = 3. (B) FOXO1 protein level was measured by Western blot in primary mouse primary hepatocytes. *P < 0.05, **P < 0.01 vs 0 min treatment, n = 3. (C) Scatter plot of differentially expressed genes between livers from 18 h-fasted control and L-F1KO male mice. (D) Functional analysis of differentially expressed genes in the liver of 18 h-fasted control and L-F1KO male mice. (E) Relative mRNA levels of Foxo1, Fxn, and Urod between livers of 18 h-fasted control and L-F1KO male mice. **P < 0.01 vs CNTR, n = 3. A full colour version of this figure is available at https://doi.org/10.1530/JOE-19-0081.
Citation: Journal of Endocrinology 241, 3; 10.1530/JOE-19-0081
Glucagon reduces heme generation through FOXO1
We then asked whether glucagon decreases expression of genes responsible for heme biosynthesis and then inhibits heme generation. Mouse primary hepatocytes were isolated from the control and L-F1KO mice and then treated with 100 nM glucagon for 10 h. In control hepatocytes, glucagon decreased Fxn and Urod mRNA expression by 32 and 22%, respectively, compared with the vehicle group (P < 0.05). However, glucagon had no significant effect on the expression levels of Fxn and Urod in L-F1KO hepatocytes (Fig. 3A). Overexpression of FOXO1 in HepG2 cells resulted in 26 and 20% decrease in FXN and UROD expression, compared with control group (P < 0.05). Glucagon treatment for 10 h in HepG2 cells also decreased the expression of FXN and UROD by 23 and 21%, respectively (P < 0.05). However, there were no significant differences in FXN and UROD expression between FOXO1 overexpression and glucagon treatment groups (Fig. 3B). We then analyzed the metabolites in the liver of random-fed control and L-F1KO mice intraperitoneally (i.p.) injected with glucagon. The principal component analysis indicated that there were distinct separations among different groups (Fig. 3C). Glucagon treatment in control mice decreased heme level by 50% in the liver (P < 0.05). However, the heme level in L-F1KO livers was barely affected by glucagon administration and was comparable to the heme level in control mice without glucagon injection (Fig. 3D). Further analysis in db/db mice showed that compared with control mice, the expression levels of Fxn and Urod were decreased by 31 and 28%, respectively in the liver of db/db mice (P < 0.01; Fig. 3E). Heme level in db/db mice liver was decreased by 39% (P < 0.05; Fig. 3F). Thus, these results demonstrate that glucagon downregulates the expression of Fxn and Urod and inhibits heme biosynthesis in a FOXO1-dependent manner
Glucagon reduces hepatic heme pool by decreasing gene expression of Fxn and Urod. (A) Relative mRNA levels of Fxn and Urod in control and L-F1KO primary mouse hepatocytes treated with or without 100 nM glucagon for 10 h. *P < 0.05 vs CNTR-Vehicle; #P < 0.05 vs CNTR-Glucagon, n = 3. (B) Relative mRNA expression of FXN and UROD was detected in HepG2 cells transfected with 4 µg plasmid DNA expressing control green fluorescence protein (GFP) or FOXO1 and treated with 100 nM glucagon for 10 h. FXN and UROD mRNA levels were measured by qPCR. *P < 0.05 vs group without Glucagon treatment and FOXO1 overexpression. (C) Principal component analysis of metabolites in the liver from random-fed control and L-F1KO male mice i.p. injected with 16 µg/kg glucagon for 1 h. (D) The relative value of Heme in the livers of random-fed control and L-F1KO male mice i.p. injected with 16 µg/kg glucagon for 1 h. *P < 0.05 vs CNTR-Vehicle; #P < 0.05 vs CNTR-Glucagon, n = 5. (E) Relative mRNA levels of Fxn and Urod in the fasted control and db/db mice livers. **P < 0.01 vs CNTR, n = 3–4. (F) The relative value of Heme in the fasted livers of control and db/db mice livers. *P < 0.05 vs CNTR, n = 3–4. A full colour version of this figure is available at https://doi.org/10.1530/JOE-19-0081.
