Abstract
Hyperglycemia plays a major role in the development of diabetic macrovascular complications, including atherosclerosis and restenosis, which are responsible for the most of disability and mortality in diabetic patients. Osteopontin (OPN) is an important factor involved in atherogenesis, and hyperglycemia enhances the transcriptional activity of FoxO1 which is closely association with insulin resistance and diabetes. Here, we showed that plasma OPN levels were significantly elevated in type 2 diabetic patients and positively correlated with glycated albumin (GA). The more atherosclerotic lesions were observed in the aorta of diabetic ApoE−/− mice analyzed by Sudan IV staining. High glucose increased both the mRNA and protein expression levels of OPN and inhibited the phosphorylation of FoxO1 in RAW 264.7 cells. Overexpression of WT or constitutively active mutant FoxO1 promoted the expression levels of OPN, while the dominant-negative mutant FoxO1 decreased slightly the expression of OPN. Conversely, knockdown of FoxO1 reduced the expression of OPN. Luciferase reporter assay revealed that high glucose and overexpression of FoxO1 enhanced the activities of the OPN promoter region nt −1918 ~ −713. Furthermore, the interactions between FoxO1 and the OPN promoter were confirmed by electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP). Our results suggest that high glucose upregulates OPN expression via FoxO1 activation, which would play a critical role in the development of diabetic atherogenesis.
Introduction
Hyperglycemia is believed to play a major role in the development of diabetic macrovascular complications, including atherosclerosis and restenosis, which are responsible for the most of disability and mortality observed in diabetic patients (Beckman et al. 2002). Multiple potential molecular mechanisms have been proposed to explain hyperglycemia-induced diabetic complications, such as (1) increased polyol activity, causing sorbitol and fructose accumulation, (2) activation of protein kinase C (PKC) pathway, (3) reactive oxygen species (ROS) accumulation, ultimately leading to increased oxidative stress, (4) increased advanced glycation end products (AGE) formation and (5) increased hexosamine pathway (Kitada et al. 2010, Son 2012). Nevertheless, the underlying mechanisms through which hyperglycemia increases macrovascular complications still have not been fully elucidated.
Osteopontin (OPN) is an integrin-binding ligand, N-linked glycoprotein, which was recognized as a proinflammatory and pro-atherogenic cytokine (Cho et al. 2009, Wolak 2014). In the progress of atherosclerosis, OPN have been shown to be highly expressed in macrophages, vascular smooth muscle cells (VSMCs) and endothelial cells (ECs) in human atherosclerotic plaque (Ikeda et al. 1993, O’Brien et al. 1994, Takemoto et al. 2000). Evidence from several genetic mouse models suggests that foamy macrophage aggregations and atherosclerotic lesions were attenuated in OPN-deficient mice (Bruemmer et al. 2003, Matsui et al. 2003). Further study showed that the circulating levels of OPN were elevated in proportion to progression of diabetic complications (Yamaguchi et al. 2004). Moreover, high plasma OPN levels were found to be independently associated with the severity of coronary atherosclerosis (Momiyama et al. 2010) and increased risk for major adverse cardiac events (Rosenberg et al. 2008, Okyay et al. 2011, Bjerre et al. 2013). These studies suggested that OPN is probably not only a marker of the atherosclerotic process but also an active mediator in the atherosclerotic pathogenesis in diabetic patients (Wolak 2014). Several studies have been reported that hyperglycemia upregulates OPN levels in VSMCs and ECs (Takemoto et al. 1999, Kawamura et al. 2004). However, the expression of OPN regulated by hyperglycemia has not been elucidated in macrophages, which are major cellular components of early and advanced atherosclerotic lesions.
The regulation of OPN transcription has been reported to require the concerted action of various transcription factors or cofactors, such as AP-1 (Renault et al. 2003), Ets-1 and Runx2 (Inman & Shore 2003, Wai et al. 2006, Abe et al. 2008), which play critical roles in different kinds of organs or cells, respectively. For example, nuclear factor of activated T cells (NFATs) has been found to be involved in the regulation of high glucose-induced OPN expression in VSMCs (Nilsson-Berglund et al. 2010). Nevertheless, transcription factors involved in regulation of OPN expression in macrophages remains unknown.
Forkhead family of transcription factors is characterized by a conserved DNA-binding domain (the ‘Forkhead box’ or FOX), among which FoxA2, FoxO1 and FoxC2 are closely association with insulin resistance and diabetes (Gross et al. 2009). FoxO proteins are a subgroup of the Forkhead family. It has been reported that high glucose promotes the activity of FoxO1 by inhibiting the phosphorylation of FoxO1, facilitating nuclei gathering and enhancing the DNA-binding capacity in ECs (Marchetti et al. 2006, Behl et al. 2009). Additionally, hyperglycemia and oxidative stress could activate FoxO1 in ECs, increase the production of iNOS-dependent NO/peroxynitrite and contribute to formation of atherosclerosis (Tanaka et al. 2009).
We have cloned and analyzed the sequence of human and mouse OPN promoter, then found several potential consensus sequences within the OPN promoter for FoxO1 binding, according to published consensus sequences (Biggs et al. 2001). Therefore, we presumed that hyperglycemia upregulates OPN expression through activation of FoxO1 in macrophages. In this study, we used FoxO1-expressing or -deficient cells as a model to investigate the effects of hyperglycemia on the regulation of OPN and its putative actions on diabetic vascular lesions. Here we provide evidence that hyperglycemia upregulates OPN expression through activation of FoxO1 in macrophages, which may be a possible pathogenesis of diabetic macrovascular complications.
Materials and methods
Cell lines
Mouse RAW 264.7 cells and human 293T cells were obtained from the American Type Culture Collection (ATCC), and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) in a humidified incubator with 5% CO2 atmosphere at 37°C.
Lentivirus and small-interfering RNA
Mouse FoxO1 gene was amplified by PCR using the cDNA of RAW 264.7 cells and confirmed by DNA sequencing. The mutants of FoxO1 including constitutively active mutant or phosphorylation-defective mutant FoxO1 (carrying three main phosphorylation sites, T24A/S253D/S316A, named FoxO1-ADA), and dominant-negative FoxO1 (containing the DNA-binding domain while lacking the transactivation domain, named FoxO1-Δ256), with HA tag in the C-terminal, were constructed by site-directed mutagenesis PCR as described (Nakae et al. 2001). The lentivirus encoding luciferase were used as a negative control, and designated as LV control.
Short hairpin RNAs (shRNAs) targeting mouse FoxO1 listed below were described in the earlier reports (Wei et al. 2011, Zhang et al. 2011). The scramble shRNA was used as the control (designed as shNon).
