Characterization of the onset of leptin effects on the regulation of energy balance

in Journal of Endocrinology
Authors:
Pryscila D S TeixeiraDepartamento de Fisiologia e Biofisica, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Sao Paulo, Brazil

Search for other papers by Pryscila D S Teixeira in
Current site
Google Scholar
PubMed
Close
,
Angela M Ramos-LoboDepartamento de Fisiologia e Biofisica, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Sao Paulo, Brazil

Search for other papers by Angela M Ramos-Lobo in
Current site
Google Scholar
PubMed
Close
,
Mariana Rosolen TavaresDepartamento de Fisiologia e Biofisica, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Sao Paulo, Brazil

Search for other papers by Mariana Rosolen Tavares in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0001-6317-6853
,
Frederick WasinskiDepartamento de Fisiologia e Biofisica, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Sao Paulo, Brazil

Search for other papers by Frederick Wasinski in
Current site
Google Scholar
PubMed
Close
,
Renata FrazaoDepartamento de Anatomia, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Sao Paulo, Brazil

Search for other papers by Renata Frazao in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-0877-8453
, and
Jose Donato JrDepartamento de Fisiologia e Biofisica, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Sao Paulo, Brazil

Search for other papers by Jose Donato Jr in
Current site
Google Scholar
PubMed
Close
View More View Less

Correspondence should be addressed to JJ Donato; Email: jdonato@icb.usp.br
Free access

Leptin is a hormone required for the regulation of body weight in adult animals. However, during the postnatal period, leptin is mostly involved in developmental processes. Because the precise moment at which leptin starts to exert its metabolic effects is not well characterized, our objective was to identify the approximate onset of leptin effects on the regulation of energy balance. We observed that male Lepob/ob mice started to exhibit increased body fat mass from postnatal day 13 (P13), whereas in females, the increase in adiposity began on P20. Daily leptin injections from P10 to P22 did not reduce the weight gain of WT mice. However, an acute leptin injection induced an anorexigenic response in 10-day-old C57BL/6 mice but not in 7-day-old mice. An age-dependent increase in the number of leptin receptor-expressing neurons and leptin-induced pSTAT3 cells was observed in the hypothalamus of P7, P10 and P16 mice. Leptin deficiency started to modulate the hypothalamic expression of transcripts involved in the regulation of metabolism between P7 and P12. Additionally, fasting-induced hypothalamic responses were prevented by leptin replacement in 10-day-old mice. Finally, 12-day-old males and females showed similar developmental timing of axonal projections of arcuate nucleus neurons in both WT and Lepob/ob mice. In summary, we provided a detailed characterization of the onset of leptin’s effects on the regulation of energy balance. These findings contribute to the understanding of leptin functions during development.

Abstract

Leptin is a hormone required for the regulation of body weight in adult animals. However, during the postnatal period, leptin is mostly involved in developmental processes. Because the precise moment at which leptin starts to exert its metabolic effects is not well characterized, our objective was to identify the approximate onset of leptin effects on the regulation of energy balance. We observed that male Lepob/ob mice started to exhibit increased body fat mass from postnatal day 13 (P13), whereas in females, the increase in adiposity began on P20. Daily leptin injections from P10 to P22 did not reduce the weight gain of WT mice. However, an acute leptin injection induced an anorexigenic response in 10-day-old C57BL/6 mice but not in 7-day-old mice. An age-dependent increase in the number of leptin receptor-expressing neurons and leptin-induced pSTAT3 cells was observed in the hypothalamus of P7, P10 and P16 mice. Leptin deficiency started to modulate the hypothalamic expression of transcripts involved in the regulation of metabolism between P7 and P12. Additionally, fasting-induced hypothalamic responses were prevented by leptin replacement in 10-day-old mice. Finally, 12-day-old males and females showed similar developmental timing of axonal projections of arcuate nucleus neurons in both WT and Lepob/ob mice. In summary, we provided a detailed characterization of the onset of leptin’s effects on the regulation of energy balance. These findings contribute to the understanding of leptin functions during development.

Introduction

The adipocyte-derived hormone leptin has fundamental importance on the regulation of body weight and feeding. In this respect, the brain uses circulating leptin levels as a major signal to indicate the balance between energy intake and expenditure (Ramos-Lobo & Donato 2017). Thus, genetic mutations that cause the absence of leptin or the leptin receptor (LepR) produce metabolic changes that resemble those observed during intense negative energy balance, including hunger and suppression of physiological processes that expend energy (Ahima et al. 1996). Consequently, mice deficient in leptin (Lepob/ob) or LepR (Leprdb/db) become morbidly obese in adulthood due to persistent hyperphagia and changes in energy metabolism. Leptin treatment in both Lepob/ob mice and WT animals leads to reductions in food intake and body weight (Campfield et al. 1995, Halaas et al. 1995, Pelleymounter et al. 1995).

The powerful effects of leptin in energy homeostasis are mostly dependent on its central actions (de Luca et al. 2005, Ring & Zeltser 2010). LepR expression was identified in several brain areas (Caron et al. 2010, Donato et al. 2010, da Silva et al. 2014), and numerous studies have investigated the importance of leptin signaling in different neural populations (Ramos-Lobo & Donato 2017). For example, leptin action on neurons that express proopiomelanocortin (POMC), agouti-related peptide (AgRP) or neuronal nitric oxide synthase regulates different aspects of metabolism (Ramos-Lobo & Donato 2017). These neural populations are distributed in several hypothalamic areas, including the arcuate nucleus (ARH) and ventral premammillary nucleus (PMv). Thus, leptin can influence a complex neural network to produce metabolic, behavioral and neuroendocrine changes.

Although the physiological effects of leptin have been widely investigated in adult animals, the precise role of leptin signaling during early life is less studied. Previous studies have shown that leptin action is required for the formation of the axonal projections that extend from ARH neurons to important second-order neurons, such as the paraventricular nucleus of the hypothalamus (PVH) (Bouret et al. 2004a,b). Besides this trophic effect, leptin signaling in early life also regulates the onset of puberty (Ahima et al. 1997, Chehab et al. 1997), brain mass and the expression of synaptic and glial proteins (Ahima et al. 1999, Ramos-Lobo et al. 2019). In accordance with the capacity of leptin to affect developmental processes and to induce the phosphorylation of the signal transducer and activator of transcription 3 (pSTAT3), brain Lepr mRNA and leptin-induced pSTAT3 expressions, respectively, are already present in suckling mice (Caron et al. 2010). Furthermore, leptin can induce electrochemical effects on ARH neurons in 2-week-old mice (Baquero et al. 2014). Taken together, these results show that leptin's action in the brain starts in early postnatal life. Nevertheless, daily leptin injections do not change the body weight gain level in 7- to 10-day-old mice. In addition, the food intake of 17-day-old WT or Lepob/ob pups is not affected by an acute intracerebroventricular leptin injection (Mistry et al. 1999). These findings suggest that leptin can regulate developmental processes in suckling animals, but the capacity of leptin to affect feeding and body weight may begin later in life. Notably, to our knowledge, a detailed temporal analysis of the onset of leptin effects on the regulation of energy balance has not yet been described. Therefore, the objective of the present study was to investigate at what point in postnatal life leptin begins its effects on feeding, body weight and in the regulation of classical neurocircuits that regulate metabolism.