Citation: Journal of Endocrinology 241, 3; 10.1530/JOE-19-0081
Glucagon impairs integrity of mitochondrial electronic transport chain via FOXO1
Heme is an important molecule that can affect the function of complexes III and IV to maintain mitochondrial function (Atamna et al. 2001, 2007, Cheng et al. 2009). We hypothesized that glucagon might affect the integrity of mitochondrial electron transport chain (ETC) through suppressing heme production. The expression of complexes I/II/III/IV/V in ETC, relatively indicated by NADH dehydrogenase subunit 6 (MT-ND6), succinate dehydrogenase complex, subunit A (SDHA), ubiquinol-cytochrome c reductase core protein (UQCRC1), cytochrome c oxidase subunit 1 (MT-CO1) and alpha subunit 1 (ATP5A), were examined in control and L-F1KO hepatocytes treated with glucagon. Glucagon decreased the mRNA expression of Mt-co1 and Uqcrc1 by 67 and 50%, respectively, in control hepatocytes (P < 0.05) and had no effects on Mt-nd6, Sdha and Atp5a in both control and L-F1KO hepatocytes. However, the effect of glucagon on the suppression of Uqcrc1 expression was blocked and the inhibition of Mt-co1 expression by glucagon largely attenuated by 35% in L-F1KO hepatocytes (P < 0.05, Fig. 4A). We further analyzed the protein abundance of total FOXO1, MT-CO1 and UQCRC1 in the control and L-F1KO hepatocytes by Western blotting. Glucagon treatment increased protein level of total FOXO1 by 30% in control hepatocytes (P < 0.05). Glucagon reduced UQCRC1 protein level by 36% in the glucagon-treated control hepatocytes (P < 0.05), which was abolished in the L-F1KO hepatocytes. Compared with the vehicle group, MT-CO1 protein abundance was reduced by 64% in the glucagon-treated control hepatocytes (P < 0.05), and the reduction of MT-CO1 protein level by glucagon was attenuated by 45% in L-F1KO hepatocytes (P < 0.05; Fig. 4B and C). We also observed 36 and 40% decrease in UQCRC1 and MT-CO1, respectively, in db/db mice liver (P < 0.05; Fig. 4D and E). These results demonstrate that glucagon disrupts complex III and complex IV and impairs the integrity of mitochondrial ETC partially through FOXO1.
Glucagon decreases hepatic mitochondrial ETC integrity. (A) The relative mRNA expression of Mt-nd6 (complex I), Sdha (complex II), Uqcrc1 (complex III), Mt-co1 (complex IV), Atp5a (complex V) in control and L-F1KO primary hepatocytes treated with or without 100 nM glucagon for 10 h. *P < 0.05 vs CNTR-Vehicle; #P < 0.05 vs CNTR-Glucagon. (B and C) The protein levels of FOXO1, UQCRC1 and MT-CO1 in control and L-F1KO primary hepatocytes with or without 100 nM glucagon for 10 h were determined by Western blotting and (C) quantification of FOXO1, UQCRC1 and MT-CO1 protein levels. *P < 0.05, **P < 0.01 vs CNTR-Vehicle; #P < 0.05, ##P < 0.01 vs CNTR-Glucagon. (D and E) The protein levels of UQCRC1 and MT-CO1 in the fasted control and db/db mice livers were determined by Western blotting and (E) quantification of UQCRC1 and MT-CO1 protein levels. *P < 0.05, **P < 0.01 vs CNTR.
Citation: Journal of Endocrinology 241, 3; 10.1530/JOE-19-0081
Glucagon promotes fatty acid oxidation to compensate for hepatic energy deficit
Glucagon level goes up to promote hepatic glucose production during fasting state. To identify whether glucagon plays a similar role in hepatic mitochondria during fasting state, we detected the expressions of Fxn, Urod, Uqcrc1 and Mt-co1 in the livers of 18-h fasted and random-fed mice. The fasted L-F1KO liver exhibited 30% higher in Fxn and 35% higher expression in Urod than that of fasted control liver (P < 0.05). The expression of Fxn and Urod in the fed control liver was increased by 28 and 26%, respectively, compared with fasted control liver (P < 0.05). However, there were no significant differences in the expression of Fxn and Urod between control and L-F1KO liver under the feeding condition (Fig. 5A and B). Compared with the fed liver of control mice, UQCRC1 protein level was decreased by 44% in the fasted liver of control mice (P < 0.05). In the fasted condition, FOXO1 deficiency resulted in a 47% increase in the UQCRC1 expression in the liver (P < 0.05), which is not observed in fed state. However, there were no significant changes in MT-CO1 protein level among different groups (Fig. 5C and D). Thus, glucagon tends to temporally and slightly attenuate the hepatic mitochondrial function during fasting state.
The expression of FXN, UROD, UQCRC1, and MT-CO1 in the mice livers under fasting and feeding state. (A and B) Relative mRNA levels of Fxn and Urod in liver from 18 h-fasted and random-fed control and L-F1KO male mice. *P < 0.05 vs CNTR-Vehicle. (C and D) The protein levels of MT-CO1 and UQCRC1 in the livers of random-fed and 18 h-fasted control and L-F1KO male mice were detected via Western blotting and (D) quantification of UQCRC1 and MT-CO1 protein levels. *P < 0.05 vs Fasted-CNTR.