-
shFoxO1-1, CGGAGGATTGAACCAGTATAA
-
shFoxO1-2, CCGCCAAACACCAGTCTAAAT
-
shFoxO1-3, GAGCGTGCCCTACTTCAAGGA
-
shNon, AATTCTCCGAACGTGTCACGT
Quantitative real-time PCR
Total RNA was extracted using the RNAprep pure cell/Bacteria Kit (TIANGEN, Beijing, China) as described by the manufacturer. Reverse transcription of total RNA was performed using oligo (dT) primers (PrimeScript RT reagent Kit, TaKaRa). Quantitative real-time PCR was performed using an GoTaq qPCR Master Mix (Promega) on the ABI 7500 Real-Time PCR System (Applied Biosystems). The gene-specific primer pairs used were as follows: OPN (forward 5′-CTTTCACTCCAATCGTCCCTAC-3′ and reverse 5′-CCTTAGACTCACCGCTCTTCAT-3′), FoxO1 (forward 5′-TTCAATTCGCCACAATCTGTCC-3′ and reverse 5′-GGGTGATTTTCCGCTCTTGC-3′), GAPDH (forward 5′-ATTCAACGGCACAGTCAAGG-3′ and reverse 5′-TGTTAGTGGGGTCTCGCTCC-3′). Data acquisition and analysis of qRT-PCR assay were performed using the 7500 System SDS Software Version 1.2 (Applied Biosystems). Gene expression was normalized by GAPDH expression using the 2−ΔΔCT method.
Western blot analysis
Cell lysates, protein extracts and immunoblottings were carried out as previously described (Zheng et al. 2011). The antibodies used were mouse monoclonal anti-FoxO1 antibody (Cell Signaling Technology), rabbit monoclonal anti-phospho-FoxO1 (Thr24) antibody (Cell Signaling Technology), rabbit polyclonal anti-phospho-FoxO1 (Ser256) antibody (Cell Signaling Technology), anti-OPN (R&D) and a HRP-conjugated monoclonal mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (KangChen Biotechnology, Inc., Shanghai, China).
Enzyme-linked immunosorbent assay
The cell culture supernatants were collected for assay at indicated times after treatments and diluted at 5000-fold. The human plasma samples were collected and diluted at 25-fold. Then, the OPN levels were determined in triplicate by ELISA using commercial ELISA kits (R&D Systems) according to the manufacturer’s instruction and the absorbance was determined at 450 nm in ELISA microplate reader (Multiskan Ascent, Thermo Labsystems, Vantaa, Finland). The concentrations of OPN in cell culture media were normalized with counted cell numbers.
Cellular immunofluorescence assay
Cellular immunofluorescence assay was performed to detect FoxO1 location in RAW264.7 cells using anti-FoxO1 antibody (ab39670, Abcam). Briefly, cells were plated on poly-l-lysine-treated coverslips and cultured in serial concentration of glucose overnight. The cells were fixed in 4% paraformaldehyde in PBS pH 7.4 for 15 min at room temperature and permeabilized with 0.25% Triton X-100 for 10 min. After blocking with 1% BSA, the cells were incubated with anti-FoxO1 antibody overnight at 4°C. The next day, cells were incubated with a Alexa Fluor 488-coupled anti-rabbit IgG antibody (Cell Signaling) at room temperature for 1 h. After rinsing, the coverslips were counter stained in the fluoroshield mounting medium with DAPI (ab104139, Abcam) and sealed with nail polish. Finally, the stained cells were analyzed by Zeiss confocal microscopy and ZEISS LSM Image Browser, version 2.80 software (Carl Zeiss).
Cloning of mouse OPN promoter and construction of luciferase reporter gene vector
About two kilobase pair length of 5′-flanking region of the mouse OPN gene was divided to two segments according to the internal cleavage site EcoRI and then amplified from RAW 264.7 genomic DNA by PCR. The gene-specific primers were mOPN −1918~−713 nt (forward: 5′-AAGGTACCTTCCTATACCTCCCTAATTCGTG-3′, reverse: 5′-AAGAATTCCTCTCCTGCCTCCAC-3′) and mOPN −713~+79 nt (forward: 5′-AAGGTACCGAATTCAGGGTCACTGTGTGG-3′, reverse: 5′-AACTCGAGCTTGGCTGGTTTCCTCCG-3′).
The mutation primers for FBEs-deletion mutants were (forward: 5′-GAACAACACTCAAACTCCAGTGGGTG-3′, reverse: 5′-CACTGGAGTTTGAGTGTTGTTCAGGG-3′) and (forward: 5′-GTGTCTTTTATTCAGAGTACCCTTTAATGTG-3′, reverse: 5′-GGTACTCTGAATAAAAGACACAGCTTATATTTC-3′).
The PCR products were cloned respectively into pLB vector (TIANGEN) and confirmed by DNA sequencing. Then correct segments were digested by the restriction enzymes KpnI and XhoI, and inserted to pGL4.17 luciferase reporter gene vector (Promega).
Luciferase assays
The luciferase assays were performed using Luciferase Assay System (Promega) according to the manufacturer’s instructions. Luciferase activities were assayed using a BioTek Synergy HT Multi-Mode microplate reader (BioTek Instruments) and normalized with counted cell numbers.
Electrophoretic mobility shift assays (EMSA)
The nuclear extracts from RAW 264.7 cell were prepared using NE-PER Nuclear and Cytoplasmic Extraction Reagents Kit (Thermo). DNA-protein binding was detected by EMSA assay using LightShift chemiluminescent EMSA Kit (Thermo) according to the manufacturer’s protocol. Briefly, binding reactions were performed by adding 2 μg of nuclear extracts to a mixture containing 1× binding buffer (10 mM Tris, 50 mM KCl, 1 mM dithiothreitol, pH 7.5), 50 ng/µL poly(dI-dC), 2.5% glycerol, 0.05% NP-40, 5 mM MgCl2 and 10 fmol/µL of biotin-labeled double-stranded probes, in a final volume of 20 μL. Binding reactions were incubated at room temperature for 20 min. Competition reaction mixtures contained a 200-fold molar excess of non-labeled probes. The mixtures were then resolved by a native polyacrylamide gel and transferred to a nylon membrane. When the transfer was complete, DNA was ultraviolet (UV) cross-linked to the membrane at 120 mJ/cm2 using a ultraviolet cross-linker (SCIENTZ, Ningbo, China). The biotin end-labeled DNA was detected using streptavidin-horseradish peroxidase conjugate and a chemiluminescent substrate. The membrane was visualized by Bio-Rad ChemiDoc imaging system (Hercules, CA, USA).
The probe used were as follows: for probe 1, forward: 5′-GTGGGCGCAGAGTAAACTGCAGTGAA-3′ and reverse: 5′-TTCACTGCAGTTTACTCTGCGCCCAC-3′; for probe 2, forward: 5′-ACACTGAAAACACAAACTCCAGTGGG-3′ and reverse: 5′-CCCACTGGAGTTTGTG TTTTCAGTGT-3′.
Chromatin immunoprecipitation (ChIP) assay
ChIP studies were carried out using Chromatin Immunoprecipitation Assay Kit (Millipore) as previously described (Zheng et al. 2011). Briefly, RAW 264.7 cells were cross-linked with 1% formaldehyde for 10 min at 37°C, then followed by sonication four times for 15 s with 1-min interval. Protein–DNA complexes were incubated with 3 μg anti-FoxO1 antibody (Abcam) followed by immunoprecipitation. Purified DNA was subjected to PCR using the following primers to amplify the OPN promoter region −1918~−1569 nt (forward: 5′-TTCCTATACCTCCCTAATTCGTG-3′ and reverse: 5′-TGAGCATTTGGGTTATCTCTTGA-3′) and −349~−102 nt (forward: 5′-AATCCATACCTTTCATCCCCAC-3′ and reverse: 5′-CCTGCTCCTACACTTCCTCCTC-3′). For all PCR reactions, 10% input was analyzed along with immunoprecipitated samples.