Materials and methods

Mice

All experiments were carried out in accordance with and approved by the Ethics Committee on the Use of Animals of the Institute of Biomedical Sciences at the University of São Paulo (Protocol number: 79/2015). Mice were bred and maintained in standard conditions of light (12 h light: 12 h darkness cycle) and received a regular rodent chow (2.99 kcal/g; 9.4% calories from fat). In the experiments, we used C57BL/6 WT mice, Lepob/ob mice (Stock No: 000632; The Jackson Laboratory, Bar Harbor, ME) and LepR-reporter mice, which was produced by breeding the LepR-Cre mouse (Stock No: 008320; The Jackson Laboratory) with the Cre-inducible tdTomato-reporter mouse (Stock No: 007909, The Jackson Laboratory).

Evaluation of body composition changes during development

To determine the precise moment when the absence of leptin starts to affect energy homeostasis, body weight, fat mass and lean body mass were monitored three times per week from birth until 6 weeks of life in male and female Lepob/ob mice and their lean littermates. Body composition was measured by time-domain NMR using the LF50 body composition mice analyzer (Bruker, Mannheim, Germany).

Evaluation of the acute and chronic effects of exogenous leptin on food intake, body weight and vaginal opening

To determine the acute effects of exogenous leptin on the food intake of suckling mice, we used a protocol published previously (Mistry et al. 1999, Buonfiglio et al. 2015, 2016, Ramos-Lobo et al. 2018). Briefly, 7- and 10-day-old C57BL/6 mice were initially separated from their mothers for 4 h. After that, the pups were weighed and received a s.c. injection of leptin (10 µg/g of body weight, from Dr AF Parlow, National Hormone and Peptide Program, Torrance, CA) or an equal volume of PBS. Then, the pups were allowed to lactate and their body weights were recorded 2 and 5 h later. To evaluate the chronic effects of leptin, 10- and 45-day-old C57BL/6 mice received daily injections of either PBS or leptin (1 µg/g) for 12 days. Their body weights were recorded daily. In females, we also determined the age of vaginal opening, as previously described (Ahima et al. 1997, Chehab et al. 1997, Donato et al. 2011, Bohlen et al. 2016).

Detection of leptin-responsive cells in the brain during development

A LepR-reporter mouse model (da Silva et al. 2014, Nagaishi et al. 2014) was used to allow the visualization of LepR-expressing neurons in different hypothalamic nuclei in mice at 7 (n = 5), 10 (n = 3) and 16 (n = 2) days of life. To identify leptin-responsive neurons, 7- (n = 3), 10- (n = 2) and 16-day-old (n = 2) C57BL/6 WT mice fed ad libitum received an acute s.c. injection of mouse recombinant leptin (10 µg/g body weight). After 90 min, mice were perfused and their brains processed to detect the immunoreactivity to pSTAT3 as a marker of leptin-responsive cells (Scott et al. 2009, Caron et al. 2010), using a protocol previously described (Campos et al. 2020). For the whole-cell patch-clamp recordings, 8- to 16-day-old LepR-reporter male mice (n = 7) were anesthetized, decapitated and their brains were immediately processed, as previously described (Silveira et al. 2017). In current-clamp mode, neurons were recorded under zero current injection (I = 0). The resting membrane potential (RMP) of LepR-expressing neurons in the ARH and PMv was monitored for at least 5 min (basal), followed by the addition of 100 nM mouse recombinant leptin to the bath for approximately 5 min. The RMP values were compensated to account for the junction potential (−8 mV).

Hypothalamic gene expression analysis in Lepob/ob and fasted WT mice

In this study, 7- or 12-day-old male and female Lepob/ob mice and lean littermates fed ad libitum were decapitated, and the entire hypothalamus was collected. To evaluate the effects of fasting and leptin replacement, 10-day-old C57BL/6 mice were subjected to an overnight fast (16 h). At the moment of separation from the dams, the pups received a s.c. injection of either PBS or leptin (10 µg/g of body weight). The following morning, the pups received a second injection of PBS or leptin and were sacrificed 3 h later. A group of 10-day-old C57BL/6 mice fed ad libitum also received PBS injections at the same time and were used as controls. The hypothalamus was collected to determine the gene expression. Total RNA was extracted with TRIzol (Invitrogen). Real-time PCR was performed using the 7500TM Real-Time PCR System (Applied Biosystems), Power SYBR Green Gene Expression PCR Master Mix (Applied Biosystems) and specific primers for target genes (Table 1). Data were normalized to the geometric average of Actb, Gapdh and Ppia.

Table 1

Primer sequences.

Target gene Forward primer (5’-3’) Reverse primer (5’-3’)
Actb gctccggcatgtgcaaag catcacaccctggtgccta
Agrp ctttggcggaggtgctagat aggactcgtgcagccttacac
Cartpt cagtcacacagcttcccgat cagatcgaagcgttgcaaga
Crh caacctcagccggttctgat ggaaaaagttagccgcagcc
Gapdh gggtcccagcttaggttcat tacggccaaatccgttcaca
Hcrt gacagcagtcgggcagag ggcaccatgaactttccttc
Kiss1 gattccttttcccaggcatt ggcaaaagtgaagcctggat
Lepr (isoform b) tgtcctactgctcggaacac gctcaaatgtttcaggcttttgg
Nos1 cggaccttgtagctcttcctc ttcggctgtgctttgatgga
Npy ccgcccgccatgatgctaggta ccctcagccagaatgcccaa
Oxt ctccgagaaggcagactcag ctgcagcccggatggc
Pmch ccagctgagaatggagttcaga gtcggtagactcttcccagcat
Pomc atagacgtgtggagctggtgc gcaagccagcaggttgct
Ppia cttcttgctggtcttgccattcc tatctgcactgccaagactgagt
Socs3 TaqMan Gene Expression Assay (Applied Biosystems)
Trh tcgtgctaactggtatcccc cccaaatctcccctctcttc

Analysis of innervation of ARH neurons

To determine possible sexually dimorphic differences in the developmental timing of the innervation of ARH neurons, 12-day-old male (n = 5) and female (n = 7) C57BL/6 mice and male (n = 5) and female (n = 5) Lepob/ob mice were transcardially perfused with saline, followed by 4% formaldehyde fixative solution. Subsequently, brains were cut in 40-µm thick sections using a freezing microtome, and the brain sections were subjected to immunofluorescence staining in order to evaluate the integrated optical density (IOD) of POMC and AgRP fibers in the PVH, as previously described (Ramos-Lobo et al. 2018, 2019). A Zeiss Axioimager A1 microscope (Zeiss, Munich, Germany) was used to obtain the epifluorescence photomicrographs. Then, the ImageJ software (http://rsb.info.nih.gov/ij) was used to determine the IOD in the PVH that was subtracted by the IOD assessed in adjacent areas (background). One representative rostrocaudal level of the PVH was analyzed (Bregma: −0.80 mm).

Statistical analysis

Changes in body weight and composition along time and the effects of leptin on food intake were analyzed by repeated-measures two-way ANOVA and the contrasts were identified by Sidak's multiple comparisons test. Comparisons between two groups were performed using Student’s t-test, and for analysis between more than two groups, we used one-way ANOVA followed by Newman–Keuls multiple comparison post-hoc test. Possible outliers were checked by the ROUT method and removed from the analysis. All results were expressed as mean ± s.e.m. Statistical analyses were performed using GraphPad Prism software (GraphPad), considering P < 0.05 as statistically significant.