Citation: Journal of Endocrinology 241, 3; 10.1530/JOE-19-0081
Glucagon-induced hepatic glucose production requires energy supply. The attenuated hepatic mitochondrial activity might be a paradox for glucagon-triggered hepatic glucose production in the liver during fasting state. To solve this inconsistency, we hypothesize that glucagon promotes fatty acid oxidation, which compromises the decreased mitochondrial function temporally to ensure hepatic glucose production. To prove this hypothesis, we detected the oxygen consumption level in primary hepatocytes cultured in the medium with palmitate. The addition of palmitate increased the oxygen consumption rate significantly in both control hepatocytes with and without glucagon treatment, compared with group without palmitate (P < 0.01). Importantly, glucagon barely reduced oxygen consumption rate in palmitate-added control hepatocytes. However, glucagon decreased oxygen consumption rate in control group without palmitate (P < 0.05, Fig. 6A). Further analysis showed that addition of palmitate in control hepatocyte without glucagon treatment increased basal respiration and ATP production by 77 and 67%, respectively (P < 0.01). When pretreated with glucagon, the control hepatocytes with addition of palmitate showed 144 and 125% increase in basal respiration and ATP production, respectively, compared with that in groups without palmitate addition (P < 0.01). In control hepatocytes without palmitate, glucagon decreased basal respiration and ATP production by 28 and 26%, respectively (P < 0.05). However, in the presence of palmitate treatment, glucagon failed to decrease the basal respiration and ATP production (Fig. 6B). Similarly, L-F1KO hepatocytes with palmitate showed significantly increased oxygen consumption rate (P < 0.01). In particular, glucagon treatment increased the FCCP-induced oxygen consumption rate in the presence of palmitate (P < 0.05; Fig. 6C). Basal respiration and ATP production were elevated by 46 and 105%, respectively, in L-F1KO hepatocytes with the addition of palmitate but without glucagon treatment (P < 0.01). After treatment with glucagon, L-F1KO hepatocytes added with palmitate exhibited 85 and 185% increase in basal respiration and ATP production, respectively (P < 0.01). Glucagon treatment lead to 21% increase in ATP production of the L-F1KO hepatocytes with palmitate (P < 0.05, Fig. 6D). The fatty acid oxidation genes Hadha, Cpt1a, Vlcad and Acadm were also upregulated by 26, 360, 80 and 32%, respectively in 10-h glucagon-treated control hepatocytes (P < 0.05). Compared with control hepatocytes, L-F1KO hepatocytes showed 56, 56, 70 and 34% increase in Hadha, Cpt1a, Vlcad and Acadm mRNA expression, respectively (P < 0.05). L-F1KO hepatocytes showed 3.6- and 1.9-fold increases by glucagon in Cpt1a and Vlcad (P < 0.01, Fig. 6E). Fasted control and L-F1KO mice exhibited 2–4 folds higher level of fatty acid oxidation genes, Hadha, Cpt1a, Vlcad and Acadm, than that in fed mice livers (P < 0.01). The FOXO1 deficiency in liver induced a moderate but not significant increase in the expression of Hadha, Cpt1a or Vlcad during the fasting state (Fig. 6F). Taken together, glucagon-suppressed oxygen consumption or mitochondrial function is secondary to the substrate-driven fatty acid oxidation in the liver, which can dominate during fasting state when fatty acid influx to the liver increases.
Glucagon promotes fatty acid oxidation to compensate energy deficit. (A, B, C and D) Fatty acid oxidation (FAO) was measured in primary hepatocytes. The hepatocytes were cultured in substrate-limited medium 24 h prior to the assay and treated with 100 nM glucagon for 10 h. FAO assay medium was used to culture hepatocytes 45 min before the assay and then palmitate was added into wells just before assay, followed by OCR measurement. Fatty acid oxidation in control primary hepatocytes (A). *P < 0.05; **P < 0.01 vs CNTR-Vehicle; ##P < 0.01 vs CNTR-Glucagon. Fatty acid oxidation in L-F1KO primary hepatocytes (C). **P < 0.01 vs L-F1KO-Glucagon; ##P < 0.01 vs L-F1KO-Vehicle; $P < 0.05 vs L-F1KO-Vehilce-Palmitate. Basal respiration and ATP production were calculated by OCR in control (B) and L-F1KO (D) hepatocytes. *P < 0.05, **P < 0.01 vs indicated; #P < 0.05 vs L-F1KO-Vehicle-Palmitate. (E) The mRNA expressions of Hadha, Cpt1a, Vlcad, and Acadm were measured in control and L-F1KO hepatocytes treated with or without 100 nM glucagon for 10 h. *P < 0.05, **P < 0.01 vs CNTR-Vehicle; ##P < 0.01 vs L-F1KO Vehicle. (F) The mRNA expressions of Hadha, Cpt1a, Vlcad, and Acadm in livers of random-fed and 18 h-fasted control and L-F1KO male mice were measured by qPCR. *P < 0.05, **P < 0.01 vs indicated. A full colour version of this figure is available at https://doi.org/10.1530/JOE-19-0081.