Induction of diabetic mice, microdissection and lesion area measurement
Male ApoE-deficient mice and littermate control of C57BL/6J mice were purchased from Shanghai Model Organisms Center, China. ApoE−/− mice (n = 6) and C57BL/6J mice (n = 6) aged 6~8 weeks were injected with 50 mg/kg streptozotocin (STZ, Sigma) intraperitoneally for continuous 5 days. The other six ApoE−/− mice and C57BL/6J mice were injected with equal volume of vehicle (0.05M citrate buffer). Ten days after the first STZ injection, mice with blood glucose levels above 15 mmol/L were used. After 6 weeks, the mice were killed and perfused with PBS following with 4% paraformaldehyde. Then aortas were dissected out, split longitudinally and stained with Sudan IV. Finally, the aortas were photographed, and the lesion areas were measured by Image-Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA).
Patient selection
To analyze OPN concentrations in the plasma, 70 type 2 diabetes mellitus (T2DM) patients not receiving statins or antidiabetic medication were recruited from inpatients at the Shanghai Changzheng Hospital. Seventy healthy volunteers were also recruited as controls. T2DM are diagnosed by World Health Organization criteria based on both fasting plasma glucose concentrations and plasma glucose 2 h after an oral glucose tolerance test (OGTT). Patients and healthy volunteers with signs of infection and tumor were excluded. In addition, 20 atherosclerosis patients (10 with T2DM and 10 without T2DM) were recruited. All patients gave informed consent, and the study was approved by the Ethics Committee at Second Military Medical University (SMMU), Shanghai, China.
Human atherosclerotic plaque samples and immunohistochemistry
Endarterectomy specimens were obtained from carotid arteries of six diabetic patients with written informed consents and ethics committee approval of Second Military Medical University. The samples were fixed in 10% paraformaldehyde and decalcified with formic acid. Then, immunohistochemistry was performed as described before using anti-human OPN antibody (R&D), anti-human FoxO1 antibody (ab39670; Abcam) and anti-CD68 antibody (clone PG-M1; Reigncom Biotechnology, Ltd, Shanghai, China).
Statistical analysis
Data are presented as means ± s.e.m. Comparisons between groups were analyzed using two-tailed Student’s t test. The correlation of the parameters in patients was estimated by Spearman’s correlation coefficient. P < 0.05 was considered statistically significant. Statistical analyses were performed with SPSS software (version 19.0; IBM Corp.).
Results
Plasma OPN levels were significantly elevated in type 2 diabetes patients and positively correlated with glycated albumin (GA)
Firstly, we detected the expression levels of OPN in the plasma of type 2 diabetes patients. A total of 70 type 2 diabetes patients were recruited from inpatients, and 70 healthy volunteers as controls. As shown in Fig. 1A and Table 1, besides fasting blood glucose, HbA1c, GA and triglycerides, the OPN levels (35.83 ± 2.09 ng/mL) were significantly elevated in type 2 diabetes patients compared with controls (22.47 ± 1.28 ng/mL). Furthermore, the plasma OPN value was positively correlated with GA (r = 0.274, P = 0.023) in T2DM patients. Interestingly, the correlation with glycated hemoglobin (HbA1c) was not detected (P > 0.05).
The expression of OPN in type 2 diabetes patients with or without atherosclerosis. (A) Plasma OPN levels were detected with ELISA in 70 type 2 diabetes patients and 70 healthy volunteers. (B) Plasma OPN levels were detected with ELISA in atherosclerosis patients with or without type 2 diabetes. (C) The representative plaque samples from the carotid arteries of diabetic patients were analyzed by hematoxylin and eosin staining or immunohistochemical staining for OPN, FoxO1 and CD68. (×40 magnification). Values are mean ± s.e.m. *P < 0.05, **P < 0.01 (unpaired t test).
Citation: Journal of Endocrinology 242, 2; 10.1530/JOE-18-0594
Characteristics and laboratory findings of T2DM patients and healthy volunteers in the study.
| DM | Normal | P value | |
|---|---|---|---|
| Gender (female/male) | 24/46 | 48/22 | 0.477 |
| Age (years) | 64.30 ± 1.83 | 51.80 ± 2.07 | 0.334 |
| Fasting blood glucose (mmol/L) | 7.67 ± 0.72 | 4.75 ± 0.08 | 0.000 |
| HbA1c (%) | 8.59 ± 0.23 | 5.78 ± 0.12 | 0.000 |
| Glycated albumin (%) | 22.47 ± 0.89 | 14.1 ± 0.65 | 0.019 |
| Cholesterol (mg/dL) | 4.67 ± 0.15 | 4.64 ± 0.12 | 0.416 |
| Triglycerides (mg/dL) | 1.96 ± 0.12 | 1.37 ± 0.09 | 0.008 |
| LDL-cholesterol (mg/dL) | 2.99 ± 0.13 | 2.94 ± 0.10 | 0.308 |
| HDL-cholesterol (mg/dL) | 1.01 ± 0.03 | 1.24 ± 0.04 | 0.119 |
| Plasma osteopontin (ng/mL) | 35.83 ± 2.09 | 22.47 ± 1.28 | 0.000 |
Values are expressed as the mean ± s.e.m. Bold indicates statistical significance.
Then, we detected the OPN levels in additional 20 atherosclerosis patients (ten with T2DM and ten without T2DM) and found that the average levels of OPN in both atherosclerosis patients with and without T2DM were respectively more than those observed before in 70 T2DM patients and 70 healthy volunteers who were not considering for distinction with or without atherosclerosis (Fig. 1B and Table 2). Furthermore, the average levels of OPN in atherosclerosis patients with T2DM (48.05 ± 8.33 ng/mL) were more than those in atherosclerosis patients without T2DM (31.28 ± 4.38 ng/mL). Similarly, the plasma OPN value was positively correlated with GA (r = 0.850, P = 0.007) in T2DM patients.
Characteristics and laboratory findings of atherosclerosis patients with or without T2DM in the study.
| T2DM | Normal | P value | |
|---|---|---|---|
| Gender (female/male) | 5/5 | 5/5 | – |
| Age (years) | 67.4 ± 3.31 | 65.5 ± 5.42 | 0.128 |
| Fasting blood glucose (mmol/L) | 7.58 ± 0.86 | 5.13 ± 0.52 | 0.000 |
| HbA1c (%) | 9.70 ± 1.04 | 5.76 ± 0.45 | 0.000 |
| Glycated albumin (%) | 23.12 ± 2.00 | 12.45 ± 1.20 | 0.019 |
| Cholesterol (mg/dL) | 5.28 ± 0.48 | 4.68 ± 0.26 | 0.110 |
| Triglycerides (mg/dL) | 3.51 ± 1.12 | 1.66 ± 0.33 | 0.008 |
| LDL cholesterol (mg/dL) | 2.23 ± 0.36 | 3.06 ± 0.28 | 0.336 |
| HDL-cholesterol (mg/dL) | 1.47 ± 0.33 | 1.18 ± 0.14 | 0.043 |
| Plasma osteopontin (ng/mL) | 48.05 ± 8.33 | 31.28 ± 4.38 | 0.040 |
Values are expressed as the mean ± s.e.m. Bold indicates statistical significance.