Results

Absence of leptin induces obesity in mice between the second and third week of life

To determine the onset of leptin effects on the regulation of energy balance, the body weight, fat mass and lean body mass were determined from birth to 6 weeks of age in male and female Lepob/ob mice and their lean littermates (Fig. 1). Interestingly, we did not find significant changes in body weight between WT and Lepob/ob mice before the sixth week of life in males (Fig. 1A) or females (Fig. 1B). After this period, Lepob/ob mice exhibited a well-established increase in body weight (data not shown). However, the body composition analysis revealed that male Lepob/ob mice exhibited increased fat mass from P13 (interaction (F(17, 442) = 11.03, P < 0.0001); Fig. 1C), whereas female Lepob/ob mice showed higher fat mass from P20 in comparison with WT littermates (interaction (F(17, 559) = 22.53, P < 0.0001); Fig. 1D). Conversely, Lepob/ob mice presented reduced lean body mass from P20, compared to WT littermates, in both males (interaction (F(16, 394) = 15.33, P < 0.0001); Fig. 1E) and females (interaction (F(17, 636) = 5.781, P < 0.0001); Fig. 1F). Thus, the absence of endogenous leptin induces obesity in mice from the second week of life.

Figure 1
Figure 1

Absence of leptin induces obesity in mice between the second and third week of life. (A, B, C, D, E, F) Changes in body weight (A and B), body fat mass (C and D) and lean body mass (E and F) in male (A, C, E) and female (B, D, F) Lepob/ob and WT mice. Body weight and composition were determined three times per week from birth until 6 weeks of life (n = 18–28/group). *Significant difference (P < 0.05) between WT and Lepob/ob mice.

Citation: Journal of Endocrinology 249, 3; 10.1530/JOE-20-0076

Chronic leptin injections in suckling mice do not reduce weight gain

To determine whether bodyweight of suckling mice is affected by exogenous leptin treatment, 10-day-old C57BL/6 mice received daily injections of PBS or leptin for 12 consecutive days. We observed that chronic leptin treatment did not affect the weight gain in males (F(1, 18) = 0.0046, P = 0.9466) or females (F(1, 18) = 0.0098, P = 0.922), compared to PBS-treated mice (Fig. 2A and B). For comparison, a group of young adult (45-days old) mice also received leptin treatment for the same period of time, and in this case, leptin caused a sustained suppression in weight gain (F(1, 12) = 10.42, P = 0.0072), compared to PBS-injected animals (Fig. 2C). Thus, exogenous leptin treatment is unable to affect the bodyweight of mice before the fourth week of life. Notably, although leptin treatment between P10 and P22 did not affect body weight, leptin-treated females presented earlier vaginal opening, compared to PBS-injected mice (t(18) = 1.834, P = 0.0416; Fig. 2D).

Figure 2
Figure 2

Chronic leptin treatment does not affect the body weight of suckling mice, although it causes earlier vaginal opening. (A, B, C) Body weight changes in 10-day-old C57BL/6 male mice (A; n = 9–11/group), 10-day-old C57BL/6 female mice (B; n = 8–12/group) and 45-day-old C57BL/6 male mice (C; n = 7/group) that received daily injections of leptin for 12 days. (D). Average days required for PBS-treated (n = 8) or leptin-treated (n = 12) female mice to exhibit vaginal opening. Mice received daily injections from P10 to P22. *Significantly different (P < 0.05) compared to PBS-treated mice.

Citation: Journal of Endocrinology 249, 3; 10.1530/JOE-20-0076

An acute leptin injection induces an anorexigenic response in 10-day-old mice but not in 7-day-old mice

Next, the acute anorexigenic effects of leptin were determined in 7- (P7) and 10-day-old (P10) C57BL/6 mice (Fig. 3). Since mice are still suckling at this age, the effects of leptin on feeding were indirectly evaluated through the weight gain in pups that had been separated from their mothers for 4 h before the test. Compared to PBS-injected pups, an acute leptin injection did not affect the weight gain of P7 mice (F(1, 9) = 0.0001, P = 0.9975; Fig. 3A). However, leptin reduced the weight gain in P10 mice (F(1, 12) = 4.783, P = 0.0493; Fig. 3B), suggesting that the acute anorexigenic effect of leptin is already present in P10 mice but not earlier.

Figure 3
Figure 3

Acute anorexigenic effect of leptin in suckling mice. (A and B) Changes in body weight in 7-day-old (A; n = 6) or 10-day-old (B; n = 7) C57BL/6 mice 2 and 5 h after an acute injection of PBS and leptin. The effects of leptin on feeding were indirectly evaluated through the weight gain in pups that had been separated from their mothers for 4 h before the test. *P = 0.0493, effect of leptin (two-way ANOVA).

Citation: Journal of Endocrinology 249, 3; 10.1530/JOE-20-0076

Temporal characterization of the LepR expression and leptin-induced pSTAT3 in the hypothalamus of young mice

Given the critical role played by hypothalamic neurons in mediating the effects of leptin on energy homeostasis (de Luca et al. 2005, Ring & Zeltser 2010), we now performed a temporal characterization of the LepR expression and leptin-induced pSTAT3 in the hypothalamus of mice at 7 (P7), 10 (P10) and 16 (P16) days of life. Using a LepR-reporter mouse, we observed that a significant number of LepR-expressing neurons are already present in the medial preoptic area (MPA), ARH and PMv of P7 mice, whereas few cells could be observed in the dorsomedial nucleus of the hypothalamus (DMH) and lateral hypothalamic area (LHA; Fig. 4). In P10 mice, a modest increase in the number of LepR-expressing neurons was observed in the MPA and DMH (Fig. 4 and Table 2). The number of LepR-expressing neurons further increased in the ARH, ventromedial nucleus of the hypothalamus (VMH), DMH and LHA of P16 mice. To demonstrate that the activation of LepR is able to recruit the STAT3 transcription factor, C57BL/6 mice received a leptin injection before perfusion. Leptin induced pSTAT3 only in the MPA, ARH and PMv of P7 mice (Fig. 5). By P10, increased responsiveness to leptin was observed in the MPA and even more in the DMH and LHA (Fig. 5 and Table 2). Furthermore, increased numbers of leptin-induced pSTAT3 cells were observed in all hypothalamic nuclei of P16 mice. Remarkably, the VMH had not shown responsiveness to leptin at younger ages (Fig. 5 and Table 2). To further demonstrate that LepR is functional in suckling mice, electrophysiological experiments were performed in brain slices of 8- to 16-day-old LepR-reporter mice. LepR-expressing neurons in the ARH and PMv were recorded before and during leptin administration (Fig. 5M). We observed that three out of eight cells in the ARH (38%) and six out of eight cells in the PMv (75%) exhibited significant changes in the RMP after leptin administration (Fig. 5N).

Figure 4
Figure 4

Temporal characterization of the leptin receptor expression in the hypothalamus of young mice. (A, B, C, D, E, F, G, H, I, J, K and L) Representative photomicrographs showing the expression of the tdTomato reporter protein in the hypothalamus of mice at 7 (P7), 10 (P10) and 16 (P16) days of life. Abbreviations: 3V, third ventricle; OVLT, organum vasculosum lamina terminalis. Scale bar = 200 µm.