Citation: Journal of Endocrinology 241, 3; 10.1530/JOE-19-0081
Glucagon attenuates hepatic mitochondrial biogenesis
We then asked whether glucagon regulates mitochondrial biogenesis. We detected the mitochondrial copy numbers in the hepatocytes using qPCR. Glucagon greatly decreased the mitochondrial copy number by 29% in control hepatocytes (P < 0.05), but the effect of glucagon on L-F1KO hepatocytes was diminished (Fig. 7A). The electron microscopy of liver sections from random-fed control mice injected with 16 μg/kg glucagon revealed larger and fewer mitochondria than liver sections from untreated control mice. However, both L-F1KO mice injected with and without glucagon showed comparable hepatic mitochondria size and number, which is similar with that in control mice not injected with glucagon (Fig. 7B). We further examined the expression levels of nuclear respirational factor-1 (Nrf1) and mitochondrial transcriptional factor A (Tfam), two key genes for mitochondrial function and biogenesis. After 10-h treatment, glucagon suppressed the mRNA expression of Nrf1 and Tfam by 21 and 33%, respectively, in the control hepatocytes, rather than in the L-F1KO hepatocytes (P < 0.05, Fig. 7C). At the protein levels, glucagon treatment similarly increased FOXO1 protein by 40% in control hepatocytes (P < 0.05). Glucagon decreased NRF1 and TFAM protein level by 49 and 44%, respectively, in control hepatocytes, while loss of FOXO1 in L-F1KO hepatocytes abolished the suppressing effect of glucagon on NRF1 and TFAM expression (P < 0.05, Fig. 7E and F).
Glucagon attenuates mitochondrial biosynthesis in the liver. (A) mtDNA copy numbers were measured relative to the nuclear DNA in control and L-F1KO hepatocytes treated with or without 100 nM glucagon for 10 h. *P < 0.05 vs CNTR-Vehicle; #P < 0.05 vs CNTR-Glucagon, n = 3. (B) Electron microscopy study of mitochondrial biogenesis and morphology in the livers from random-fed control and L-F1KO male mice injected with or without 16 μg/kg glucagon for 1h. Scale bar, 500 nm. (C) The mRNA expressions of TFAM and NRF1 were measured in control and L-F1KO hepatocytes treated with or without 100 nM glucagon for 10 h by qPCR. *P < 0.05 vs CNTR; #P < 0.05 vs CNTR-Glucagon. (D) The mRNA expressions of TFAM and NRF1 in livers of the fasted control and db/db mice by qPCR. *P < 0.05 vs CNTR. (E and F) Western blots (F) and corresponding quantification (G) of TFAM and NRF1 in control and L-F1KO hepatocytes treated with or without 100 nM glucagon for 10 h. *P < 0.05 vs CNTR-Vehicle; #P < 0.05 vs CNTR-Glucagon. (G and H) Western blots (G) and corresponding quantification (H) of TFAM and NRF1 in livers of fasted control and db/db mice. **P < 0.01 vs CNTR. (I) The mRNA expressions of Ppargc1a and Sirt1 were measured in control and L-F1KO primary hepatocytes treated with or without 100 nM glucagon for 10 h. *P < 0.05, **P < 0.01 vs CNTR-Vehicle; #P < 0.05, ##P < 0.01 vs CNTR-Glucagon. (J) The mRNA expression of Fis1, Drp1, Mfn1, and Mfn2 were detected in control and L-F1KO hepatocytes treated with or without 100 nM glucagon for 10 h by qPCR. *P < 0.05 vs CNTR-Glucagon.
Citation: Journal of Endocrinology 241, 3; 10.1530/JOE-19-0081
Then, we detected the expression of NRF1 and TFAM in the db/db mice livers. Compared with the liver of control mice, mRNA expression levels of Nrf1 and Tfam were decreased by 40 and 36% in the db/db mice liver (P < 0.05; Fig. 7D). Similarly, db/db mice liver showed 30 and 40% decrease in NRF1 and TFAM protein, respectively, compared with that in control mice (P < 0.01; Fig. 7G and H). PPARGC1A plays an important role in mitochondrial biogenesis. We found that glucagon increased the expression of Ppargc1a by 5- and 2.5-fold in control and L-F1KO primary hepatocytes, respectively (P < 0.01; Fig. 7I). Considering the activity of PPARGC1A is induced by SIRT1-mediated deacetylation, we examined the Sirt1 level in primary hepatocytes. The result showed that glucagon treatment decreased Sirt1 expression by 33% in control hepatocytes but not in L-F1KO hepatocytes (P < 0.05; Fig. 7I). We also detected the hepatic mitochondrial fission and fusion genes. Glucagon increased the expression of Mitofusin 2 (Mfn2) by 2.2-fold in control hepatocytes rather than in L-F1KO hepatocytes (P < 0.05). However, we did not observe the effect of glucagon on the levels of Fission 1 (Fis1), Dynamin-related protein 1 (Drp1) and Mfn1 in hepatocytes (Fig. 7J). Together, these results suggest that glucagon potentially attenuates hepatic mitochondrial biogenesis and dynamics involved in control of NRF1, TFAM and MFN2 expression, which is dependent on FOXO1.