Then, we further examine OPN protein expression in six human plaque samples from the carotid arteries of diabetic patients. Analysis of those plaque samples by hematoxylin and eosin staining revealed predominantly fatty streak lesions (Fig. 1C). Immunohistochemical analysis revealed the expression of OPN, FoxO1 and CD68 protein in plague sample.
High glucose enhances the expression of OPN and modulates FoxO1 phosphorylation in RAW 264.7 cells
The atherosclerotic plaques consist of a heterogeneous population of cells, including ECs, VSMCs and macrophages. As an immune modulator, OPN was reported to be expressed in a range of immune cells, including macrophages. Therefore, we purposed that high glucose enhance the OPN expression in macrophages. Then, we used RAW 264.7 cells, a mouse macrophage cell line, to examine the effect of high glucose on the expression of OPN in macrophages. RAW 264.7 cells were cultured in DMEM media with different concentration of glucose (5 mM, 10 mM and 25 mM, respectively) for 48 h. As shown in Fig. 2A, high glucose (10 mM and 25 mM) increased the expression of OPN mRNA in RAW264.7 cells compared with low glucose group (5 mM), in a dose-dependent manner. Furthermore, the intracellular and secreted OPN protein levels were detected by Western blot analysis (Fig. 2B) and ELISA (Fig. 2C) using whole-cell lysates and cell culture supernatants, respectively. The results showed that the concentration of 25 mM glucose induced a 2.3-fold and 2.5-fold increases respectively on OPN at mRNA levels and supernatant protein levels compared with low glucose group (5 mM). The cellular immunofluorescence assay showed that FoxO1 was transported into the nucleus when the RAW264.7 cells were cultured in media with high glucose (Fig. 2F), suggesting that high glucose activates FoxO1 and its dependent transcription in macrophages. Taken together, these results indicate that high glucose could stimulate OPN expression in RAW 264.7 cells.
High glucose increases the expression of OPN and modulates FoxO1 phosphorylation in RAW 264.7 cells. (A) RAW264.7 cells were cultured in medium containing different concentration of glucose (5, 10, 25 mM) for an additional 48 h. The levels of OPN mRNA expression were determined by quantitative PCR and estimated by the ratio of OPN signal to GAPDH signal. (B) The protein lysated from (A) were analyzed for the expression of OPN, phosphorylated and total FoxO1 by Western blot. (C) The secreted OPN protein levels were detected by ELISA from cell culture supernatants. (D) RAW264.7 cells were stimulated by different concentration of insulin (1, 10, 100 nM) for 2 h, and detected for the expression levels of OPN mRNA by qPCR. (E) RAW264.7 cells were stimulated by different concentration of insulin (1, 10 nM) for 3 h and analyzed for the expression of OPN, phosphorylated and total FoxO1 by Western blot. (F) Immunofluorescence staining shows the distribution of FoxO1 in the cytoplasm and nucleus of RAW264.7 cultured in the media with 5 mM or 25 mM glucose by means of confocal microscopy. Each value represents mean ± s.e.m. obtained from three independent experiments. *P < 0.05, **P < 0.01 (unpaired t test).
Citation: Journal of Endocrinology 242, 2; 10.1530/JOE-18-0594
Furthermore, we determined FoxO1 phosphorylation changed by high glucose stimulation in macrophages. We found that high glucose inhibited the phosphorylation of FoxO1 at Thr24 and Ser256 (Fig. 2B). When RAW 264.7 cells were stimulated with insulin, the phosphorylation of FoxO1 at Ser256 and Thr24 were induced and OPN was upregulated both in mRNA (Fig. 2D) and protein levels (Fig. 2E).
Overexpression of FoxO1 positively regulated OPN expression in RAW 264.7 cells
To investigate the regulation role of FoxO1 on OPN expression, RAW 264.7 cells were infected with lentivirus encoding wild-type FoxO1 (FoxO1-WT), phosphorylation-defective mutant FoxO1 (FoxO1-ADA) or dominant-negative form of FoxO1 (FoxO1-Δ256), respectively. As shown in Fig. 3, OPN expression was significantly increased in RAW 264.7 cells infected with LV-FoxO1-WT or LV-FOXO1-ADA, but decreased slightly in the cells infected with LV-FoxO1-Δ256, compared with LV-control infected cells at both mRNA and protein levels. The results indicated that FoxO1 is involved in regulation of OPN expression, and the active form but not dominant-negative form of FoxO1 plays an important role especially.
Overexpression of FoxO1 upregulates OPN expression in RAW 264.7 cells. (A) RAW264.7 cells were infected with lentivirus encoding wild-type FoxO1 (FoxO1-WT), phosphorylation-defective mutant FoxO1 (FoxO1-ADA) or dominant-negative form of Foxo1 (FoxO1-Δ256) as indicated. The levels of OPN mRNA were determined by quantitative PCR and normalized to those of GAPDH. (B) The whole-cell extracts were assessed for the expression of FoxO1 and OPN by Western blot analysis. (C) The secreted OPN protein levels were detected by ELISA using cell culture supernatants. Each value represents mean ± s.e.m. obtained from three independent experiments. *P < 0.05, **P < 0.01 compared with LV control (unpaired t test).
Citation: Journal of Endocrinology 242, 2; 10.1530/JOE-18-0594
Silencing expression of FoxO1 negatively regulated OPN expression in RAW 264.7 cells
To further confirm FoxO1 involved in OPN expression in RAW 264.7 cells, we designed three distinct shRNA targeting FoxO1 to downregulate its expression. The lentivirus-mediated shRNA interference of FoxO1 in RAW264.7 cells were confirmed by qRT-PCR (Fig. 4A) and Western blot (Fig. 4C). The silencing of FoxO1 resulted in decreased OPN expression in mRNA levels by 81, 91 and 69% respectively (Fig. 4B). The decreases of the intracellular and secreted OPN protein levels were also identified by Western blot analysis (Fig. 4C) and ELISA (Fig. 4D). The three shFoxO1 induced a 79, 58 and 79% decrease respectively at supernatant protein levels compared with scrambled shRNA. Silencing of FoxO1 expression inhibited the OPN expression promoted by high glucose (Fig. 4E). Taken together, these results indicated that downregulated FoxO1 expression could reduce OPN expression in RAW264.7 cells.
Silencing expression of FoxO1 decreases OPN expression in RAW 264.7 cells. (A) RAW264.7 cells were infected with lentivirus containing three distinct short hairpin RNA (shRNA) targeting FoxO1 or scrambled shRNA (shNon). The levels of FoxO1 were normalized to those of GAPDH after qRT-PCR. (B) The levels of OPN mRNA were detected by qRT-PCR. (C) The whole-cell extracts were assessed for the expression of FoxO1 and OPN by Western blot analysis. (D) The secreted OPN protein levels were detected by ELISA using cell culture supernatants. (E) RAW264.7 cells infected with LV-shFoxO1 or LV-shNon were cultured in media with 5 mM or 25 mM glucose for 48 h, then were detected for OPN mRNA levels by qPCR. Each value represents mean ± s.e.m. obtained from three independent experiments. *P < 0.05, **P < 0.01 compared with LV-shNon (unpaired t test).