Citation: Journal of Endocrinology 249, 3; 10.1530/JOE-20-0076

Figure 5
Figure 5

Temporal characterization in the capacity of leptin to induce pSTAT3 in the hypothalamus of young mice. (A, B, C, D, E, F, G, H, I, J, K and L) Representative photomicrographs showing the pSTAT3 induced by a s.c. leptin injection in the hypothalamus of C57BL/6 mice at 7 (P7), 10 (P10) and 16 (P16) days of life. Abbreviations: 3V, third ventricle; OVLT, organum vasculosum lamina terminalis. Scale bar = 200 µm. (M) Example of a current-clamp recording of a LepR-expressing neuron that exhibited a hyperpolarization after application of leptin. Dashed line indicates the resting membrane potential (RMP) before leptin treatment. (N) Changes in the RMP induced by leptin in LepR-expressing neurons of the ARH and PMv in 8 to 16-day-old LepR-reporter male mice.

Citation: Journal of Endocrinology 249, 3; 10.1530/JOE-20-0076

Table 2

Temporal characterization of the leptin receptor (LepR) expression and leptin-induced pSTAT3 in the hypothalamus of mice at 7 (P7), 10 (P10) and 16 (P16) days of life.

LepR-expressing neurons Leptin-induced pSTAT3
P7 P10 P16 P7 P10 P16
MPA +++ ++++ ++++ ++ +++ +++
ARH ++ ++ +++ ++ ++ +++
VMH + +++
DMH + ++ +++ ++ +++
LHA + + ++ - + ++
PMv ++++ ++++ ++++ +++ +++ ++++

Classification: −, very low expression or virtually absent; +, low density of cells covering only parts of the nucleus; ++, moderate density of cells covering only parts of the nucleus; +++, high density of cells covering most of the nucleus; ++++, high density of cells covering the whole extension of the nucleus.

ARH, arcuate nucleus; DMH, dorsomedial nucleus of the hypothalamus; LHA, lateral hypothalamic area; MPA, medial preoptic nucleus; PMv, ventral premammillary nucleus; VMH, ventromedial nucleus of the hypothalamus.

Temporal characterization in the hypothalamic expression of several transcripts involved in the regulation of energy balance in postnatal Lepob/ob mice

To determine whether endogenous leptin is able to regulate the hypothalamic expression of transcripts involved in the regulation of energy balance in young mice, we analyzed the hypothalamic gene expression of 7- and 12-day-old male and female Lepob/ob mice (Fig. 6). In P7 Lepob/ob male mice, only a reduction in hypothalamic Crh (t(7) = 2.592, P = 0.358) mRNA levels was observed, as compared to WT littermates (Fig. 6A). No significant changes were observed in the hypothalamic mRNA levels of Agrp, Npy, Pomc, Cartpt, Hcrt, Pmch, Trh, Oxt, Kiss1, Nos1, Lepr or Socs3 (Fig. 6A). In P7 female mice, we observed an increase in Agrp (t(5) = 2.652, P = 0.0453) mRNA levels in the hypothalamus of Lepob/ob mice, whereas Hcrt (t(5) = 3.312, P = 0.0212) and Crh (t(4) = 2.94, P = 0.0424) mRNA levels decreased, as compared to WT littermates (Fig. 6A). In P12 male mice, the absence of leptin action induced an upregulation in the expression of Agrp (t(13) = 3.457, P = 0.0043), Npy (t(13) = 4.798, P = 0.0003), Pomc (t(11) = 2.204, P = 0.0497), Kiss1 (t(13) = 2.059, P = 0.0289) and Lepr (t(13) = 4.767, P = 0.0004) mRNA levels in the hypothalamus, whereas Cartpt (t(13) = 2.174, P = 0.0487), Hcrt (t(13) = 5.128, P = 0.0002), Pmch (t(13) = 4.013, P = 0.0015), Nos1 (t(13) = 2.675, P = 0.0191) and Socs3 (t(13) = 2.326, P = 0.0368) expression reduced in Lepob/ob male mice, compared to WT littermates (Fig. 6B). The hypothalamic gene expression was also analyzed in P12 females. As seen in males, the absence of leptin increased the hypothalamic expression of Agrp (t(9) = 4.109, P = 0.0026), Npy (t(9) = 2.856, P = 0.0189) and Kiss1 (t(9) = 2.784, P = 0.0213) mRNA levels. However, in contrast to the results found in males, P12 Lepob/ob females exhibited increased hypothalamic Cartpt (t(9) = 3.751, P = 0.0045), Trh (t(9) = 5.369, P = 0.0005) and Nos1 (t(9) = 5.27, P = 0.0005) mRNA levels, compared to WT mice (Fig. 6B).

Figure 6
Figure 6

Hypothalamic expression of several transcripts involved in the energy balance regulation is already altered in pre-obese Lepob/ob mice. (A) Hypothalamic gene expression in 7-day-old (P7) WT (n = 5–8) and Lepob/ob (n = 2–7) male and female mice. (B) Hypothalamic gene expression in 12-day-old (P12) WT (n = 7–8) and Lepob/ob (n = 4–7) male and female mice. *Significant difference (P < 0.05) between WT and Lepob/ob mice.

Citation: Journal of Endocrinology 249, 3; 10.1530/JOE-20-0076

Leptin treatment prevents fasting-induced changes in the expression of hypothalamic transcripts involved in energy-balance regulation

To determine whether suckling mice are responsive to fasting-induced hypothalamic changes and if leptin replacement can prevent these adaptions, the hypothalamic gene expression was analyzed in fed, fasted or leptin-treated fasted 10-day-old C57BL/6 mice (Fig. 7). Fasted 10-day-old mice exhibited increased expression of Agrp (F(2, 28) = 5.205, P = 0.012), Npy (F(2, 30) = 3.973, P = 0.0295) and Hcrt (F(2, 30) = 9.857, P = 0.0005) mRNA, compared to fed mice, whereas Kiss1 (F(2, 27) = 11.29, P = 0.0003) and Nos1 (F(2, 19) = 4.177, P = 0.0314) mRNA levels suppressed by fasting (Fig. 7). Notably, leptin replacement prevented the fasting-induced increase in Agrp, Npy and Hcrt expression (Fig. 7). In contrast, leptin treatment in fasted mice did not restore Kiss1 and Nos1 mRNA levels (Fig. 7). We also observed increased expression of Crh (F(2, 30) = 11.9, P = 0.0002) and Socs3 (F(2, 14) = 14.02, P = 0.0005) only in fasted + leptin mice (Fig. 7). Neither fasting nor leptin treatment affected the hypothalamic expression of Pomc, Cartpt, Pmch, Trh, Oxt, and Lepr mRNA in 10-day-old mice (Fig. 7).

Figure 7
Figure 7

Leptin treatment prevents fasting-induced changes in the expression of several hypothalamic transcripts involved in energy-balance regulation. Hypothalamic gene expression in PBS-treated fed (n = 10), PBS-treated fasted (n = 11) and leptin-treated fasted (n = 12) 10-day-old WT mice. *Significantly different (P < 0.05) compared to Fed + PBS group. #Significantly different (P < 0.05) compared to Fasted + PBS group.