Discussion
Glucagon is traditionally an anti-hypoglycemic hormone, cooperating with insulin to govern the metabolic homeostasis. Glucagon excess is essential for the development of diabetes. High level glucagon contributes to hyperglycemia in diabetic animals and humans. In this study, we demonstrated that glucagon, especially in long-term hyperglucagonemia condition, decreases the expression of genes responsible for mitochondrial biogenesis and function in a FOXO1-dependent manner.
FOXO1, a key mediator of insulin signaling in control of blood glucose homeostasis, also regulates mitochondrial function in the liver. Deletion of FOXO1 can rescue the dysfunctional mitochondria in the liver deficient for IRS1 and IRS2 in mice (Cheng et al. 2009). We demonstrated that glucagon increases FOXO1 activity by promoting its nuclear translocation and stability via phosphorylation of FOXO1 at Ser 273 (Wu et al. 2018). We also observed that glucagon increased FOXO1 expression in both mRNA and protein level. Our results in this study further showed that FOXO1 is an important mediator in glucagon signaling in control of mitochondrial biogenesis and function.
Heme is a cofactor used commonly for multiple biological reactions (Kim et al. 2012). Heme and iron-sulfur clusters are required by proteins in the mitochondrial ETC for correct folding and assembly into a functional complex with full activity (Atamna et al. 2002). In our study, glucagon administration reduced heme production depending on FOXO1. The reduced level of heme is possibly responsible for the downregulated hepatic oxygen consumption by glucagon. Glucagon suppressed the expression of FXN and UROD via FOXO1 to regulate heme pool. Frataxin is a conserved mitochondrial protein and involved in cellular iron metabolism. Frataxin acts to protect bioavailable iron within mitochondria and to facilitate its use for heme synthesis (Zhang et al. 2005). Frataxin is also associated with mitochondrial membranes and involved in mitochondrial iron homeostasis. Overexpression of frataxin in mammalian cells increased mitochondrial membrane potential and resulted in the elevation of cellular ATP content (Ristow et al. 2000). UROD participates in heme biosynthetic process by catalyzing conversion of URO’GEN to coproporphyrinogen III (Ajioka et al. 2006). Dysregulation of UROD expression results in retardation of heme maturation. Therefore, the downregulated expression of FXN and UROD by glucagon can contribute to a reduction of heme biosynthesis in the liver and affect hepatic mitochondrial function.
Oxidative phosphorylation is driven by proteins located within the mitochondrial inner membranes and ETC (Wallace 1999). Heme plays an important role in mitochondrial oxidation by promoting electron transport and maintaining expression and stability of complexes III and IV (Atamna et al. 2001, Cheng et al. 2009). We observed that only UQCRC1 and MT-CO1 (heme-dependent) were impaired after glucagon treatment, indicating the decrease in mitochondrial heme pool by glucagon. Therefore, glucagon can intervene the integrity of ETC by regulating UQCRC1 and MT-CO1 to decrease the mitochondrial oxidative phosphorylation.
During the fasting condition, insulin level falls and glucagon becomes dominant for increasing gluconeogenesis and glycogenolysis, which requires energy supply. Attenuated hepatic mitochondrial activity by glucagon can lead to temporal energy deficit, which might impair the ability of glucagon to promote glucose production in the liver. However, during the fasting status, glucagon stimulates the liver to utilize free fatty acid efficiently providing energy for glucose production and conversion of fatty acid into ketone bodies (von Meyenn et al. 2013). Fatty acid oxidation assay in mouse hepatocytes showed that palmitate, largely triggered fatty acid β-oxidation to maintain normal energy production, overriding the glucagon-suppressed mitochondrial function. Therefore, although increased secretion of glucagon under the fasting condition, the increase of fatty acid flux from lipolysis of adipose tissue majorly governs the metabolic regulation and mitochondrial function with enhanced fatty acid oxidation, so that temporal glucagon-suppressed mitochondrial function is secondary to the metabolic demand as adaptive compensation.
