Abstract
Serum prolactin levels gradually increase from birth to puberty in both male and female rats, with higher levels observed in female since the first days of life. The increase in lactotroph secretion was attributed to the maturation of prolactin-inhibiting and prolactin-releasing factors; however, those mechanisms could not fully explain the gender differences observed. Prolactin secretion from isolated lactotrophs, in the absence of hypothalamic control, also increases during the first weeks of life, suggesting the involvement of intra-pituitary factors. We postulate that pituitary transforming growth factor beta 1 (TGFβ1) is involved in the regulation of prolactin secretion as well as in the gender differences observed at early postnatal age. Several components of the local TGFβ1 system were evaluated during postnatal development (11, 23, and 45 days) in female and male Sprague–Dawley rats. In vivo assays were performed to study local TGFβ1 activation and its impact on prolactin secretion. At day 11, female pituitaries present high levels of active TGFβ1, concomitant with the highest expression of TGFβ1 target genes and the phospho-Smad3 immunostaining in lactotrophs. The steady increase in prolactin secretion inversely correlates with active TGFβ1 levels only in females. Dopamine and estradiol induce TGFβ1 activation at day 11, in both genders, but its activation induces the inhibition of prolactin secretion only in females. Our findings demonstrate that: (1) TGFβ1 activation is regulated by dopamine and estradiol; (2) the inhibitory regulation of local TGFβ1 on prolactin secretion is gender specific; and (3) this mechanism is responsible, at least partially, for the gender differences observed being relevant during postnatal development.
Introduction
Serum prolactin levels are low during the first 2 weeks of life, in both female and male rats, and then gradually increases until puberty. The progressive maturation of the neuroendocrine network involving both prolactin-inhibiting and prolactin-releasing factors induces important changes in prolactin synthesis, storage, and release during development (Chen 1987, Becú-Villalobos et al. 1992). Gender differences were described in all these processes, which results in female rats presenting higher levels of serum prolactin compared to males since the first days of life.
It is well known that dopamine is the primary hypothalamic inhibitor of prolactin synthesis and secretion (for review see Ben-Jonathan & Hnasko 2001). Nevertheless, other hypothalamic factors have been reported to contribute to prolactin inhibition such as gamma-aminobutyric acid (GABA), somatostatin, and opiates, among others (Leong et al. 1983, Grattan 2015). On the other hand, although lactotrophs synthesize and secrete prolactin constitutively, several hypothalamic factors contribute to prolactin release, including serotonin, thyrotropin-releasing hormone (TRH), oxytocin, and VIP. Nonetheless, the primary stimulus of prolactin synthesis and release is exerted by estradiol (Kansra et al. 2005).
It was first suggested that the gradual increase observed in prolactin secretion during the first weeks of life was mainly due to a gradual decrease in the hypothalamic inhibitory activity. However, later on, it was demonstrated that the inhibitory effect exerted by hypothalamic factors increases significantly during the first postnatal weeks (Karanth et al. 1987). In fact, the dopaminergic input toward the pituitary, as well as the lactotroph responsiveness to dopamine, increase from birth to puberty (Nazian 1983).
Then, the maturation of this inhibitory mechanism could not explain the prolactin rise observed during the first weeks of life. So, later, the postnatal prolactin rise was associated with an increase in the efficiency of prolactin-releasing factors such as estrogen, serotonin, and opiates, among others. Additionally, in vitro studies performed in isolated lactotrophs revealed that the basal release of prolactin also increased with age (Karanth et al. 1987). By using a reverse hemolytic plaque assay in dispersed pituitary cells to detect prolactin secretion from individual lactotrophs, Chen et al. observed that only a half of the total lactotrophs (prolactin positive cells by ICC) are plaque-forming cells (secreting lactotrophs) during the first week of postnatal life (Chen 1987).
These results were obtained using isolated lactotrophs, in the absence of hypothalamic factors, suggesting the presence of an intra-pituitary inhibitory mechanism exercised on prolactin secretion, which decreases with age, allowing a gradual increase in the percentage of secreting lactotrophs.
There are several intra-pituitary peptides and growth factors involved in the paracrine and/or autocrine control of prolactin secretion. Among them, the transforming growth factor beta 1 (TGFβ1) has been proposed as a strong inhibitor of lactotroph function and as a mediator of the local inhibitory action induced by dopamine (Minami & Sarkar 1997, Sarkar et al. 1998). All the components of the TGFβ1 system are expressed in the pituitary gland (Sarkar et al. 1992, 1998, Recouvreux et al. 2013).
While TGFβ1 action on prolactin secretion and lactotroph proliferation has been well studied in different pituitary cell lines and adult animals, the postnatal development of this inhibitory system, as well as its involvement in the control of lactotroph function, remain unknown. We hypothesize that the intra-pituitary TGFβ1 contributes to the inhibitory control of lactotroph function in early postnatal days. Even more, we postulate that this mechanism is involved in the gender differences observed in prolactin secretion during the first weeks of life.
The present work aimed to study the postnatal development of the pituitary TGFβ1 system in association with lactotroph function, in male and female Sprague–Dawley rats at 11, 23, and 45 postnatal days.
Materials and methods
Animals
All studies were performed in Sprague–Dawley (SD) rats of both genders. Animals were housed in a temperature-controlled room with 12 h light:12 h darkness cycle, lights on 07:00–19:00 h, and were provided with laboratory chow and tap water ad libitum. All animal procedures were approved by the Institutional Animal Care and Use Committee of the Instituto de Biología y Medicina Experimental, Consejo Nacional de Investigaciones Científicas y Técnicas (IByME-CONICET), in accordance with National Institutes of Health guidelines for animal research (8th edition 2010) and with the European Communities Council Directive of November 2010 (2010/63/UE).
Animals were killed by decapitation at 11, 23, and 45 days of age. Forty-five-day-old female rats were used in diestrus. Anterior pituitaries of different experimental groups were stored in TRIzol® reagent (Invitrogen) for posterior RNA isolation or ice-cold buffer (100 mM Tris, 10 mM CaCl2, 1 mM MgCl2, 1% Triton X-100 pH 7.4) containing a mix of proteases inhibitors (phenylmethylsulfonylfluoride, tosyl-phenylalanine-chloromethyl-ketone, tert-Amyl-methyl-ether, N-carbobenzoxy-L-phenylalanine chloromethyl-ketone, and tosylamide-lysyl-chloromethyl-ketone) for posterior ELISA assays. Trunk blood was collected to measure serum prolactin levels by RIA.
In vivo experiments
TGFβ1 regulation by estradiol
Male and female 11-day-old SD rats were injected with a single dose of estradiol valerate (0.2 mg/kg sc, Progynon Depot; Bayer Schering) or castor oil (control group). n = 5 per group and per gender. Animals were killed by decapitation after 3 h. Anterior pituitaries were collected in ice-cold buffer with proteases inhibitors for TGFβ1 ELISA assay. Trunk blood was collected for serum PRL determination.