Citation: Journal of Endocrinology 249, 3; 10.1530/JOE-20-0076

Male and female show similar developmental timing of ARH neuronal projections

To determine whether possible differences in the developmental timing of the innervation of ARH neurons could explain the sexually dimorphic differences in the timing of obesity in Lepob/ob mice, we compared the innervation of ARH neurons to the PVH between 12-day-old male and female WT or Lepob/ob mice (Fig. 8). We found that 12-day-old WT males and females showed similar density of AgRP fibers in the PVH (t(9) = 0.94, P = 0.3717) (Fig. 8A, B and C). Regarding POMC innervation, we also observed an equivalent density of POMC fibers in the PVH between male and female WT mice (t(10) = 1.876, P = 0.0902) (Fig. 8D, E and F). Likewise, 12-day-old Lepob/ob male and female mice showed similar density of AgRP (t(8) = 0.8373, P = 0.4267) (Fig. 8G, H and I) and POMC (t(7) = 1.865, P = 0.1044) (Fig. 8J, K and L) fibers in the PVH.

Figure 8
Figure 8

Male and female C57BL/6 or Lepob/ob mice show similar developmental timing of neural projections of arcuate nucleus neurons. (A, B and C) Quantification of the AgRP innervation density in the paraventricular nucleus of the hypothalamus (PVH) of 12-day-old male (n = 5) and female (n = 6) C57BL/6 WT mice. (D, E and F) Quantification of the POMC innervation density in the PVH of 12-day-old male (n = 5) and female (n = 7) C57BL/6 WT mice. (G, H and I) Quantification of the AgRP innervation density in the PVH of 12-day-old male (n = 5) and female (n = 5) Lepob/ob mice. (J, K and L) Quantification of the POMC innervation density in the PVH of 12-day-old male (n = 4) and female (n = 5) Lepob/ob mice. Scale bar = 200 µm.

Citation: Journal of Endocrinology 249, 3; 10.1530/JOE-20-0076

Discussion

The well-established importance of leptin on the regulation of body weight is based on studies in adult animals, whereas, in early life, leptin is mostly involved in developmental processes (Ahima et al. 1999, Bouret et al. 2004a,b, Ramos-Lobo et al. 2019). Remarkably, a detailed temporal characterization of the onset of leptin effects on the regulation of energy balance is not available. Data in humans indicate that the absence of leptin action does not affect birth weight but leads to severe obesity that starts at an average age of 4.1 months (Huvenne et al. 2015). In mice, some studies have shown that 17- or 18-day-old Lepob/ob mice already exhibited changes in bodyweight, characterizing the onset of obesity, although these studies did not evaluate males and females separately (Dubuc 1976, Mistry et al. 1999). However, another study did not find statistically significant changes in bodyweight of 3.5-week-old Leprdb/db mice, although the analysis of body fat indicated higher adiposity (Trayhurn & Fuller 1980). This study and our findings highlight the importance of using body adiposity, instead of bodyweight, as the main readout to detect metabolic changes in Lepob/ob mice during development. In this regard, changes in body weight were detected in Lepob/ob mice only after 6 weeks of age, whereas statistically significant changes in body adiposity were observed between the second and third week of age. The greater adiposity of Lepob/ob mice did not lead to significant changes in bodyweight because they were offset by a lower gain in lean mass during that period. The causes of the lower gain in lean mass in Lepob/ob mice are unknown but may be related to a blunted or delayed onset of the somatotropic axis. Accordingly, while lean littermates exhibit the normal peak of growth hormone (GH) secretion around puberty, Lepob/ob mice maintain reduced serum GH levels over development and at adulthood (Larson et al. 1976). The GH/insulin-like growth factor-1 axis becomes functional between the third and fourth week of age in mice (Donahue & Beamer 1993), which represents the moment when the difference in lean mass between WT and Lepob/ob mice starts. It is worth mentioning that the absence of leptin causes an interruption in sexual maturation (Ahima et al. 1997, Chehab et al. 1997), and the onsets of puberty and the somatotropic axis are generally interconnected (Veldhuis et al. 2006). Accordingly, gonadal steroids act directly in growth hormone-releasing hormone neurons to modulate the somatotropic axis during the pubertal transition (Garcia-Galiano et al. 2020).

Not only body adiposity is altered early in life in Lepob/ob mice but several metabolic parameters as well. In this sense, 15-day-old Lepob/ob mice exhibited increased carcass lipogenesis (Godbole et al. 1980). Furthermore, 15-day-old Lepob/ob mice already exhibited decreased thermogenesis in brown adipose tissue and body temperature, as well as increased serum insulin levels, compared to lean animals (Dubuc 1976, Godbole et al. 1980, Goodbody & Trayhurn 1982, Hull & Vinter 1984). In addition, insulin-stimulated glycogen synthesis is already impaired in the adipose tissue of 3-week-old Lepob/ob mice (Kaplan & Leveille 1981). These findings and the present results indicate that the absence of leptin action starts to induce significant metabolic consequences in mice around the end of the second week of age.

Our findings are in accordance with a previous study that showed the lack of effect of exogenous leptin injections on the bodyweight of suckling mice (Mistry et al. 1999). However, while we observed a significant acute reduction in food intake in leptin-injected 10-day-old mice, Mistry (1999) did not observe significant changes in food intake after leptin injection in 17-day-old WT mice or Lepob/ob mice. Methodological differences may explain these divergent findings since we assessed food intake indirectly through changes in body weight after suckling, whereas Mistry (1999) evaluated the intake of a powdered stock diet. Despite this divergence, it seems that exogenous leptin treatment in suckling mice produces metabolic changes that are more difficult to detect in comparison with adult animals. Nevertheless, we observed that leptin treatment between P10 and P22 induced an earlier vaginal opening, which is in accordance with previous studies that treated 3-week-old mice with leptin and observed puberty advancement (Ahima et al. 1997, Chehab et al. 1997). However, given the fact that we did not determine additional reproductive parameters, like first estrous or sex hormone levels, further experiments are necessary to confirm whether the earlier vaginal opening observed in our study is indeed associated with earlier onset of puberty.

Previous studies have already shown that suckling mice exhibit Lepr mRNA expression in several hypothalamic nuclei, and leptin is able to induce pSTAT3 in 10-day-old mice (Caron et al. 2010). In the current study, we observed an age-dependent increase in the number of LepR-expressing neurons and leptin-induced pSTAT3 cells in the hypothalamus of mice between days 7 and 16 of life. Of note, the distribution of LepR-expressing neurons and leptin-induced pSTAT3 in the hypothalamus of 16-day-old mice resembles the pattern observed in adult mice (Scott et al. 2009, Caron et al. 2010, da Silva et al. 2014, Nagaishi et al. 2014). The pattern of ARH projections to different hypothalamic nuclei is similar to that found in adult mice only around 18 days of life (Bouret et al. 2004a). Differences in the timing when responsiveness to leptin begins in different nuclei are interesting. In this regard, MPA, ARH and PMv neurons exhibit an earlier expression of LepR and/or leptin-induced pSTAT3, compared to other hypothalamic nuclei. Whether this difference has biological meaning is unknown, but all these three hypothalamic areas are associated with the regulation of onset of puberty and reproduction (Donato et al. 2011,2013 Wu et al. 2012, Bellefontaine et al. 2014, Egan et al. 2017). Thus, during development, leptin may first modulate hypothalamic neuronal populations involved in the control of neuroendocrine axes, while the appearance of neurons that regulate the energy balance may occur later.