Citation: Journal of Endocrinology 242, 2; 10.1530/JOE-18-0594
FoxO1 enhanced the transcriptional activity of the OPN promoter regulated by high glucose
As mentioned earlier, FoxO1 plays a role in the expression of OPN in macrophages. FoxO1 is a transcriptional factor, so we firstly supposed that FoxO1 regulates the OPN expression through binding and activating the OPN promoter directly. By a bioinformatic analysis of mouse OPN gene promoters, we found that there are two consensus sequences for FoxO1 binding and several suboptimal binding sites located in −1918 ~ −713 sites while no FBEs in −713 ~ +79 sites. Then, the DNA fragments of −1918 ~ +79 and −713 ~ +79 were respectively cloned into pGL4.17 vector and luciferase reporter assays were performed. The results showed that there were high transcriptional activities in the nt −1918 to +79 of OPN promoter, but a significant reduction in the nt −713 ~ +79 (Fig. 5A). To evaluate the potential of FBEs in the transcriptional activity of OPN promoter, deletion of either or both FBEs were constructed and inserted to pGL4.17 vector. Luciferase reporter assay showed that deletion of the putative FBEs dramatically decreased the activity of the OPN promoter, especially for double-deletion mutant (Fig. 5A).
High glucose promotes the binding of FoxO1 with the OPN promoter in RAW 264.7 cells. (A) The RAW 264.7 cells stabled transfected with luciferase reporter gene containing different region of OPN promoter as indicated. Forks represent the mutant of putative FBEs in OPN promoter. The activities of luciferase were normalized by cells counting. (B) The cells were cultured in medium containing different concentration of glucose (5 mM, 10 mM and 25 mM) for 48 h and harvested to measure the activities of luciferase as described in (A). (C) The cells were infected with lentivirus encoding wild-type FoxO1 (FoxO1-WT), phosphorylation-defective mutant FoxO1 (FoxO1-ADA) or dominant-negative form of Foxo1 (FoxO1-Δ256) as indicated and harvested to measure the activities of luciferase as described in (A). (D) The cells were transfected with scrambled shRNA (shNon) or three distinct FoxO1-targeting short hairpin RNA (shFoxO1), and harvested to measure the activities of luciferase as described in (A). Each value represents mean ± s.e.m. obtained from three independent experiments. *P < 0.05, **P < 0.01 compared with LV-shNon (unpaired t test).
Citation: Journal of Endocrinology 242, 2; 10.1530/JOE-18-0594
Furthermore, upregulation or downregulation of FoxO1 enhanced or repressed the transcriptional activity of OPN promoter within −1918 ~ −713, respectively (Fig. 5C and D). These results indicated that nt −1918 to −713 might be the critical region for the basal transcriptional activity of the OPN promoter in RAW 264.7 cells, which are aligned with several FoxO1-binding sites located in −1918 ~ −713 sites by the bioinformatic analysis.
To identify whether high glucose promotes transcriptional activity of OPN promoter, the RAW264.7 cells stably transfected with pGL4.17-1918 or pGL4.17-713 plasmid were cultured in medium with various concentrations of glucose (5 mM, 10 mM and 25 mM). The luciferase report assays showed that high glucose promoted the luciferase activities of −1918 ~ +79 region of OPN promoters in a dose-dependent manner, but not of −713 ~ +79 region (Fig. 5B). Together, these data suggested that high glucose regulate the transcriptional activities of OPN promoter through FoxO1 binding to the nt −1918 ~−713 of OPN promoter.
Direct binding of FoxO1 to FoxO1-binding sites in the promoter of OPN
To visualize the interaction between FoxO1 and OPN promoter, EMSA and ChIP assays were performed. As shown in Fig. 6A, the nuclear extracts from RAW 264.7 formed complexes with one probe containing a FoxO1-binding consensus sequence (lanes 5), which was more than another probe containing a suboptimal binding site (lanes 2). Nevertheless, excess cold competitors eliminated the formations of the complex (lanes 3 and 6). The EMSA result showed initially that the nuclear extracts from RAW 264.7 cells binded to the two probes.
Direct binding of FoxO1 to FoxO1-binding sites in the promoter of OPN. (A) Analysis of protein–DNA complexes formed between oligonucleotides containing FoxO1-binding sites from OPN promoter and nuclear extracts (NE) from RAW 264.7 cells by EMSA. For oligonucleotide competition experiments, 200-fold excess of unlabeled oligonucleotides were added before the addition of the labeled probe. Specific shifts are marked with an arrow. Gel shown is representative of three independent experiments. (B) ChIP assays were performed to detect the binding of FoxO1 with OPN promoter in RAW 264.7 cells. The sheared DNA fragments were immunoprecipitated with antibody against FoxO1, and subjected to PCR using primer pairs located in the region nt −1918~−1569 and nt −349~−102 of the OPN promoter, respectively. The PCR results were separated in a 2% agarose gel. Gel shown is representative of three independent experiments. (C) RAW 264.7 cells were cultured in media with different concentration of glucose (5, 10, 25 mM) for 48 h, and then ChIP assays were performed to detect the binding of FoxO1 with OPN promoter as described in (B). Gel shown is representative of three independent experiments.
Citation: Journal of Endocrinology 242, 2; 10.1530/JOE-18-0594
To verify the in vivo binding of FoxO1 to its binding sites within OPN promoter, ChIP assay was performed in RAW264.7 cells transfected with shNon or shFoxO1. ChIP analysis revealed that FoxO1 was recruited on the region (−1918~−1569 nt) containing a FoxO1 binding consensus sequence of the OPN promoter, but not the region (−349~−102) containing no binding sites in RAW 264.7 cells transfected with shNon (Fig. 6B). Furthermore, downregulation of FoxO1 mediated by shRNA markedly reduced the binding of FoxO1 to OPN promoter (Fig. 6B). When RAW 264.7 cells were treated with high glucose, the binding of FoxO1 to the region (−1918~−1569 nt) of the OPN promoter were increased in dependent of the concentration of glucose (Fig. 6C). These data showed that FoxO1 could directly bind to the region (nt −1918 ~−713) of OPN promoter which could be promoted by high glucose.
High glucose accelerates atherogenesis in diabetic mice
To evaluate atherosclerotic lesion development in diabetic mice, we induced ApoE−/− mice and littermate control (C57BL/6J) to diabetic mice using STZ, which were confirmed by blood glucose detection (Fig. 7A). The mean blood glucose level of the diabetic C57BL/6J mice (24.4 ± 4.9 mmol/L) and ApoE−/− mice (25.6 ± 3.7 mmol/L) was much higher than that of wild-type mice (9.4 ± 1.0 mmol/L) and ApoE−/− mice (9.5 ± 0.4 mmol/L). After 6 weeks, the OPN levels in plasma were detected by ELISA and the results showed that both diabetic C57BL/6J mice (339.2 ± 27.5 ng/mL) and ApoE−/− mice (353.6 ± 6.3 ng/mL) elevated plasmic OPN levels compared to normal glycemic C57BL/6J mice (268.0 ± 9.7 ng/mL). Though the OPN levels of diabetic ApoE−/− mice is slightly more than those of normal glycemic ApoE−/− mice (340.3 ± 15.5 ng/mL), the differences were not statistically significant, which would due to the higher OPN levels of ApoE−/− mice compared to nondiabetic controls as reported before (Di Marco et al. 2016).