TGFβ1 regulation by dopamine
Male and female 11-day-old rats (n = 5 per treatment-group and per gender) were injected with a single dose of sulpiride (5 mg/kg ip, Vipral, Ivax Laboratories, Argentina), cabergoline (2 mg/kg ip, Beta Laboratories, Buenos Aires, Argentina), or saline (control group). Animals were killed by decapitation after 30 min. Anterior pituitaries were collected in ice-cold buffer with proteases inhibitors for TGFβ1 ELISA assay. Trunk blood was collected for serum PRL determination.
RIA
Serum prolactin levels were determined by RIA using a rat-specific primary antibody and the reagents provided by the National Institute of Diabetes and Digestive and Kidney Diseases, National Hormone and Pituitary Program (Dr A F Parlow, NHPP, Torrance, CA, USA). Results are expressed in nanograms per millilitre. The inter- and intra-assay coefficients of variation were 6.9% and 11.6%, respectively.
Detection of total and active TGFβ1
To quantify active or total TGFβ1 content in pituitary homogenates, an ELISA assay was performed (TGFβ1 DuoSet ELISA Kit, DY1679, R&D Systems), following the manufacturer’s instructions. To assay active TGFβ1, proteins from anterior pituitary glands of different experimental groups were isolated and equal amounts of protein were loaded per well. Pituitaries from 11-day-old rats were grouped (two pituitaries = one sample) to obtain enough amount of protein. To assay total TGFβ1, samples were acidified up to pH 2.6 by adding 1 N HCl (20 min at room temperature), followed by neutralization with NaOH to pH 7.6 before being loaded. TGFβ1 content is expressed as picograms per milligram of protein. Samples used in these assays were n = 7, 8, and 8 for 11, 23, and 45 days, respectively, for studying differences among gender and age (Fig. 2); n = 5 per group for in vivo assay (Fig. 8).
RNA isolation and reverse transcription PCR
After the animals were killed, anterior pituitaries were collected in TRIzol® Reagent (Invitrogen) and total RNA was isolated from the tissue following the manufacturer’s protocol. Total RNA was quantified using a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific) and RNA purity was determined by 260:280 nm absorbance ratio. Ratios above 1.8 were considered acceptable.
RT was performed using 1 µg of total RNA, Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT, Promega) and random primers (Biodynamics, SRL, Buenos Aires, Argentina). The resulting cDNA samples were used to perform quantitative real-time PCR.
Quantitative real-time PCR
RT-qPCRs were performed using specific-designed primers and the Fast Start Universal SYBR Green Master Rox (Roche) or the EVA green qPCR mix (Solis BioDyne, Tartu, Estonia) on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). All samples were assayed in duplicate and specificity of amplification was determined by melt curve analysis. Relative fold-change in target gene expression was quantified by the 2−ΔΔCT method. Two reference genes were evaluated: Cyclophilin B and the 60S ribosomal protein L38 (Rpl38) to normalize the differences of starting template among samples. Calibration curves were used to establish the efficiency of each pair of primers. Comparing the slope of the regression lines among references genes and other genes of interest, Cyclophilin B was selected as the most proper housekeeping gene. All primers used showed similar efficiencies (95–100%). Primer sequences used for RT-qPCR are shown in Table 1.
Primers sequences for RT-qPCR.
| Gene | Accession number | Forward primer sequence 5′→3′ | Reverse primer sequence 5′→3′ |
|---|---|---|---|
| Prl | NM_012629 | CATCAATGACTGCCCCACTTC | GAGTGCACCAAACTGAGGATCA |
| Tgfβ1 | NM_021578 | CAACAATTCCTGGCGTTACC | AGCCCTGTATTCCGTCTCCT |
| Tβr2 | NM_031132 | CCGTGTGGAGGAAGAACGAC | CAGAGTGAAGCCGTGGTAGG |
| Alk5 | NM_012775 | TCCAAACCACAGAGTAGGCAC | TGGATTCCGCCAATGGAACA |
| Tsp1 | NM_001013062 | GTGCGCACCCTGTGGCATGA | ACCGGTCTTTGGCCTGTGGC |
| Klf14 | NM_001135094 | AGGCAGATTACACCCGCATC | TACGCTGGTGTGACTTGAGG |
| Tmpai1 | NM_001107807 | GAGAGACGACGGAGGACTGT | GGGCATAGACCTGTGGCTCC |
| Ltbp1 | NM_021587 | AGCACCGTCACCTCTGCTCT | ATCCTCGCAGTGGTCTCCAA |
| Ltbp3 | NM_001191561 | ATGGCCTCAGTTGCATAGAC | AAGGAGCCTGGTGTGTTCGT |
| CyclophilinB | NM_022536 | GACCCTCCGTGGCCAACGAT | GTCACTCGTCCTACAGGTTCGTCTC |
Double indirect immunostaining by confocal laser scanning microscopy
Pituitaries from 11- and 45-day-old male and female rats were removed immediately after killing, placed in Crioplast (Biopack, Buenos Aires, Argentina), and frozen in liquid nitrogen. Tissues were sectioned using a cryostat and slices were fixed in methanol as was previously described by Perez et al. (2018). The slices were blocked for 1 h in PBS-5% BSA and incubated overnight with primary antibodies (anti-TβRII, sc-17792, Santa Cruz Biotechnology, dilution 1:50; or anti-phospho-SMAD3, C25A9, Cell Signalling, dilution 1:150) in PBS-1% BSA. Then, sections were incubated with anti-PRL (NIDDK-rPRL-IC-5; Dr A F Parlow, National Hormone and Pituitary Program, Torrance, CA, USA; dilution 1:1000) for 1 h and further incubated with Alexa 488 and Alexa 594 secondary antibodies (1:1000; Invitrogen) for 1 h. Finally, sections were incubated with DAPI (Sigma-Aldrich) and mounted with Fluoromount (Sigma-Aldrich). Negative control slides were incubated with PBS-1% BSA without the primary antibody to validate the specificity of the immunostaining. Images were obtained using a Zeiss LSM 800 inverted confocal laser scanning microscope (Carl Zeiss) and analyzed with the software FV10-ASW 1.6 Viewer. This assay was performed using three animals (pituitaries) per age, per gender, and per first antibody to be studied. Total n = 12. Representative images are shown.
Statistical analysis
Results are expressed as mean ± s.e.m. Comparisons among gender and age were evaluated by two-way ANOVA, followed by Tukey test. Comparisons between gender or age were evaluated by Student’s t-test or one-way ANOVA followed by Tukey test. Data were transformed when required. P < 0.05 was considered significant.