The absence of leptin causes limited effects in the hypothalamic gene expression of 7-day-old mice. The exceptions were an increase in Agrp expression and a decrease in Crh mRNA level, both observed in male and female Lepob/ob mice. In contrast, 12-day-old Lepob/ob mice exhibit significant changes in the hypothalamic expression of several transcripts that regulate energy balance and are influenced by leptin action. Both males and females showed increased Agrp, Npy and Kiss1 mRNA levels in the hypothalamus. Since leptin exerts an inhibitory effect on AgRP/NPY neurons (Ramos-Lobo & Donato 2017), an upregulation in the hypothalamic Agrp and Npy expression is expected and observed in both adult Lepob/ob and Leprdb/db mice (Mizuno & Mobbs 1999, de Luca et al. 2005, Ramos-Lobo et al. 2019). Although adult Lepob/ob mice show reduced hypothalamic Kiss1 mRNA levels (Smith et al. 2006), we observed the opposite effect in pre-pubertal Lepob/ob mice. This contrasting result may be explained by the fact that leptin signaling in Kiss1-expressing neurons only arises after pubertal development (Cravo et al. 2013). Thus, indirect factors possibly led to the increased Kiss1 expression in the hypothalamus of 12-day-old Lepob/ob mice. Intriguingly, Pomc mRNA levels are suppressed in the hypothalamus of adult mice lacking leptin or its receptor (Schwartz et al. 1997, de Luca et al. 2005, Ramos-Lobo et al. 2019), whereas this transcript was either unchanged or increased in 12-day-old Lepob/ob mice. Therefore, POMC neurons seem to require a longer developmental time to respond to the lack of leptin than AgRP/NPY neurons. Accordingly, in 7- and 10-day-old mice, leptin-induced pSTAT3 cells are mostly observed in the ventromedial ARH, where AgRP/NPY neurons are found (Ramos-Lobo & Donato 2017), while leptin-responsive neurons in the lateral ARH, where POMC neurons are mainly distributed, are only observed in 16-day-old mice. Additionally, some evidence of sexual dimorphism was observed in the hypothalamic expression of neuropeptides during development. While 12-day-oldmale Lepob/ob mice exhibited decreased hypothalamic expression of Cartpt, Hcrt, Pmch, Nos1 and Socs3, compared to lean animals, females showed increased expression of Cartpt, Trh and Nos1. Overall, our findings indicate that leptin deficiency begins to modulate the hypothalamic expression of transcripts involved in the regulation of metabolism between the seventh and twelfth days of life.

Noteworthy, the ability of exogenous leptin to prevent fasting-induced changes in the hypothalamic expression of Agrp, Npy and Hcrt is already present in 10-day-old C57BL/6 mice. This finding suggests that the cellular machinery necessary for the response to leptin emerges early in life, even before Lepob/ob mice start to exhibit significant changes in body adiposity. Interestingly, fasting-induced changes in Nos1 and Kiss1 mRNA levels were not reversed by leptin treatment. However, in adult animals, fasting also suppresses hypothalamic Nos1 and Kiss1 expression via leptin-independent mechanisms (Donato et al. 2010, True et al. 2011). Although fasting did not affect the hypothalamic expression of Crh or Socs3, leptin-treated mice exhibited increased levels of these transcripts, compared to the other groups. Increased Socs3 mRNA levels are expected in mice treated with leptin since Socs3 expression is induced by LepR signaling (Andreoli et al. 2019, Pedroso et al. 2019). The causes of the increased hypothalamic expression of Crh in leptin-treated mice are unknown.

A remarkable observation of the present study is that male Lepob/ob mice exhibit an earlier onset of obesity, compared to female Lepob/ob mice. Although the onset of leptin’s effects is not necessarily linked to puberty timing, it is interesting that, on average, puberty begins earlier in girls than in boys (Partsch et al. 2002). Less information is available about the comparison in the timing of puberty between male and female rodents. However, the first ovulation of female rats and mice usually occurs between P35 and P45 (Nelson et al. 1990, Neill 2006), whereas spermatozoa only begin to be observed in seminiferous tubules in 45-day-old rats (Clermont & Perey 1957, Neill 2006). The onset of leptin’s effects may also be linked with changes in the development of the neural circuits that connect ARH neurons to second-order neurons. Of note, ARH neuronal projections develop during the first weeks of postnatal life (Bouret et al. 2004a). Thus, based on our results, one could expect that males would present an earlier development of ARH neuronal projections than females, given the long time it takes for them to respond to the absence of leptin. However, we observed a similar density of AgRP and POMC fibers in the PVH of 12-day-old males and females. At this age, male Lepob/ob mice are almost exhibiting differences in fat mass, whereas female Lepob/ob mice need one additional week to show increased body adiposity, compared to lean littermates. Although the development of ARH projections was not studied separately in males and females, previous studies also reported that the developmental timing of ARH projections was similar between the sexes (Bouret et al. 2004a). Therefore, the earlier onset of obesity in male Lepob/ob mice, as compared to females, cannot be explained by the timing in which ARH neuronal projections are established.

In the present study, we provided a detailed characterization of the onset of leptin’s effects on the regulation of energy balance, indicating that leptin begins to influence the metabolism in mice around the end of the second week of postnatal life. Nevertheless, the ability of exogenous leptin administration to induce changes in body weight seems to be reduced in suckling mice. We provide evidence of sexual dimorphic differences in the timing of obesity caused by the absence of leptin, in which Lepob/ob males exhibit an earlier onset of obesity compared to females. However, this sexual dimorphism cannot be explained by differences in the developmental timing of ARH neuronal projections or the hypothalamic gene expression of transcripts that control metabolism. Thus, our findings contribute to the understating of leptin functions during development.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This study was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP/Brazil; grants number: 14/11752-6 to A.M.R.L.; 16/20897-3 to F.W.; 17/21840-8 to R.F., 20/10102-9 to M.R.T. and 20/01318-8 to J.D.J.) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq/Brazil; grant number: 160186/2015-3 to P.D.S.T.). J.D.J. is an investigator of the CNPq.

Author contribution statement

P D S T, A M R L, M R T and F W performed the in vivo, molecular and histological experiments. R F performed the electrophysiological experiments. J D J designed the study. P D S T, R F and J D J analyzed the data. J D J wrote the paper. All authors revised and approved the final manuscript.

Acknowledgement

The authors thank Ana Maria P Campos for technical assistance.