Patients with type 2 diabetes typically show normal-to-high fasting glucagon level that fails to properly decrease after nutrition intake (Müller et al. 2017). Continuously high level of glucagon was supposed to play roles in the development of chronic hyperglycemia and diabetes. Inhibition of glucagon action can alleviate hyperglycemia in type 2 diabetes (Liang et al. 2004). Hepatic mitochondrial function and biogenesis were inhibited in db/db mice, which can be recovered by the deletion of FOXO1 (Cheng et al. 2009). Our previous research showed that db/db mice exhibited 2–3 times higher in blood glucagon level than that in wild-type mice (Wu et al. 2018). Our study shows that db/db mice displayed significantly decreased hepatic mitochondrial function, which is possibly caused by hyperglucagonemia. Therefore, long-term high glucagon level might cause severe defect of hepatic mitochondrial function, resulting in energy deficit that cannot be compensated by substrate-increased fatty acid oxidation. More seriously, dysfunctional hepatic mitochondria can impair fatty acid oxidation activity, resulting in fatty liver diseases. Thus, managing glucagon level into a reasonable range is a critical therapy for the management of type 2 diabetes, not only because of controlling blood glucose but also rescuing hepatic mitochondrial function.
PPARGC1A plays a role in mitochondrial function and biogenesis by triggering the expression of nuclear respiration factor-1 (NRF1) and mitochondrial transcriptional factor A (TFAM) (Liu et al. 2011). Glucagon treatment increased the expression of Ppargc1a. However, NRF1 and TFAM were downregulated after glucagon treatment. This paradox might be explained by the acetylation of PPARGC1A. PPARGC1A is heavily acetylated by acetyltransferase GCN5, inhibiting its activity. SIRT1, modulated by NAD+/NADH, deacetylates PGC1α to increase its activity on transcriptional targets (Scarpulla 2011). We observed that glucagon decreased Sirt1 mRNA level in a FOXO1-dependent manner. Therefore, PPARGC1A might maintain high level of acetylation and its activity remains suppressed. However, we cannot exclude the possibility that FOXO1 plays a role in regulating expression NRF1 and TFAM directly. Mitochondrial constantly adjust their shapes by fusion, fission, and motility in response to the cellular energy status (Youle et al. 2012). Fusion process allows one mitochondrion to compensate for other mitochondrial dysfunction by sharing transfer RNAs, ribosomal RNAs or proteins (Nasrallah et al. 2014). Increased fusion gene (Mfn2) by glucagon potentially stimulated hepatic mitochondrial fusion to rescue their function defects caused by glucagon. Therefore, during the fasting period, glucagon tends to regulate hepatic mitochondrial dynamics and biogenesis, which will be recovered in the feeding state. However, long-term high glucagon level, especially in type 2 diabetic patients, possibly will cause significant defects in hepatic mitochondrial biogenesis.
Glucagon primarily maintains blood glucose by inducing gluconeogenesis and glycogenolysis, and promotes fatty acid oxidation to ensure energy supply during the fasting condition (Habegger et al. 2010, von Meyenn et al. 2013). In diabetic status, long-term high level of glucagon leads to severe hepatic mitochondrial dysfunction through increasing FOXO1. Hyperglucagonemia also contributes to the increased blood glucose level, which together with glucagon-induced hepatic mitochondrial dysfunction will result in other liver diseases (Fig. 8). Taken together, this study reveals a negative effect of glucagon on hepatic mitochondrial function in a FOXO1-dependent manner. This study further provides evidence that FOXO1, an important mediator in the glucagon signaling, is a potentially important therapeutic target for type 2 diabetes.
A schematic diagram representing the function of glucagon in diabetic state. In diabetic condition, glucagon maintains at high level to significantly increase hepatic glucose production by glycogenolysis and gluconeogenesis. Meanwhile, high level of glucagon decreases the expression of FXN and UROD in a FOXO1-dependent manner to reduce the heme pool, impairing heme-dependent UQCRC1 (complex III) and MT-CO1 (complex IV). Moreover, glucagon also decreases NRF1 and TFAM to attenuate the hepatic mitochondrial biogenesis in a FOXO1-dependent manner. Therefore, hyperglucagonemia suppresses the hepatic mitochondrial function and biogenesis. The hyperglycemia and dysfunctional hepatic mitochondria rendered by hyperglucagonemia will further lead to other liver diseases. A full colour version of this figure is available at https://doi.org/10.1530/JOE-19-0081.
Citation: Journal of Endocrinology 241, 3; 10.1530/JOE-19-0081
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by National Institutes of Health grant (RO1 DK095118), American Diabetes Association Career Development Award (1-15-CD-09), American Heart Association grant (BGIA-7880040), Faculty Start-up funds from Texas A&M University Health Science Center and AgriLife Research, and USDA National Institute of Food and Agriculture grant (Hatch 1010958) to S G.