Results
Serum prolactin levels were measured at different postnatal days: day 11, day 23, and day 45 in male and female rats (n = 24, 8, and 20, respectively, for each gender). According to previous results (Becú-Villalobos et al. 1992, Díaz-Torga et al. 1994), prolactin levels are low at day 11 and gradually increase until 45-days-old in both female and male rats. As previously described, prolactin levels remain lower in males during postnatal development (Fig. 1A). Not only serum levels but also PRL synthesis (mRNA, assayed by RT-qPCR) steeply increases with age, always maintaining higher values in females (Fig. 1B, see scale).
(A) Serum prolactin levels during postnatal development. Serum prolactin levels were measured by RIA. Data were analyzed by two-way ANOVA (age P < 0.0001, gender P < 0.05) followed by Tukey test. *P < 0.05. **P < 0.01 and ****P < 0.0001 vs 45-day-old females. (B) mRNA levels of PRL. Pituitary expression of prolactin was measured by RT-qPCR. Data were analyzed by two-way ANOVA (age and gender, interaction P < 0.0001) followed by Tukey test. **P < 0.01 and ****P < 0.0001 vs 45-day-old animals (within the same gender). n = 5–9 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
(A) Serum prolactin levels during postnatal development. Serum prolactin levels were measured by RIA. Data were analyzed by two-way ANOVA (age P < 0.0001, gender P < 0.05) followed by Tukey test. *P < 0.05. **P < 0.01 and ****P < 0.0001 vs 45-day-old females. (B) mRNA levels of PRL. Pituitary expression of prolactin was measured by RT-qPCR. Data were analyzed by two-way ANOVA (age and gender, interaction P < 0.0001) followed by Tukey test. **P < 0.01 and ****P < 0.0001 vs 45-day-old animals (within the same gender). n = 5–9 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
(A) Serum prolactin levels during postnatal development. Serum prolactin levels were measured by RIA. Data were analyzed by two-way ANOVA (age P < 0.0001, gender P < 0.05) followed by Tukey test. *P < 0.05. **P < 0.01 and ****P < 0.0001 vs 45-day-old females. (B) mRNA levels of PRL. Pituitary expression of prolactin was measured by RT-qPCR. Data were analyzed by two-way ANOVA (age and gender, interaction P < 0.0001) followed by Tukey test. **P < 0.01 and ****P < 0.0001 vs 45-day-old animals (within the same gender). n = 5–9 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Active and total pituitary TGFβ1
Pituitary content of active TGFβ1 and total TGFβ1 (active + latent TGFβ1) was measured by a specific ELISA. Total TGFβ1 protein expression was found significantly increased at day 11 and decreased thereafter (Fig. 2A) without gender differences. However, when active TGFβ1 levels were assayed, the profile observed was gender-specific (Fig. 2B). Higher active cytokine levels are found in females at day 11 and they decrease afterwards. In contrast, male pituitaries express higher active TGFβ1 levels at day 45. Then, the bioactive cytokine in the pituitary is significantly higher in females than in males at day 11, but this profile is reversed at day 45 (Fig. 2B).
(A) Pituitary content of total TGFβ1. The cytokine levels were assayed by ELISA. Data were analyzed by two-way ANOVA (age P < 0.0001) followed by Tukey test. ****P < 0.0001 vs 45-day-old females. n = 7–8 per group. (B) Pituitary content of active TGFβ1. The cytokine levels were assayed by ELISA. Data were analyzed by two-way ANOVA (interaction P < 0.05) followed by Tukey test. *P < 0.0001 vs 45-day-old females. Gender differences at days 11 and 45 were analyzed by Student’s t-test. P < 0.05. n = 7–8 per group. (C) Pituitary expression of Klf-14. mRNA levels were assayed by RT-qPCR. Data were analyzed by two-way ANOVA (interaction and age P < 0.01), followed by Tukey test. ***P < 0.001 vs 45-day-old females. Gender differences at days 11 and 45 were analyzed by Student’s t-test. P < 0.05. n = 5–9 per group. (D) Pituitary expression of Tmpai-1. mRNA levels were assayed by RT-qPCR. Data were analyzed by two-way ANOVA (interaction and age P < 0.01), followed by Tukey test. *P < 0.05 and ***P < 0.001 vs 45-day-old females. n = 5–9 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
(A) Pituitary content of total TGFβ1. The cytokine levels were assayed by ELISA. Data were analyzed by two-way ANOVA (age P < 0.0001) followed by Tukey test. ****P < 0.0001 vs 45-day-old females. n = 7–8 per group. (B) Pituitary content of active TGFβ1. The cytokine levels were assayed by ELISA. Data were analyzed by two-way ANOVA (interaction P < 0.05) followed by Tukey test. *P < 0.0001 vs 45-day-old females. Gender differences at days 11 and 45 were analyzed by Student’s t-test. P < 0.05. n = 7–8 per group. (C) Pituitary expression of Klf-14. mRNA levels were assayed by RT-qPCR. Data were analyzed by two-way ANOVA (interaction and age P < 0.01), followed by Tukey test. ***P < 0.001 vs 45-day-old females. Gender differences at days 11 and 45 were analyzed by Student’s t-test. P < 0.05. n = 5–9 per group. (D) Pituitary expression of Tmpai-1. mRNA levels were assayed by RT-qPCR. Data were analyzed by two-way ANOVA (interaction and age P < 0.01), followed by Tukey test. *P < 0.05 and ***P < 0.001 vs 45-day-old females. n = 5–9 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
(A) Pituitary content of total TGFβ1. The cytokine levels were assayed by ELISA. Data were analyzed by two-way ANOVA (age P < 0.0001) followed by Tukey test. ****P < 0.0001 vs 45-day-old females. n = 7–8 per group. (B) Pituitary content of active TGFβ1. The cytokine levels were assayed by ELISA. Data were analyzed by two-way ANOVA (interaction P < 0.05) followed by Tukey test. *P < 0.0001 vs 45-day-old females. Gender differences at days 11 and 45 were analyzed by Student’s t-test. P < 0.05. n = 7–8 per group. (C) Pituitary expression of Klf-14. mRNA levels were assayed by RT-qPCR. Data were analyzed by two-way ANOVA (interaction and age P < 0.01), followed by Tukey test. ***P < 0.001 vs 45-day-old females. Gender differences at days 11 and 45 were analyzed by Student’s t-test. P < 0.05. n = 5–9 per group. (D) Pituitary expression of Tmpai-1. mRNA levels were assayed by RT-qPCR. Data were analyzed by two-way ANOVA (interaction and age P < 0.01), followed by Tukey test. *P < 0.05 and ***P < 0.001 vs 45-day-old females. n = 5–9 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
To evaluate whether this gender-specific profile in active TGFβ1 levels was also observed in the biological activity of the cytokine, we measured the expression of two TGFβ1-target genes: the androgen-induced trans-membrane protein, Tmpai (Brunschwig et al. 2003, Levy & Hill 2005), and the Krüppel-like factor 14 (Klf14) (Truty et al. 2009). The expression pattern of both target genes correlates with pituitary levels of active TGFβ1. mRNA levels of Tmpai and Klf-14 were found significantly higher in 11-day-old female rats compared to males, and then this gender difference was inverted at 45 days old (Fig. 2C and D).