References

  • Ahima RS, Prabakaran D, Mantzoros C, Qu D, Lowell B, Maratos-Flier E & Flier JS 1996 Role of leptin in the neuroendocrine response to fasting. Nature 382 250252. (https://doi.org/10.1038/382250a0)

    • Search Google Scholar
    • Export Citation
  • Ahima RS, Dushay J, Flier SN, Prabakaran D & Flier JS 1997 Leptin accelerates the onset of puberty in normal female mice. Journal of Clinical Investigation 99 391395. (https://doi.org/10.1172/JCI119172)

    • Search Google Scholar
    • Export Citation
  • Ahima RS, Bjorbaek C, Osei S & Flier JS 1999 Regulation of neuronal and glial proteins by leptin: implications for brain development. Endocrinology 140 27552762. (https://doi.org/10.1210/endo.140.6.6774)

    • Search Google Scholar
    • Export Citation
  • Andreoli MF, Donato J, Cakir I & Perello M 2019 Leptin resensitisation: a reversion of leptin-resistant states. Journal of Endocrinology 241 R81R96. (https://doi.org/10.1530/JOE-18-0606)

    • Search Google Scholar
    • Export Citation
  • Baquero AF, de Solis AJ, Lindsley SR, Kirigiti MA, Smith MS, Cowley MA, Zeltser LM & Grove KL 2014 Developmental switch of leptin signaling in arcuate nucleus neurons. Journal of Neuroscience 34 99829994. (https://doi.org/10.1523/JNEUROSCI.0933-14.2014)

    • Search Google Scholar
    • Export Citation
  • Bellefontaine N, Chachlaki K, Parkash J, Vanacker C, Colledge W, d'Anglemont de Tassigny X, Garthwaite J, Bouret SG & Prevot V 2014 Leptin-dependent neuronal NO signaling in the preoptic hypothalamus facilitates reproduction. Journal of Clinical Investigation 124 25502559. (https://doi.org/10.1172/JCI65928)

    • Search Google Scholar
    • Export Citation
  • Bohlen TM, Silveira MA, Zampieri TT, Frazao R & Donato J Jr 2016 Fatness rather than leptin sensitivity determines the timing of puberty in female mice. Molecular and Cellular Endocrinology 423 1121. (https://doi.org/10.1016/j.mce.2015.12.022)

    • Search Google Scholar
    • Export Citation
  • Bouret SG, Draper SJ & Simerly RB 2004a Formation of projection pathways from the arcuate nucleus of the hypothalamus to hypothalamic regions implicated in the neural control of feeding behavior in mice. Journal of Neuroscience 24 27972805. (https://doi.org/10.1523/JNEUROSCI.5369-03.2004)

    • Search Google Scholar
    • Export Citation
  • Bouret SG, Draper SJ & Simerly RB 2004b Trophic action of leptin on hypothalamic neurons that regulate feeding. Science 304 108110. (https://doi.org/10.1126/science.1095004)

    • Search Google Scholar
    • Export Citation
  • Buonfiglio DC, Ramos-Lobo AM, Silveira MA, Furigo IC, Hennighausen L, Frazao R & Donato J Jr 2015 Neuronal STAT5 signaling is required for maintaining lactation but not for postpartum maternal behaviors in mice. Hormones and Behavior 71 6068. (https://doi.org/10.1016/j.yhbeh.2015.04.004)

    • Search Google Scholar
    • Export Citation
  • Buonfiglio DC, Ramos-Lobo AM, Freitas VM, Zampieri TT, Nagaishi VS, Magalhaes M, Cipolla-Neto J, Cella N & Donato J Jr 2016 Obesity impairs lactation performance in mice by inducing prolactin resistance. Scientific Reports 6 22421. (https://doi.org/10.1038/srep22421)

    • Search Google Scholar
    • Export Citation
  • Campfield LA, Smith FJ, Guisez Y, Devos R & Burn P 1995 Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269 546549. (https://doi.org/10.1126/science.7624778)

    • Search Google Scholar
    • Export Citation
  • Campos AMP, Teixeira PDS, Wasinski F, Klein MO, Bittencourt JC, Metzger M & Donato J Jr 2020 Differences between rats and mice in the leptin action on the paraventricular nucleus of the hypothalamus: implications for the regulation of the hypothalamic-pituitary-thyroid axis. Journal of Neuroendocrinology 32 e12895. (https://doi.org/10.1111/jne.12895)

    • Search Google Scholar
    • Export Citation
  • Caron E, Sachot C, Prevot V & Bouret SG 2010 Distribution of leptin-sensitive cells in the postnatal and adult mouse brain. Journal of Comparative Neurology 518 459476. (https://doi.org/10.1002/cne.22219)

    • Search Google Scholar
    • Export Citation
  • Chehab FF, Mounzih K, Lu R & Lim ME 1997 Early onset of reproductive function in normal female mice treated with leptin. Science 275 8890. (https://doi.org/10.1126/science.275.5296.88)

    • Search Google Scholar
    • Export Citation
  • Clermont Y & Perey B 1957 Quantitative study of the cell population of the seminiferous tubules in immature rats. American Journal of Anatomy 100 241267. (https://doi.org/10.1002/aja.1001000205)

    • Search Google Scholar
    • Export Citation
  • Cravo RM, Frazao R, Perello M, Osborne-Lawrence S, Williams KW, Zigman JM, Vianna C & Elias CF 2013 Leptin signaling in Kiss1 neurons arises after pubertal development. PLoS ONE 8 e58698. (https://doi.org/10.1371/journal.pone.0058698)

    • Search Google Scholar
    • Export Citation
  • da Silva RP, Zampieri TT, Pedroso JA, Nagaishi VS, Ramos-Lobo AM, Furigo IC, Camara NO, Frazao R & Donato J Jr 2014 Leptin resistance is not the primary cause of weight gain associated with reduced sex hormone levels in female mice. Endocrinology 155 42264236. (https://doi.org/10.1210/en.2014-1276)

    • Search Google Scholar
    • Export Citation
  • de Luca C, Kowalski TJ, Zhang Y, Elmquist JK, Lee C, Kilimann MW, Ludwig T, Liu SM & Chua SC Jr 2005 Complete rescue of obesity, diabetes, and infertility in db/db mice by neuron-specific LEPR-B transgenes. Journal of Clinical Investigation 115 34843493. (https://doi.org/10.1172/JCI24059)

    • Search Google Scholar
    • Export Citation
  • Donahue LR & Beamer WG 1993 Growth hormone deficiency in 'little' mice results in aberrant body composition, reduced insulin-like growth factor-I and insulin-like growth factor-binding protein-3 (IGFBP-3), but does not affect IGFBP-2, -1 or -4. Journal of Endocrinology 136 91104. (https://doi.org/10.1677/joe.0.1360091)

    • Search Google Scholar
    • Export Citation
  • Donato J Jr, Frazao R, Fukuda M, Vianna CR & Elias CF 2010 Leptin induces phosphorylation of neuronal nitric oxide synthase in defined hypothalamic neurons. Endocrinology 151 54155427. (https://doi.org/10.1210/en.2010-0651)

    • Search Google Scholar
    • Export Citation
  • Donato J Jr, Cravo RM, Frazão R, Gautron L, Scott MM, Lachey J, Castro IA, Margatho LO, Lee S & Lee C et al.2011 Leptin’s effect on puberty in mice is relayed by the ventral premammillary nucleus and does not require signaling in Kiss1 neurons. Journal of Clinical Investigation 121 355368. (https://doi.org/10.1172/JCI45106)

    • Search Google Scholar
    • Export Citation
  • Donato J Jr, Lee C, Ratra DV, Franci CR, Canteras NS & Elias CF 2013 Lesions of the ventral premammillary nucleus disrupt the dynamic changes in Kiss1 and GnRH expression characteristic of the proestrus-estrus transition. Neuroscience 241 6779. (https://doi.org/10.1016/j.neuroscience.2013.03.013)

    • Search Google Scholar
    • Export Citation
  • Dubuc PU 1976 The development of obesity, hyperinsulinemia, and hyperglycemia in ob/ob mice. Metabolism: Clinical and Experimental 25 15671574. (https://doi.org/10.1016/0026-0495(7690109-8)