High glucose accelerates atherogenesis in diabetic mice. Male ApoE-deficient mice and littermate control of C57BL/6J mice were injected with 50 mg/kg STZ or equal volume of vehicle (0.05 M citrate buffer) intraperitoneally for continuous 5 days. (A) Ten days after the first STZ injection, the blood glucose levels of C57BL/6 wild-type mice (WT), ApoE−/− mice (ApoE−/−), STZ-induced diabetic wild-type mice (WT+STZ) and ApoE−/− mice (ApoE−/−+STZ), were detected by glucometers (n = 6/group). (B) Six weeks after the first STZ injection, the plasmic OPN levels of four groups of mice were detected by ELISA. (C) The representative images of mouse aortae analyzed by Sudan IV staining to visualize accumulation of lipids present in atherosclerotic lesions. (D) Mean atherosclerotic lesion areas of the mouse aorta were measured by Image-Pro Plus 6.0 software. Values are mean ± s.e.m. *P < 0.05, **P < 0.01 (unpaired t test).
Citation: Journal of Endocrinology 242, 2; 10.1530/JOE-18-0594
Then the total aortas were dissected and the lipid contents were determined by Sudan IV staining. As shown in Fig. 7C and D, diabetic ApoE−/− mice developed significantly larger atherosclerotic lesions in the aorta especially in the aortic arches (13.11 ± 1.26%), compared with nondiabetic ApoE−/− mice (6.69 ± 1.15%, P < 0.05), diabetic (0.07 ± 0.01%, P < 0.01) and nondiabetic wild-type mice (0.10 ± 0.01%, P < 0.01).
Discussion
The prevalence of diabetes is increasing worldwide due to aging, excess weight, physical inactivity, longer life expectancy and sedentary lifestyle. The microvascular and macrovascular complications are the most serious consequences of diabetes. For microvascular complications, diabetic nephropathy and retinopathy are common, which contribute to chronic renal failure and severe vision loss or blindness, respectively. For macrovascular complications, atherosclerosis and cardiovascular disease are the main causes for impaired life expectancy in patients with diabetes (Zeadin et al. 2013). Especially, complications of atherosclerosis cause most morbidity and mortality in patients with diabetes mellitus. Though multiple potential molecular mechanisms have been proposed to explain hyperglycemia-induced diabetic complications (Kitada et al. 2010, Son 2012), the underlying mechanisms still have not been fully elucidated.
In recent years, many molecules were found to be associated with atherosclerosis, such as OPN (Ikeda et al. 1993, O’Brien et al. 1994, Takemoto et al. 2000, Poggio et al. 2011), leukocyte transport-related vascular adhesion protein-1 (VAP-1) (Silvola et al. 2016), CD137 (Olofsson et al. 2008), insulin-like growth factor 1 (IGF-1) (Higashi et al. 2016) and neutrophil gelatinase-associated lipocalin (NGAL) (Hemdahl et al. 2006). Among of them, OPN is a secreted extracellular matrix protein and proinflammatory cytokine, which was found to be highly expressed in atherosclerotic lesion areas (Ikeda et al. 1993, O’Brien et al. 1994, Takemoto et al. 2000, Poggio et al. 2011). In OPN and apolipoprotein E deficient mice, both atherosclerotic plaque formation and macrophage deposition were reduced (Matsui et al. 2003), suggesting that OPN plays a promoting effect in atherosclerosis. Therefore, OPN is regarded as an important factor in the formation of atherosclerotic plaques.
Further studies showed that plasma OPN levels were elevated in diabetic (Nakamachi et al. 2007) and obese patients (Gomez-Ambrosi et al. 2007). GA is a more sensitive indicator of short-term variations of glycemic control than HbA1c during treatment of diabetic patients. It also acts as an indicator of intermediate glycation and as a causative agent of the damage of diabetes complications, especially in atherosclerosis. Our data showed that the plasma OPN levels were positively correlated with GA but not HbA1c in diabetic patients, suggesting that short-term blood glycemic levels are associated with OPN expression.
In the progress of atherosclerosis, OPN have been shown to be highly expressed in macrophages, VSMCs and ECs in human atherosclerotic plaque (Ikeda et al. 1993, O’Brien et al. 1994, Takemoto et al. 2000). It has been reported that high glucose increases the expression of OPN in human ECs and VSMCs (O’Brien et al. 1994, Takemoto et al. 2000). Our study further demonstrated that high glucose also elicited a dose-dependent increase in OPN mRNA and protein levels in RAW 264.7 cells. But to our knowledge, it have not been reported that which cell types play a critical role on upregulation of circulating OPN levels under diabetic conditions. So high glucose would upregulate the OPN expression in macrophages, VSMCs and ECs to play an important role together in the development of atherosclerosis, such as inhibiting the migration and proliferation of ECs, infiltration of macrophages at the site of lipid deposition as well as the activation of VSMCs.
FoxO1, a proinflammatory transcription factor, is closely related to insulin resistance in type 2 diabetes mellitus (Dominy & Puigserver 2010, Kitamura 2013). Hyperglycemia increases the activity of FoxO1 by inhibiting the phosphorylation of FoxO1, promoting the accumulation of nucleus and enhancing its DNA-binding capacity in ECs (Marchetti et al. 2006, Behl et al. 2009). Moreover, FoxO1 is involved in the development and progression of atherosclerosis by affecting endothelial cell function, LDL oxidation, oxidative stress and macrophage accumulation (Tanaka et al. 2009). So FoxO1 was thought to link hyperglycemia with the early pathophysiologic manifestation of atherosclerosis in diabetes. Though it has been reported that loss of three FoxO proteins in myeloid cells accelerates atherosclerosis in Ldlr−/−:MYFKO mice (Tsuchiya et al. 2013), the function of FoxO1 in diabetic condition and its relationship to atherosclerosis need to be elucidated.
There are several FoxO1-binding sites found in both human and mouse OPN promoter region, suggesting that FoxO1 proteins could be involved in the expression regulation of OPN. Through overexpression or knockdown expression of FoxO1 in macrophages, we demonstrate for the first time that FoxO1 participates in the activation of OPN transcription in macrophages. Meanwhile, high glucose promotes the activity of FoxO1 by dephosphorylation of FoxO1 at Thr24 and Ser256.
To identify the mechanisms by which FoxO1 regulates OPN, we cloned and analyzed the sequences of mouse OPN promoter and found that there are two consensus sequences for FoxO1 binding in nt −1918~−713 region of the OPN promoter, which was coincidental with the results of luciferase reporter gene. Furthermore, high glucose enhanced the activities of luciferase, while silencing of FoxO1 expression decreased the activities. EMSA and ChIP assays confirmed the binding of FoxO1 on the OPN promoter.
Finally, we found larger atherosclerotic lesions in the aorta of diabetic apolipoprotein E deficient mice (diabetic ApoE−/− mice), compared to apolipoprotein E-deficient mice (nondiabetic ApoE−/− mice). However, the OPN levels of diabetic ApoE−/− mice are slightly more than those of normal glycemic ApoE−/− mice without statistical significance. Compared to nondiabetic C57BL/6J mice, the OPN levels of ApoE−/− mice have been elevated to higher levels, consistent with others’ reports (Di Marco et al. 2016), which would explain the slight increases in diabetic ApoE−/− mice.