As observed in Fig. 3A and C, serum PRL levels inversely correlated with values obtained for pituitary active TGFβ1 only in females. In contrast, a direct correlation between these two variables was observed in males (Fig. 3B and D). On the other hand, no correlation between serum prolactin and total TGFβ1 was observed, neither in females nor in males (data not shown).
Serum prolactin levels and pituitary active TGFβ1 during postnatal development in females (A) and males (B). Prolactin levels were measured by RIA and TGFβ1 content was assayed by ELISA. (C) Inverse correlation between prolactin and TGFβ1 in females. Data were analyzed with a correlation test. P = 0.0395. n = 7, 6, and 7 samples for 11-, 23-, and 45-day-old rats, respectively. (D) Direct correlation between prolactin and TGFβ1 in males. Data were analyzed with a correlation test. P = 0.0165. n = 8 samples/age.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Serum prolactin levels and pituitary active TGFβ1 during postnatal development in females (A) and males (B). Prolactin levels were measured by RIA and TGFβ1 content was assayed by ELISA. (C) Inverse correlation between prolactin and TGFβ1 in females. Data were analyzed with a correlation test. P = 0.0395. n = 7, 6, and 7 samples for 11-, 23-, and 45-day-old rats, respectively. (D) Direct correlation between prolactin and TGFβ1 in males. Data were analyzed with a correlation test. P = 0.0165. n = 8 samples/age.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Serum prolactin levels and pituitary active TGFβ1 during postnatal development in females (A) and males (B). Prolactin levels were measured by RIA and TGFβ1 content was assayed by ELISA. (C) Inverse correlation between prolactin and TGFβ1 in females. Data were analyzed with a correlation test. P = 0.0395. n = 7, 6, and 7 samples for 11-, 23-, and 45-day-old rats, respectively. (D) Direct correlation between prolactin and TGFβ1 in males. Data were analyzed with a correlation test. P = 0.0165. n = 8 samples/age.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Pituitary expression of other components of the TGFβ1 system
Once synthesized, TGFβ1 is secreted to the extracellular matrix (ECM) coupled to a latent TGFβ binding protein (LTBP). LTBPs are important mediators of TGFβ1 secretion, storage in the ECM, and appropriate activation (Rifkin 2005). In the ECM, TGFβ1 remains inactive, as a reservoir, and must undergo a tightly regulated activation process by which TGFβ1 is released from its latent proteins. This activation process enables the cytokine to be biologically active (Annes et al. 2003, Yoshinaga et al. 2008).
We have previously described that the four LTBP isoforms (LTBP-1, -2, -3, and -4) are expressed in the pituitary gland of adult rats and mice (Recouvreux et al. 2013, 2016), LTBP-1 and LTBP-3 being the two isoforms with the highest expression. At the time, there is no data available on pituitary LTBPs expression at early postnatal days.
We found that pituitary expression of Ltbp-1 is higher at postnatal day 11 in both female and male rats and markedly decreases with age (Fig. 4A). On the contrary, pituitary Ltbp-3 expression remains relatively constant during postnatal life (Fig. 4B), being higher in females than in males at day 45.
(A) Pituitary expression of Ltbp-1. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (age P < 0.0001), followed by Tukey test. ****P < 0.0001 vs 45-day-old females. n = 5–7 per group. (B) Pituitary expression of Ltbp-3. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (age P < 0.0001 and gender P < 0.05), followed by Tukey test. *P < 0.05. n = 5–7 per group. (C) Pituitary expression of Tsp-1. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (interaction P < 0.01 and age P < 0.0001), 0.0001), followed by Tukey test. ****P < 0.0001 vs 45-day-old females. *P < 0.05. n = 5–7 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
(A) Pituitary expression of Ltbp-1. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (age P < 0.0001), followed by Tukey test. ****P < 0.0001 vs 45-day-old females. n = 5–7 per group. (B) Pituitary expression of Ltbp-3. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (age P < 0.0001 and gender P < 0.05), followed by Tukey test. *P < 0.05. n = 5–7 per group. (C) Pituitary expression of Tsp-1. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (interaction P < 0.01 and age P < 0.0001), 0.0001), followed by Tukey test. ****P < 0.0001 vs 45-day-old females. *P < 0.05. n = 5–7 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
(A) Pituitary expression of Ltbp-1. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (age P < 0.0001), followed by Tukey test. ****P < 0.0001 vs 45-day-old females. n = 5–7 per group. (B) Pituitary expression of Ltbp-3. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (age P < 0.0001 and gender P < 0.05), followed by Tukey test. *P < 0.05. n = 5–7 per group. (C) Pituitary expression of Tsp-1. mRNA levels were measured by RT-qPCR. Data were analyzed by two-way ANOVA (interaction P < 0.01 and age P < 0.0001), 0.0001), followed by Tukey test. ****P < 0.0001 vs 45-day-old females. *P < 0.05. n = 5–7 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Several proteases have been suggested as TGFβ1 activators, which are tissue specific. Among them, thrombospondin 1 (TSP-1), kallikrein 1, and matrix metalloproteinases (MMP9 and MMP2) are known activators in several tissues (Ribeiro et al. 1999, Paez-Pereda et al. 2005). TSP1 has been previously suggested as a local activator of pituitary TGFβ1 (Pastorcic et al. 1995, Recouvreux et al. 2012, Faraoni et al. 2017). We found high expression of pituitary Tsp1 mRNA in postnatal day 11 in both genders. Tsp1 levels significantly decreased with age in females (Fig. 4C). On the contrary, Tsp1 decreased at postnatal day 23 in males, keeping those values at day 45, being significantly higher than females at this age, as observed with active TGFβ1 (Figs 2B and 4C).
After activation, TGFβ1 binds to the receptor type 2 (TβRII), which recruits and activates a receptor type 1 (TβRI; ALK5), forming hetero-tetrameric complexes in the presence of the dimeric ligand (reviewed by Wrana 2013). Signalling is initiated by direct phosphorylation of Smad2 and Smad3 proteins which, after binding to Smad4, migrate to the nucleus to modulate the transcription of target genes (Shi & Massague 2003).