Acknowledgement
The authors thank the scientists at Metabolon Inc. for data generation and analysis.
References
Ajioka RS, Phillips JD & Kushner JP 2006 Biosynthesis of heme in mammals. Biochimica et Biophysica Acta 1763 723–736. (https://doi.org/10.1016/j.bbamcr.2006.05.005)
Atamna H & Frey Ii WH 2007 Mechanisms of mitochondrial dysfunction and energy deficiency in Alzheimer’s disease. Mitochondrion 7 297–310. (https://doi.org/10.1016/j.mito.2007.06.001)
Atamna H, Liu J & Ames BN 2001 Heme deficiency selectively interrupts assembly of mitochondrial complex IV in human fibroblasts: relevance to aging. Journal of Biological Chemistry 276 48410–48416. (https://doi.org/10.1074/jbc.M108362200)
Atamna H, Walter PB & Ames BN 2002 The role of heme and iron-sulfur clusters in mitochondrial biogenesis, maintenance, and decay with age. Archives of Biochemistry and Biophysics 397 345–353. (https://doi.org/10.1006/abbi.2001.2671)
Baggio LL & Drucker DJ 2007 Biology of incretins: GLP-1 and GIP. Gastroenterology 132 2131–2157. (https://doi.org/10.1053/j.gastro.2007.03.054)
Cheng Z, Guo S, Copps K, Dong X, Kollipara R, Rodgers JT, Depinho RA, Puigserver P & White MF 2009 FoxO1 integrates insulin signaling with mitochondrial function in the liver. Nature Medicine 15 1307–1311. (https://doi.org/10.1038/nm.2049)
Consoli A 1992. Role of liver in pathophysiology of NIDDM. Diabetes Care 15 430–441. (https://doi.org/10.2337/diacare.15.3.430)
Habegger KM, Heppner KM, Geary N, Bartness TJ, Dimarchi R & Tschöp MH 2010 The metabolic actions of glucagon revisited. Nature Reviews: Endocrinology 6 689–697. (https://doi.org/10.1038/nrendo.2010.187)
Jiang G & Zhang BB 2003 Glucagon and regulation of glucose metabolism. American Journal of Physiology: Endocrinology and Metabolism 284 E671–E678. (https://doi.org/10.1152/ajpendo.00492.2002)
Khiati S, Baechler SA, Factor VM, Zhang H, Huang SY, Dalla Rosa I, Sourbier C, Neckers L, Thorgeirsson SS & Pommier Y 2015 Lack of mitochondrial topoisomerase I (TOP1mt) impairs liver regeneration. PNAS 112 11282–11287. (https://doi.org/10.1073/pnas.1511016112)
Kim HJ, Khalimonchuk O, Smith PM & Winge DR 2012 Structure, function, and assembly of heme centers in mitochondrial respiratory complexes. Biochimica et Biophysica Acta 1823 1604–1616. (https://doi.org/10.1016/j.bbamcr.2012.04.008)
Lee S & Dong HH 2017 FoxO integration of insulin signaling with glucose and lipid metabolism. Journal of Endocrinology 233 R67–R79. (https://doi.org/10.1530/JOE-17-0002)
Lee Y, Wang MY, Du XQ, Charron MJ & Unger RH 2011 Glucagon receptor knockout prevents insulin-deficient type 1 diabetes in mice. Diabetes 60 391–397. (https://doi.org/10.2337/db10-0426)
Liang Y, Osborne MC, Monia BP, Bhanot S, Gaarde WA, Reed C, She P, Jetton TL & Demarest KT 2004 Reduction in glucagon receptor expression by an antisense oligonucleotide ameliorates diabetic syndrome in db/db mice. Diabetes 53 410–417. (https://doi.org/10.2337/diabetes.53.2.410)
Liu C & Lin JD 2011 PGC-1 coactivators in the control of energy metabolism. Acta Biochimica and Biophysica Sinica 43 248–257. (https://doi.org/10.1093/abbs/gmr007)
Lu M, Wan M, Leavens KF, Chu Q, Monks BR, Fernandez S, Ahima RS, Ueki K, Kahn CR & Birnbaum MJ 2012 Insulin regulates liver metabolism in vivo in the absence of hepatic Akt and FoxO1. Nature Medicine 18 388–395. (https://doi.org/10.1038/nm.2686)
Miller RA & Birnbaum MJ 2016 Glucagon: acute actions on hepatic metabolism. Diabetologia 59 1376–1381. (https://doi.org/10.1007/s00125-016-3955-y)
Montgomery MK & Turner N 2015 Mitochondrial dysfunction and insulin resistance: an update. Endocrine Connections 4 R1–R15. (https://doi.org/10.1530/EC-14-0092)