In conclusion, our findings highlight OPN as a target of FoxO1 in macrophages. High glucose activates the FoxO1 pathway to promote the expression of OPN, which is involved in the development and progression of diabetic macrovascular diseases. It provides a new clue to the pathogenesis and risk evaluation of diabetic vascular complications.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of this research reported.
Funding
This work was supported by National Natural Science Foundation of China (grant number 81270890).
References
Abe K, Nakashima H, Ishida M, Miho N, Sawano M, Soe NN, Kurabayashi M, Chayama K, Yoshizumi M & Ishida T 2008 Angiotensin II-induced osteopontin expression in vascular smooth muscle cells involves Gq/11, Ras, ERK, Src and Ets-1. Hypertension Research 31 . (https://doi.org/10.1291/hypres.31.987)
Beckman JA, Creager MA & Libby P 2002 Diabetes and atherosclerosis: epidemiology, pathophysiology, and management. JAMA 287 . (https://doi.org/10.1001/jama.287.19.2570)
Behl Y, Krothapalli P, Desta T, Roy S & Graves DT 2009 FOXO1 plays an important role in enhanced microvascular cell apoptosis and microvascular cell loss in type 1 and type 2 diabetic rats. Diabetes 58 . (https://doi.org/10.2337/db08-0537)
Biggs WH 3rd, Cavenee WK & Arden KC 2001 Identification and characterization of members of the FKHR (FOX O) subclass of winged-helix transcription factors in the mouse. Mammalian Genome 12 . (https://doi.org/10.1007/s003350020002)
Bjerre M, Pedersen SH, Møgelvang R, Lindberg S, Jensen JS, Galatius S & Flyvbjerg A 2013 High osteopontin levels predict long-term outcome after STEMI and primary percutaneous coronary intervention. European Journal of Preventive Cardiology 20 . (https://doi.org/10.1177/2047487313487083)
Bruemmer D, Collins AR, Noh G, Wang W, Territo M, Ariasmagallona S, Fishbein MC, Blaschke F, Kintscher U, Graf K, et al.2003 Angiotensin II-accelerated atherosclerosis and aneurysm formation is attenuated in osteopontin-deficient mice. Journal of Clinical Investigation 112 . (https://doi.org/10.1172/JCI18141)
Cho HJ, Cho HJ & Kim HS 2009 Osteopontin: a multifunctional protein at the crossroads of inflammation, atherosclerosis, and vascular calcification. Current Atherosclerosis Reports 11 . (https://doi.org/10.1007/s11883-009-0032-8)
Di Marco E, Gray SP, Kennedy K, Szyndralewiez C, Lyle AN, Lassegue B, Griendling KK, Cooper ME, Schmidt HHHW & Jandeleit-Dahm KAM 2016 NOX4-derived reactive oxygen species limit fibrosis and inhibit proliferation of vascular smooth muscle cells in diabetic atherosclerosis. Free Radical Biology and Medicine 97 . (https://doi.org/10.1016/j.freeradbiomed.2016.07.013)
Dominy JE & Puigserver P 2010 Nuclear FoxO1 inflames insulin resistance. EMBO Journal 29 . (https://doi.org/10.1038/emboj.2010.305)
Gomez-Ambrosi J, Catalan V, Ramirez B, Rodriguez A, Colina I, Silva C, Rotellar F, Mugueta C, Gil MJ, Cienfuegos JA, et al.2007 Plasma osteopontin levels and expression in adipose tissue are increased in obesity. Journal of Clinical Endocrinology and Metabolism 92 . (https://doi.org/10.1210/jc.2007-0349)
Gross DN, Wan M & Birnbaum MJ 2009 The role of FOXO in the regulation of metabolism. Current Diabetes Reports 9 . (https://doi.org/10.1007/s11892-009-0034-5)
Hemdahl AL, Gabrielsen A, Zhu C, Eriksson P, Hedin U, Kastrup J, Thoren P & Hansson GK 2006 Expression of neutrophil gelatinase-associated lipocalin in atherosclerosis and myocardial infarction. Arteriosclerosis, Thrombosis, and Vascular Biology 26 . (https://doi.org/10.1161/01.ATV.0000193567.88685.f4)
Higashi Y, Sukhanov S, Shai SY, Danchuk S, Tang R, Snarski P, Li Z, Lobelle-Rich P, Wang M, Wang D, et al.2016 Insulin-like growth factor-1 receptor deficiency in macrophages accelerates atherosclerosis and induces an unstable plaque phenotype in apolipoprotein E-deficient mice. Circulation 133 . (https://doi.org/10.1161/CIRCULATIONAHA.116.021805)
Ikeda T, Shirasawa T, Esaki Y, Yoshiki S & Hirokawa K 1993 Osteopontin mRNA is expressed by smooth muscle-derived foam cells in human atherosclerotic lesions of the aorta. Journal of Clinical Investigation 92 . (https://doi.org/10.1172/JCI116901)
Inman CK & Shore P 2003 The osteoblast transcription factor Runx2 is expressed in mammary epithelial cells and mediates osteopontin expression. Journal of Biological Chemistry 278 . (https://doi.org/10.1074/jbc.M308001200)
Kawamura H, Yokote K, Asaumi S, Kobayashi K, Fujimoto M, Maezawa Y, Saito Y & Mori S 2004 High glucose-induced upregulation of osteopontin is mediated Via Rho/Rho kinase pathway in cultured rat aortic smooth muscle cells. Arteriosclerosis, Thrombosis, and Vascular Biology 24 . (https://doi.org/10.1161/01.ATV.0000112012.33770.2a)
Kitada M, Zhang Z, Mima A & King GL 2010 Molecular mechanisms of diabetic vascular complications. Journal of Diabetes Investigation 1 . (https://doi.org/10.1111/j.2040-1124.2010.00018.x)
Kitamura T 2013 The role of FOXO1 in beta-cell failure and type 2 diabetes mellitus. Nature Reviews: Endocrinology 9 . (https://doi.org/10.1038/nrendo.2013.157)
Marchetti V, Menghini R, Rizza S, Vivanti A, Feccia T, Lauro D, Fukamizu A, Lauro R & Federici M 2006 Benfotiamine counteracts glucose toxicity effects on endothelial progenitor cell differentiation via Akt/FoxO signaling. Diabetes 55 . (https://doi.org/10.2337/db06-0369)
Matsui Y, Rittling SR, Okamoto H, Inobe M, Jia N, Shimizu T, Akino M, Sugawara T, Morimoto J, Kimura C, et al.2003 Osteopontin deficiency attenuates atherosclerosis in female apolipoprotein E-deficient mice. Arteriosclerosis, Thrombosis, and Vascular Biology 23 . (https://doi.org/10.1161/01.ATV.0000074878.29805.D0)
Momiyama Y, Ohmori R, Fayad ZA, Kihara T, Tanaka N, Kato R, Taniguchi H, Nagata M, Nakamura H & Ohsuzu F 2010 Associations between plasma osteopontin levels and the severities of coronary and aortic atherosclerosis. Atherosclerosis 210 . (https://doi.org/10.1016/j.atherosclerosis.2009.12.024)