When the mRNA expression of TGFβ1 receptors was assayed by RT-qPCR, we found a high expression of TβRII in pituitaries from 11-day-old female and male rats that decreased with age. This decrease was more pronounced in males, and then a gender difference appears in postnatal days 23 and 45, where lower TβRII expression was observed in males compared to females (Fig. 5A).
Pituitary expression of TGFβ1 receptors measured by RT-qPCR. (A) TβRII. Data were analyzed by two-way ANOVA (interaction P < 0.05, age and gender P < 0.0001), followed by Tukey test. ***P < 0.001 vs 45-day-old females. P < 0.05. n = 5–7 per group. (B) Alk-5. Data were analyzed by two-way ANOVA (interaction P < 0.01 and age P < 0.001), followed by Tukey test. *P < 0.05 vs 45-day-old females. n = 5–7 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Pituitary expression of TGFβ1 receptors measured by RT-qPCR. (A) TβRII. Data were analyzed by two-way ANOVA (interaction P < 0.05, age and gender P < 0.0001), followed by Tukey test. ***P < 0.001 vs 45-day-old females. P < 0.05. n = 5–7 per group. (B) Alk-5. Data were analyzed by two-way ANOVA (interaction P < 0.01 and age P < 0.001), followed by Tukey test. *P < 0.05 vs 45-day-old females. n = 5–7 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Pituitary expression of TGFβ1 receptors measured by RT-qPCR. (A) TβRII. Data were analyzed by two-way ANOVA (interaction P < 0.05, age and gender P < 0.0001), followed by Tukey test. ***P < 0.001 vs 45-day-old females. P < 0.05. n = 5–7 per group. (B) Alk-5. Data were analyzed by two-way ANOVA (interaction P < 0.01 and age P < 0.001), followed by Tukey test. *P < 0.05 vs 45-day-old females. n = 5–7 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Pituitary Alk-5 expression did not undergo remarkable changes during postnatal development. However, it was found higher in 45-day-old female pituitaries compared to age-matched males (Fig. 5B).
TβRII and p-Smad3 expression by immunostaining using confocal laser scanning microscopy
Figure 6 shows TβRII expression in 11- and 45-day-old female and male pituitaries. Double staining with PRL (merge) indicates that lactotrophs express this receptor in all the groups analyzed.
TGFβ1 receptor type II (TβRII) expression in pituitaries from 11- and 45-day-old female and male rats. Identification of TβRII (red) and prolactin (green) by double indirect immunofluorescence. Arrows show lactotrophs expressing TβRII. (*) TβRII expression in non-lactotroph cells. Nuclei were immunostained with DAPI (blue). Scale bar = 20 μm.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
TGFβ1 receptor type II (TβRII) expression in pituitaries from 11- and 45-day-old female and male rats. Identification of TβRII (red) and prolactin (green) by double indirect immunofluorescence. Arrows show lactotrophs expressing TβRII. (*) TβRII expression in non-lactotroph cells. Nuclei were immunostained with DAPI (blue). Scale bar = 20 μm.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
TGFβ1 receptor type II (TβRII) expression in pituitaries from 11- and 45-day-old female and male rats. Identification of TβRII (red) and prolactin (green) by double indirect immunofluorescence. Arrows show lactotrophs expressing TβRII. (*) TβRII expression in non-lactotroph cells. Nuclei were immunostained with DAPI (blue). Scale bar = 20 μm.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
When TGFβ1 binds to TβRII, this receptor transactivates the TβRI, which phosphorylates Smad2 and Smad3 proteins. We next assayed phospho-Smad3 (p-Smad3) expression in 11- and 45-day-old male and female pituitaries. Double staining with PRL (merge) indicates that lactotrophs express p-Smad3. As Fig. 7 shows, a strong p-Smad3 expression is observed in 11-day-old females. This expression was higher than that found in 45-day-old females and males.
p-Smad3 expression in pituitaries from 11- and 45-day-old female and male rats. Identification of p-Smad3 (red) and prolactin (green) by double indirect immunofluorescence. Nuclei were immunostained with DAPI (blue). Scale bar = 20 μm.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
p-Smad3 expression in pituitaries from 11- and 45-day-old female and male rats. Identification of p-Smad3 (red) and prolactin (green) by double indirect immunofluorescence. Nuclei were immunostained with DAPI (blue). Scale bar = 20 μm.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
p-Smad3 expression in pituitaries from 11- and 45-day-old female and male rats. Identification of p-Smad3 (red) and prolactin (green) by double indirect immunofluorescence. Nuclei were immunostained with DAPI (blue). Scale bar = 20 μm.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Gender differences in active TGFβ1 regulation by dopamine and estradiol at early postnatal age
We have previously demonstrated that pituitary TGFβ1 activity is regulated by dopamine and estradiol. We demonstrated that dopamine and estradiol also regulate pituitary TGFβ1 activation (Recouvreux et al. 2011, 2013). Although this regulation is well studied in adult rats and mice, little is known about the involvement of dopamine and estradiol in the regulation of pituitary TGFβ1 system at early postnatal days.
The impact of dopamine and estradiol on pituitary TGFβ1 activation was studied in vivo in 11-day-old female and male rats. As Fig. 8 shows, both estradiol and cabergoline (Drd2 agonist) increased pituitary levels of TGFβ1 in 11-day-old rats (both genders). In females, the activation of the cytokine was concomitant with a decrease in serum prolactin levels. In contrast, the increased pituitary levels of active TGFβ1 had no impact on serum prolactin in males (Fig. 8A, B, E and F). On the other hand, although sulpiride (Drd2 antagonist) did not alter active TGFβ1 expression in the pituitary, it induced the expected increase in prolactin levels in both female and male rats (Fig. 8C and D).