Müller TD, Finan B, Clemmensen C, Dimarchi RD & Tschöp MH 2017 The new biology and pharmacology of glucagon. Physiological Reviews 97 721–766. (https://doi.org/10.1152/physrev.00025.2016)
Nakae J, Park BC & Accili D 1999 Insulin stimulates phosphorylation of the forkhead transcription factor FKHR on serine 253 through a wortmannin-sensitive pathway. Journal of Biological Chemistry 274 15982–15985. (https://doi.org/10.1074/jbc.274.23.15982)
Nasrallah CM & Horvath TL 2014 Mitochondrial dynamics in the central regulation of metabolism. Nature Reviews: Endocrinology 10 650–658. (https://doi.org/10.1038/nrendo.2014.160)
Rena G, Guo S, Cichy SC, Unterman TG & Cohen P 1999 Phosphorylation of the transcription factor forkhead family member FKHR by protein kinase B. Journal of Biological Chemistry 274 17179–17183. (https://doi.org/10.1074/jbc.274.24.17179)
Ristow M, Pfister MF, Yee AJ, Schubert M, Michael L, Zhang CY, Ueki K, Michael MD, Lowell BB & Kahn CR 2000 Frataxin activates mitochondrial energy conversion and oxidative phosphorylation. PNAS 97 12239–12243. (https://doi.org/10.1073/pnas.220403797)
Sandoval DA & D’Alessio DA 2015 Physiology of proglucagon peptides: role of glucagon and GLP-1 in health and disease. Physiological Reviews 95 513–548. (https://doi.org/10.1152/physrev.00013.2014)
Scarpulla RC 2011 Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochimica et Biophysica Acta 1813 1269–1278. (https://doi.org/10.1016/j.bbamcr.2010.09.019)
Schmoll D, Walker KS, Alessi DR, Grempler R, Burchell A, Guo S, Walther R & Unterman TG 2000 Regulation of glucose-6-phosphatase gene expression by protein kinase Bα and the forkhead transcription factor FKHR evidence for insulin response unit-dependent and-independent effects of insulin on promoter activity. Journal of Biological Chemistry 275 36324–36333. (https://doi.org/10.1074/jbc.M003616200)
Unger RH 1978 Role of glucagon in the pathogenesis of diabetes: the status of the controversy. Metabolism: Clinical and Experimental 27 1691–1709. (https://doi.org/10.1016/0026-0495(78)90291-3)
von Meyenn F, Porstmann T, Gasser E, Selevsek N, Schmidt A, Aebersold R & Stoffel M 2013 Glucagon-induced acetylation of Foxa2 regulates hepatic lipid metabolism. Cell Metabolism 17 436–447. (https://doi.org/10.1016/j.cmet.2013.01.014)
Wallace DC 1999 Mitochondrial diseases in man and mouse. Science 283 1482–1488. (https://doi.org/10.1126/science.283.5407.1482)
Wu Y, Pan Q, Yan H, Zhang K, Guo X, Xu Z, Yang W, Qi Y, Guo CA, Hornsby C, et al.2018 Novel mechanism of FoxO1 phosphorylation in glucagon signaling in control of glucose homeostasis. Diabetes 67 2167–2182. (https://doi.org/10.2337/db18-0674)
Yoon T & Cowan JA 2004 Frataxin-mediated iron delivery to ferrochelatase in the final step of heme biosynthesis. Journal of Biological Chemistry 279 25943–25946. (https://doi.org/10.1074/jbc.C400107200)
Youle RJ & Van Der Bliek AM 2012 Mitochondrial fission, fusion, and stress. Science 337 1062–1065. (https://doi.org/10.1126/science.1219855)
Zhang Y, Lyver ER, Knight SA, Lesuisse E & Dancis A 2005 Frataxin and mitochondrial carrier proteins, Mrs3p and Mrs4p, cooperate in providing iron for heme synthesis. Journal of Biological Chemistry 280 19794–19807. (https://doi.org/10.1074/jbc.M500397200)
Zhang W, Patil S, Chauhan B, Guo S, Powell DR, Le J, Klotsas A, Matika R, Xiao X, Franks R & Heidenreich KA 2006 FoxO1 regulates multiple metabolic pathways in the liver effects on gluconeogenic, glycolytic, and lipogenic gene expression. Journal of Biological Chemistry 281 10105–10117.
Zhang K, Li L, Qi Y, Zhu X, Gan B, Depinho RA, Averitt T & Guo S 2012 Hepatic suppression of FoxO1 and Foxo3 causes hypoglycemia and hyperlipidemia in mice. Endocrinology 153 631–646. (https://doi.org/10.1210/en.2011-1527)