Nakae J, Kitamura T, Silver DL & Accili D 2001 The forkhead transcription factor FoxO1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. Journal of Clinical Investigation 108 . (https://doi.org/10.1172/JCI12876)
Nakamachi T, Nomiyama T, Gizard F, Heywood EB, Jones KL, Zhao Y, Fuentes L, Takebayashi K, Aso Y, Staels B, et al.2007 PPARalpha agonists suppress osteopontin expression in macrophages and decrease plasma levels in patients with type 2 diabetes. Diabetes 56 . (https://doi.org/10.2337/db06-1177)
Nilsson-Berglund LM, Zetterqvist AV, Nilsson-Ohman J, Sigvardsson M, Gonzalez Bosc LV, Smith ML, Salehi A, Agardh E, Fredrikson GN, Agardh CD, et al.2010 Nuclear factor of activated T cells regulates osteopontin expression in arterial smooth muscle in response to diabetes-induced hyperglycemia. Arteriosclerosis, Thrombosis, and Vascular Biology 30 . (https://doi.org/10.1161/ATVBAHA.109.199299)
O’Brien ER, Garvin MR, Stewart DK, Hinohara T, Simpson JB, Schwartz SM & Giachelli CM 1994 Osteopontin is synthesized by macrophage, smooth muscle, and endothelial cells in primary and restenotic human coronary atherosclerotic plaques. Arteriosclerosis and Thrombosis 14 . (https://doi.org/10.1161/01.ATV.14.10.1648)
Okyay K, Tavil Y, Sahinarslan A, Tacoy G, Turfan M, Sen N, Gurbahar O, Boyaci B, Yalcin R, Demirkan D, et al.2011 Plasma osteopontin levels in prediction of prognosis in acute myocardial infarction. Acta Cardiologica 66 . (https://doi.org/10.2143/AC.66.2.2071251)
Olofsson PS, Soderstrom LA, Wagsater D, Sheikine Y, Ocaya P, Lang F, Rabu C, Chen L, Rudling M, Aukrust P, et al.2008 CD137 is expressed in human atherosclerosis and promotes development of plaque inflammation in hypercholesterolemic mice. Circulation 117 . (https://doi.org/10.1161/CIRCULATIONAHA.107.699173)
Poggio P, Grau JB, Field BC, Sainger R, Seefried WF, Rizzolio F & Ferrari G 2011 Osteopontin controls endothelial cell migration in vitro and in excised human valvular tissue from patients with calcific aortic stenosis and controls. Journal of Cellular Physiology 226 . (https://doi.org/10.1002/jcp.22549)
Renault MA, Jalvy S, Belloc I, Pasquet S, Sena S, Olive M, Desgranges C & Gadeau AP 2003 AP-1 is involved in UTP-induced osteopontin expression in arterial smooth muscle cells. Circulation Research 93 . (https://doi.org/10.1161/01.RES.0000094747.05021.62)
Rosenberg M, Zugck C, Nelles M, Juenger C, Frank D, Remppis A, Giannitsis E, Katus HA & Frey N 2008 Osteopontin, a new prognostic biomarker in patients with chronic heart failure. Circulation: Heart Failure 1 . (https://doi.org/10.1161/CIRCHEARTFAILURE.107.746172)
Silvola JM, Virtanen H, Siitonen R, Hellberg S, Liljenback H, Metsala O, Stahle M, Saanijoki T, Kakela M, Hakovirta H, et al.2016 Leukocyte trafficking-associated vascular adhesion protein 1 is expressed and functionally active in atherosclerotic plaques. Scientific Reports 6 35089. (https://doi.org/10.1038/srep35089)
Son SM 2012 Reactive oxygen and nitrogen species in pathogenesis of vascular complications of diabetes. Diabetes and Metabolism Journal 36 . (https://doi.org/10.4093/dmj.2012.36.3.190)
Takemoto M, Yokote K, Yamazaki M, Ridall AL, Butler WT, Matsumoto T, Tamura K, Saito Y & Mori S 1999 Enhanced expression of osteopontin by high glucose in cultured rat aortic smooth muscle cells. Biochemical and Biophysical Research Communications 258 . (https://doi.org/10.1006/bbrc.1999.0701)
Takemoto M, Yokote K, Nishimura M, Shigematsu T, Hasegawa T, Kon S, Uede T, Matsumoto T, Saito Y & Mori S 2000 Enhanced expression of osteopontin in human diabetic artery and analysis of its functional role in accelerated atherogenesis. Arteriosclerosis, Thrombosis, and Vascular Biology 20 . (https://doi.org/10.1161/01.ATV.20.3.624)
Tanaka J, Qiang L, Banks AS, Welch CL, Matsumoto M, Kitamura T, Ido-Kitamura Y, DePinho RA & Accili D 2009 FoxO1 links hyperglycemia to LDL oxidation and endothelial nitric oxide synthase dysfunction in vascular endothelial cells. Diabetes 58 . (https://doi.org/10.2337/db09-0167)
Tsuchiya K, Westerterp M, Murphy AJ, Subramanian V, Ferrante AW Jr, Tall AR & Accili D 2013 Expanded granulocyte/monocyte compartment in myeloid-specific triple FoxO knockout increases oxidative stress and accelerates atherosclerosis in mice. Circulation Research 112 . (https://doi.org/10.1161/CIRCRESAHA.112.300749)
Wai PY, Mi Z, Gao C, Guo H, Marroquin C & Kuo PC 2006 Ets-1 and runx2 regulate transcription of a metastatic gene, osteopontin, in murine colorectal cancer cells. Journal of Biological Chemistry 281 . (https://doi.org/10.1074/jbc.M511962200)
Wei D, Tao R, Zhang Y, White MF & Dong XC 2011 Feedback regulation of hepatic gluconeogenesis through modulation of SHP/Nr0b2 gene expression by Sirt1 and FoxO1. American Journal of Physiology: Endocrinology and Metabolism 300 E312–E320. (https://doi.org/10.1152/ajpendo.00524.2010)
Wolak T 2014 Osteopontin – a multi-modal marker and mediator in atherosclerotic vascular disease. Atherosclerosis 236 . (https://doi.org/10.1016/j.atherosclerosis.2014.07.004)
Yamaguchi H, Igarashi M, Hirata A, Tsuchiya H, Sugiyama K, Morita Y, Jimbu Y, Ohnuma H, Daimon M, Tominaga M, et al.2004 Progression of diabetic nephropathy enhances the plasma osteopontin level in type 2 diabetic patients. Endocrine Journal 51 . (https://doi.org/10.1507/endocrj.51.499)
Zeadin MG, Petlura CI & Werstuck GH 2013 Molecular mechanisms linking diabetes to the accelerated development of atherosclerosis. Canadian Journal of Diabetes 37 . (https://doi.org/10.1016/j.jcjd.2013.06.001)
Zhang X, Yalcin S, Lee DF, Yeh TY, Lee SM, Su J, Mungamuri SK, Rimmele P, Kennedy M, Sellers R, et al.2011 FOXO1 is an essential regulator of pluripotency in human embryonic stem cells. Nature Cell Biology 13 . (https://doi.org/10.1038/ncb2293)
Zheng JY, Zou JJ, Wang WZ, Feng XY, Shi YY, Zhao Y, Jin G & Liu ZM 2011 Tumor necrosis factor-α increases angiopoietin-like protein 2 gene expression by activating FoxO1 in 3T3-L1 adipocytes. Molecular and Cellular Endocrinology 339 . (https://doi.org/10.1016/j.mce.2011.04.002)