Gender differences in the regulation of active TGFβ1 and PRL secretion by dopamine and estradiol in vivo. (A, C, and E) Pituitary active TGFβ1 content measured by ELISA in pituitary extracts. (B, D, and F) Serum PRL levels measured by RIA. DA regulation: 11-day-old male and female rats were injected with the Drd2 agonist, cabergoline (A and B, caberg, 2 mg/kg, i.p.), or Drd2 antagonist, sulpiride (C and D, sulp, 10 mg/kg, i.p) or saline (control, i.p.), and killed after 30 min. E2 regulation: 11-day-old male and female rats were injected with estradiol valerate (E2 3 h, 0.2 mg/kg, s.c.) or castor oil (control, s.c.) and killed after 3 h. Data were analyzed by Student’s t-test within the same gender (control vs treatment). *P < 0.05. n = 5 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Gender differences in the regulation of active TGFβ1 and PRL secretion by dopamine and estradiol in vivo. (A, C, and E) Pituitary active TGFβ1 content measured by ELISA in pituitary extracts. (B, D, and F) Serum PRL levels measured by RIA. DA regulation: 11-day-old male and female rats were injected with the Drd2 agonist, cabergoline (A and B, caberg, 2 mg/kg, i.p.), or Drd2 antagonist, sulpiride (C and D, sulp, 10 mg/kg, i.p) or saline (control, i.p.), and killed after 30 min. E2 regulation: 11-day-old male and female rats were injected with estradiol valerate (E2 3 h, 0.2 mg/kg, s.c.) or castor oil (control, s.c.) and killed after 3 h. Data were analyzed by Student’s t-test within the same gender (control vs treatment). *P < 0.05. n = 5 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Gender differences in the regulation of active TGFβ1 and PRL secretion by dopamine and estradiol in vivo. (A, C, and E) Pituitary active TGFβ1 content measured by ELISA in pituitary extracts. (B, D, and F) Serum PRL levels measured by RIA. DA regulation: 11-day-old male and female rats were injected with the Drd2 agonist, cabergoline (A and B, caberg, 2 mg/kg, i.p.), or Drd2 antagonist, sulpiride (C and D, sulp, 10 mg/kg, i.p) or saline (control, i.p.), and killed after 30 min. E2 regulation: 11-day-old male and female rats were injected with estradiol valerate (E2 3 h, 0.2 mg/kg, s.c.) or castor oil (control, s.c.) and killed after 3 h. Data were analyzed by Student’s t-test within the same gender (control vs treatment). *P < 0.05. n = 5 per group.
Citation: Journal of Endocrinology 246, 1; 10.1530/JOE-20-0041
Discussion
In the present work, we demonstrated that pituitary TGFβ1 system is involved in the control of prolactin secretion during early postnatal life, as well as in the gender differences observed. Only in females, prolactin levels negatively correlate with pituitary active TGFβ1. Moreover, dopamine and estradiol stimulate pituitary TGFβ1 activation at postnatal day 11 in both genders, nevertheless, the impact of increased active TGFβ1 levels on prolactin inhibition was observed only in females.
It is well known that serum prolactin increases from birth to puberty in both genders, but prolactin levels remain higher in females. However, the gradual and continuous increase in prolactin secretion as well as the gender differences previously described could not be explained neither by the decrease in hypothalamic inhibitory impact nor by the increase observed in serum estradiol levels.
The inhibitory hypothalamic impact, including dopaminergic tone and lactotroph responsiveness to dopamine, also increases during the first weeks of life in both genders (Nazian 1983). Moreover, prolactin levels remain higher in females even though the dopamine-inhibitory action on lactotroph function is higher in females since the first weeks of postnatal life (Becú-Villalobos et al. 1992). Then, the gradual increase in prolactin secretion and the gender differences found cannot be fully explained by the maturation of the dopamine inhibitory regulation.
It was proposed that the continuous increase in prolactin levels is related to an increase in the efficiency of prolactin-releasing factors such as estradiol, serotonin, and opiates among others, but considering estradiol as the primary stimulus (Karanth et al. 1987). However, serum estradiol levels alone neither explain the steady increase in prolactin levels after birth nor the gender differences observed. After several contradictory reports in the literature of the 80s and 90s about postnatal serum estradiol levels, in 2012, Walker et al. described that serum estradiol concentration is similar in developing female and male rats. Estradiol levels gradually increase after birth, presenting the highest concentration on postnatal day 15 and then undergo a decrease as the animals mature, while prolactin levels remain increasing after postnatal day 15 to puberty. The gender differences in estradiol levels appear after 45 days of life (Walker et al. 2012).
Then, the complete mechanism involved in both the control of prolactin secretion during the first weeks of postnatal life as well as the gender differences observed is still unsolved.
The lactotroph population, the synthesis of prolactin, and the amount of prolactin secreted from individual lactotrophs increase from birth to puberty, in both female and male pituitaries. However, Chen et al. demonstrated that, after birth, only a percentage of lactotrophs are secreting cells (Chen 1987). These results were obtained using a reverse hemolytic plaque assay for detection and measurement of PRL secretion from individual cells in conjunction with PRL by immunocytochemistry. Authors demonstrated that the percentage of plaque-forming cells (secreting lactotrophs) is about 5% of the total anterior pituitary cell population at postnatal day 5 in both male and females and that the fraction of pituitary cells staining for PRL (lactotrophs) is twice that of cells forming plaques. The proportion of secreting lactotrophs gradually increases, in a gender-specific rate, until reaching the adult values of about 37% in males and 54% in females at proestrus (Chen 1987). These results were obtained in dispersed pituitary cells, avoiding hypothalamic influence, and suggest the presence of an intra-pituitary factor involved in the inhibition of prolactin secretion (Chen 1987).
Substantial evidence supports the relevance of the TGFβ1 inhibitory action on lactotroph function as well as its involvement in prolactinoma development. colleagues mRNA and protein expression in the pituitary gland and the inhibitory effect of TGFβ1 on prolactin secretion and lactotroph proliferation (Sarkar et al. 1992). Few years later, TGFβ1 and TβRII expression were found expressed in human pituitaries and human pituitary adenomas (Fujiwara et al. 1995, Jin et al. 1997).
Interestingly, TGFβ1 activity is reduced in prolactinomas, concomitant with the increase observed in prolactin secretion and lactotroph proliferation (Pastorcic et al. 1995, Recouvreux et al. 2013). It was postulated that this decreased cytokine activity is involved in prolactinoma development. Indeed, we have previously demonstrated, using animal models of prolactinomas, that the pharmacological recovery of local TGFβ1 activity reverts hyperprolactinemia and tumour development (Recouvreux et al. 2012, 2016, Faraoni et al. 2017).
Additionally, gender differences have been described in the pituitary TGFβ1 activity. Studies performed in two animal models of prolactinoma (mice lacking dopamine receptor type 2 and mice overexpressing the β subunit of chorionic gonadotrophin) demonstrated that only females develop prolactinomas, concomitant with a weakened TGFβ1 system (Recouvreux et al. 2013, 2017, Faraoni et al. 2017). Interestingly, males present a stronger pituitary TGFβ1 system compared to females, in both mouse models, and this gender does not develop prolactinoma, even in the absence of dopaminergic control (Recouvreux et al. 2012, 2013).
All the previously mentioned results corroborate the impact of the intra-pituitary TGFβ1 inhibition on lactotroph function, and even more, confirm that this regulation is gender specific.
We here described that total pituitary TGFβ1 content presents the highest levels at day 11 and gradually decreases with age, without gender differences. The pituitary expression of LTBP1 and TβRII was also found increased at day 11, and it also decreased with age in female and males. However, the levels of pituitary cytokine activity followed a gender-specific profile. Female pituitaries presented the highest active TGFβ1 levels at day 11, and then it decreased with age. The cytokine biological activity, measured by target genes expression, correlated with active TGFβ1 levels. Moreover, the strongest p-Smad3 immunostaining was observed in pituitaries from 11-day-old females and specifically in lactotrophs. Interestingly, the steady decrease in the TGFβ1 activity observed in females inversely correlates with the gradual increase observed in serum prolactin levels in this gender. In contrast, in male pituitaries, cytokine levels were similar at days 11 and 23 but then increased at 45 days of age. Neither active nor total TGFβ1 levels explain the prolactin secretion in males. Moreover, by an in vivo assay, we demonstrated that dopamine as well as estradiol induce an increase in the pituitary cytokine activity in both genders; however, those treatments impacted on prolactin secretion only in females.
Although no gender differences were observed in total TGFβ1 pituitary expression during postnatal development, active TGFβ1 levels followed a gender-specific profile. Female pituitaries express higher levels of active cytokine than males at day 11, but that relationship is reversed at day 45, when the highest levels of active TGFβ1 were found in males. This suggests an age and gender-specific activity of local TGFβ1 activators.
TSP1 is one of the most characterized physiologic activators of TGFβ1 in vitro and in vivo (Schultz-Cherry et al. 1994). We have previously demonstrated that an in vivo treatment with TSP1 analogues improve pituitary levels of active TGFβ1, decreasing hyperprolactinemia in female rats carrying prolactinomas (Recouvreux et al. 2012). In the present work, we found increased pituitary TSP1 mRNA expression at day 11 in both genders, and then Tsp1 gradually decreased with age only in females, in direct correlation with the cytokine activity found in this gender. On the other hand, the highest expression of Tsp1 in male pituitaries was observed at day 45, and this fact could explain the higher levels of active TGFβ1 found in this gender at this time. However, the Tsp1 expression observed in 11-day-old pituitaries, without gender differences, does not explain the higher TGFβ1 biological activity observed in females at this age. In the same way, the lower cytokine activity observed in 11-day-old males could not be associated either with decreased latent cytokine or with impediments in the process of TGFβ1 activation, as cabergoline and estradiol were able to induce TGFβ1 activation in 11-day-old pituitaries from both genders.
The complete mechanism involved in pituitary TGFβ1 activation and the gender differences observed at early postnatal life could not be elucidated with the present results and deserve future studies.
We have previously postulated, by studying the pituitary TGFβ1 system in adult mice and rats, that the TGFβ1 system is a target of the estradiol-dopamine interaction in the regulation of PRL secretion and lactotroph proliferation. Moreover, we suggested that the gender differences observed in the pituitary TGFβ1 system could explain the gender differences found in the control of lactotroph function (Recouvreux et al. 2011, 2017, Faraoni et al. 2017). The present results show, once more, the relevance of this intra-pituitary mechanism involved in the inhibitory regulation of prolactin secretion. This inhibitory control exercised by TGFβ1 is female-specific and is responsible for the gender differences observed in the control of lactotroph function, even at early postnatal age.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the Agencia Nacional de Promoción Científica y Técnica, Buenos Aires, Argentina (grant PICT 2016 N0252 to G D T; grant PICT 2017 N0072 to G D T), René Barón Fundation (to G D T), and Williams Fundation (to G D T).
Author contribution statement
A A M, P A P, S G, and G D T performed conception and design of research. A A M, P A P, M A C, E Y F, and F P performed experiments. A A M, P A P, S G, J P P, and G D T analyzed the data. A A M, P A P, J P P, S G, and G D T interpreted the results of the experiments. A A M and P A P prepared figures. A A M and G D T drafted the manuscript. P A P, F P, M A C, E Y F, J P P, and S G edited and revised the manuscript. All authors approved the final version of the manuscript.
References
Annes JP, Munger JS & Rifkin DB 2003 Making sense of latent TGFbeta activation. Journal of Cell Science 116 217–224. (https://doi.org/10.1242/jcs.00229)
Becú-Villalobos D, Lacau-Mengido IM, Díaz-Torga GS & Libertun C 1992 Ontogenic studies of the neural control of adenohypophyseal hormones in the rat. II. prolactin. Cellular and Molecular Neurobiology 12 1–19. (https://doi.org/10.1007/BF00711635)
Ben-Jonathan N & Hnasko R 2001 Dopamine as a prolactin (PRL) inhibitor. Endocrine Reviews 22 724–763. (https://doi.org/10.1210/edrv.22.6.0451)
Brunschwig EB, Wilson K, Mack D, Dawson D, Lawrence E, Willson JKV, Lu SL, Nosrati A, Rerko RM, Swinler S, et al. 2003 PMEPA1, a transforming growth factor-β-induced marker of terminal colonocyte differentiation whose expression is maintained in primary and metastatic colon cancer. Cancer Research 63 1568–1575.
Chen HT 1987 Postnatal development of pituitary lactotropes in the rat measured by reverse hemolytic plaque assay. Endocrinology 120 247–253. (https://doi.org/10.1210/endo-120-1-247)
Díaz-Torga GS, Becú-Villalobos D & Libertun C 1994 Ontogeny of angiotensin-II-induced prolactin release in vivo and in vitro in female and male rats. Neuroendocrinology 59 57–62. (https://doi.org/10.1159/000126638)
Faraoni EY, Camilletti MA, Abeledo-Machado A, Ratner LD, de Fino F, Ipo Huhtaniemi I, Rulli SB & Díaz-Torga G 2017 Sex differences in the development of prolactinoma in mice overexpressing hCGB: role of TGFB1. Journal of Endocrinology 232 535–546. (https://doi.org/10.1530/JOE-16-0371)
Fujiwara K, Ikeda H & Yoshimoto T 1995 Immunohistochemical demonstration of TGF-beta-receptor type II in human pituitary adenomas. Acta Histochemica 97 445–454. (https://doi.org/10.1016/S0065-1281(11)80071-1)
Grattan DR 2015 60 YEARS OF NEUROENDOCRINOLOGY: The hypothalamo-prolactin axis. Journal of Endocrinology 226 T101–T122. (https://doi.org/10.1530/JOE-15-0213)
Jin L, Qian X, Kulig E, Sanno N, Scheithauer BW, Kovacs K, Young WF & Lloyd RV 1997 Transforming growth factor-β, transforming growth factor-β receptor II, and p27(Kip1) expression in nontumorous and neoplastic human pituitaries. American Journal of Pathology 151 509–519.
Kansra S, Yamagata S, Sneade L, Foster L & Ben-Jonathan N 2005 Differential effects of estrogen receptor antagonists on pituitary lactotroph proliferation and prolactin release. Molecular and Cellular Endocrinology 239 27–36. (https://doi.org/10.1016/j.mce.2005.04.008)
Karanth S, Dutt A & Juneja HS 1987 Age-related release of prolactin by the pituitary and the pituitary-hypothalamic complex in vitro: an attempt to describe the development of the hypothalamic prolactin-inhibiting and -releasing activities in male rats. Journal of Endocrinology 115 405–409. (https://doi.org/10.1677/joe.0.1150405)
Leong DA, Frawley LS & Neill JD 1983 Neuroendocrine control of prolactin secretion. Annual Review of Physiology 45 109–127. (https://doi.org/10.1146/annurev.ph.45.030183.000545)
Levy L & Hill C 2005 Smad4 dependency defines two classes of transforming growth factor β (TGF-β) target genes and distinguishes TGF-β-induced epithelial-mesenchymal transition from. Molecular and Cellular Biology 25 8108–8125. (https://doi.org/10.1128/MCB.25.18.8108)
Minami S & Sarkar DK 1997 Transforming growth factor-beta 1 inhibits prolactin secretion and lactotropic cell proliferation in the pituitary of oestrogen-treated Fischer 344 rats. Neurochemistry International 30 499–506. (https://doi.org/10.1016/s0197-0186(96)00087-3)
Nazian SJ 1983 Pituitary function during the sexual maturation of the male rat: inhibition of prolactin secretion by exogenous dopamine. Biology of Reproduction 28 645–651. (https://doi.org/10.1095/biolreprod28.3.645)
Paez-Pereda M, Kuchenbauer F, Arzt E & Stalla GK 2005 Regulation of pituitary hormones and cell proliferation by components of the extracellular matrix. Brazilian Journal of Medical and Biological Research 38 1487–1494. (https://doi.org/10.1590/S0100-879X2005001000005)
Pastorcic M, De A, Boyadjieva N, Vale W & Sarkar DK 1995 Reduction in the expression and action of transforming growth factor beta 1 on lactotropes during estrogen-induced tumorigenesis in the anterior pituitary. Cancer Research 55 4892–4898.
Perez PA, Petiti JP, Picech F, Guido CB, dV Sosa L, Grondona E, Mukdsi JH, De Paul AL, Torres AI & Gutierrez S 2018 Estrogen receptor beta regulates the tumoral suppressor PTEN to modulate pituitary cell growth. Journal of Cellular Physiology 233 1402–1413. (https://doi.org/10.1002/jcp.26025)
Recouvreux MV, Guida MC, Rifkin DB, Becu-Villalobos D & Díaz-Torga G 2011 Active and total transforming growth factor-β1 are differentially regulated by dopamine and estradiol in the pituitary. Endocrinology 152 2722–2730. (https://doi.org/10.1210/en.2010-1464)
Recouvreux MV, Camilletti MA, Rifkin DB, Becu-Villalobos D & Diaz-Torga G 2012 Thrombospondin-1 (TSP-1) analogs ABT-510 and ABT-898 inhibit prolactinoma growth and recover active pituitary transforming growth factor-beta1 (TGF-beta1). Endocrinology 153 3861–3871. (https://doi.org/10.1210/en.2012-1007)
Recouvreux MV, Lapyckyj L, Camilletti MA, Guida MC, Ornstein A, Rifkin DB, Becu-Villalobos D & Diaz-Torga G 2013 Sex differences in the pituitary transforming growth factor-beta1 system: studies in a model of resistant prolactinomas. Endocrinology 154 4192–4205. (https://doi.org/10.1210/en.2013-1433)
Recouvreux MV, Camilletti MA, Rifkin DB & Díaz-Torga G 2016 The pituitary TGFβ1 system as a novel target for the treatment of resistant prolactinomas. Journal of Endocrinology 228 R73–R83. (https://doi.org/10.1530/JOE-15-0451)
Recouvreux MV, Faraoni EY, Camilletti MA, Ratner L, Abeledo-Machado A, Rulli SB & Díaz-Torga G 2017 Sex differences in the pituitary TGFβ1 system: the role of TGFβ1 in prolactinoma development. Frontiers in Neuroendocrinology 50 118–122. (https://doi.org/10.1016/j.yfrne.2017.10.003)
Ribeiro SM, Poczatek M, Schultz-Cherry S, Villain M & Murphy-Ullrich JE 1999 The activation sequence of thrombospondin-1 interacts with the latency-associated peptide to regulate activation of latent transforming growth factor-beta. Journal of Biological Chemistry 274 13586–13593. (https://doi.org/10.1074/jbc.274.19.13586)
Rifkin DB 2005 Latent transforming growth factor-beta (TGF-beta) binding proteins: orchestrators of TGF-beta availability. Journal of Biological Chemistry 280 7409–7412. (https://doi.org/10.1074/jbc.R400029200)
Sarkar DK, Kim KH & Minami S 1992 Transforming growth factor-beta 1 messenger RNA and protein expression in the pituitary gland: its action on prolactin secretion and lactotropic growth. Molecular Endocrinology 6 1825–1833. (https://doi.org/10.1210/mend.6.11.1480172)
Sarkar DK, Pastorcic M, De A, Engel M, Moses H & Ghasemzadeh MB 1998 Role of transforming growth factor (TGF)-beta Type I and TGF-beta type II receptors in the TGF-beta1-regulated gene expression in pituitary prolactin-secreting lactotropes. Endocrinology 139 3620–3628. (https://doi.org/10.1210/endo.139.8.6135)
Schultz-Cherry S, Ribeiro S, Gentry L & Murphy-Ullrich JE 1994 Thrombospondin binds and activates the small and large forms of latent transforming growth factor-β in a chemically defined system. Journal of Biological Chemistry 269 26775–26782.
Shi Y & Massague J 2003 Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113 685–700. (https://doi.org/10.1016/s0092-8674(03)00432-x)
Truty MJ, Lomberk G, Fernandez-Zapico ME & Urrutia R 2009 Silencing of the transforming growth factor-beta (TGFbeta) receptor II by Kruppel-like factor 14 underscores the importance of a negative feedback mechanism in TGFbeta signaling. Journal of Biological Chemistry 284 6291–6300. (https://doi.org/10.1074/jbc.M807791200)
Walker DM, Kirson D, Perez LF & Gore AC 2012 Molecular profiling of postnatal development of the hypothalamus in female and male rats. Biology of Reproduction 87 129. (https://doi.org/10.1095/biolreprod.112.102798)
Wrana JL 2013 Signaling by the TGFβ superfamily. Cold Spring Harbor Perspectives in Biology 5 a011197. (https://doi.org/10.1101/cshperspect.a011197)
Yoshinaga K, Obata H, Jurukovski V, Mazzieri R, Chen Y, Zilberberg L, Huso D, Melamed J, Prijatelj P, Todorovic V, et al. 2008 Perturbation of transforming growth factor (TGF)-beta1 association with latent TGF-beta binding protein yields inflammation and tumors. PNAS 105 18758–18763. (https://doi.org/10.1073/pnas.0805411105)