    • Search Google Scholar
    • Export Citation
  • Egan OK, Inglis MA & Anderson GM 2017 Leptin signaling in AgRP neurons modulates puberty onset and adult fertility in mice. Journal of Neuroscience 37 38753886. (https://doi.org/10.1523/JNEUROSCI.3138-16.2017)

    • Search Google Scholar
    • Export Citation
  • Garcia-Galiano D, Cara AL, Tata Z, Allen SJ, Myers MG Jr, Schipani E & Elias CF 2020 ERalpha signaling in GHRH/Kiss1 dual phenotype neurons plays sex-specific roles in growth and puberty. Journal of Neuroscience 40 94559466. (https://doi.org/10.1523/JNEUROSCI.2069-20.2020)

    • Search Google Scholar
    • Export Citation
  • Godbole VY, Grundleger ML & Thenen SW 1980 Early development of lipogenesis in genetically obese (ob/ob) mice. American Journal of Physiology 239 E265E268. (https://doi.org/10.1152/ajpendo.1980.239.4.E265)

    • Search Google Scholar
    • Export Citation
  • Goodbody AE & Trayhurn P 1982 Studies on the activity of brown adipose tissue in suckling, pre-obese, ob/ob mice. Biochimica et Biophysica Acta 680 119126. (https://doi.org/10.1016/0005-2728(8290002-0)

    • Search Google Scholar
    • Export Citation
  • Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK & Friedman JM 1995 Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269 543546. (https://doi.org/10.1126/science.7624777)

    • Search Google Scholar
    • Export Citation
  • Hull D & Vinter J 1984 The development of cold-induced thermogenesis and the structure of brown adipocyte mitochondria in genetically-obese (ob/ob) mice. British Journal of Nutrition 52 3339. (https://doi.org/10.1079/bjn19840068)

    • Search Google Scholar
    • Export Citation
  • Huvenne H, Le Beyec J, Pepin D, Alili R, Kherchiche PP, Jeannic E, Frelut ML, Lacorte JM, Nicolino M & Viard A et al.2015 Seven novel deleterious LEPR mutations found in early-onset obesity: a DeltaExon6-8 shared by subjects from Reunion Island, France, suggests a founder effect. Journal of Clinical Endocrinology and Metabolism 100 E757E766. (https://doi.org/10.1210/jc.2015-1036)

    • Search Google Scholar
    • Export Citation
  • Kaplan ML & Leveille GA 1981 Development of lipogenesis and insulin sensitivity in tissues of the ob/ob mouse. American Journal of Physiology 240 E101E 107. (https://doi.org/10.1152/ajpendo.1981.240.2.E101)

    • Search Google Scholar
    • Export Citation
  • Larson BA, Sinha YN & Vanderlaan WP 1976 Serum growth hormone and prolactin during and after the development of the obese-hyperglycemic syndrome in mice. Endocrinology 98 139145. (https://doi.org/10.1210/endo-98-1-139)

    • Search Google Scholar
    • Export Citation
  • Mistry AM, Swick A & Romsos DR 1999 Leptin alters metabolic rates before acquisition of its anorectic effect in developing neonatal mice. Am J Physiol-Reg I 277 R742R747. (https://doi.org/10.1152/ajpregu.1999.277.3.R742)

    • Search Google Scholar
    • Export Citation
  • Mizuno TM & Mobbs CV 1999 Hypothalamic agouti-related protein messenger ribonucleic acid is inhibited by leptin and stimulated by fasting. Endocrinology 140 814817. (https://doi.org/10.1210/endo.140.2.6491)

    • Search Google Scholar
    • Export Citation
  • Nagaishi VS, Cardinali LI, Zampieri TT, Furigo IC, Metzger M & Donato J Jr 2014 Possible crosstalk between leptin and prolactin during pregnancy. Neuroscience 259 7183 (https://doi.org/10.1016/j.neuroscience.2013.11.050)

    • Search Google Scholar
    • Export Citation
  • Neill JD 2006 Knobil and Neill's Physiology of Reprodution. St. Louis: Elsevier Academic Press.

  • Nelson JF, Karelus K, Felicio LS & Johnson TE 1990 Genetic influences on the timing of puberty in mice. Biology of Reproduction 42 649655. (https://doi.org/10.1095/biolreprod42.4.649)

    • Search Google Scholar
    • Export Citation
  • Partsch CJ, Heger S & Sippell WG 2002 Management and outcome of central precocious puberty. Clinical Endocrinology 56 129148. (https://doi.org/10.1046/j.0300-0664.2001.01490.x)

    • Search Google Scholar
    • Export Citation
  • Pedroso JAB, Ramos-Lobo AM & Donato J Jr 2019 SOCS3 as a future target to treat metabolic disorders. Hormones 18 127136. (https://doi.org/10.1007/s42000-018-0078-5)

    • Search Google Scholar
    • Export Citation
  • Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T & Collins F 1995 Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269 540543. (https://doi.org/10.1126/science.7624776)

    • Search Google Scholar
    • Export Citation
  • Ramos-Lobo AM & Donato J Jr 2017 The role of leptin in health and disease. Temperature 4 258291. (https://doi.org/10.1080/23328940.2017.1327003)

    • Search Google Scholar
    • Export Citation
  • Ramos-Lobo AM, Furigo IC, Teixeira PDS, Zampieri TT, Wasinski F, Buonfiglio DC & Donato J Jr 2018 Maternal metabolic adaptations are necessary for normal offspring growth and brain development. Physiological Reports 6. (https://doi.org/10.14814/phy2.13643)

    • Search Google Scholar
    • Export Citation
  • Ramos-Lobo AM, Teixeira PD, Furigo IC, Melo HM, de M Lyra E Silva N, De Felice FG & Donato J Jr 2019 Long-term consequences of the absence of leptin signaling in early life. eLife 8 e40970. (https://doi.org/10.7554/eLife.40970)

    • Search Google Scholar
    • Export Citation
  • Ring LE & Zeltser LM 2010 Disruption of hypothalamic leptin signaling in mice leads to early-onset obesity, but physiological adaptations in mature animals stabilize adiposity levels. Journal of Clinical Investigation 120 29312941. (https://doi.org/10.1172/JCI41985)

    • Search Google Scholar
    • Export Citation
  • Schwartz MW, Seeley RJ, Woods SC, Weigle DS, Campfield LA, Burn P & Baskin DG 1997 Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes 46 21192123. (https://doi.org/10.2337/diab.46.12.2119)

    • Search Google Scholar
    • Export Citation
  • Scott MM, Lachey JL, Sternson SM, Lee CE, Elias CF, Friedman JM & Elmquist JK 2009 Leptin targets in the mouse brain. Journal of Comparative Neurology 514 518532. (https://doi.org/10.1002/cne.22025)

    • Search Google Scholar
    • Export Citation
  • Silveira MA, Furigo IC, Zampieri TT, Bohlen TM, de Paula DG, Franci CR, Donato J Jr & Frazao R 2017 STAT5 signaling in kisspeptin cells regulates the timing of puberty. Molecular and Cellular Endocrinology 448 5565. (https://doi.org/10.1016/j.mce.2017.03.024)

    • Search Google Scholar
    • Export Citation
  • Smith JT, Acohido BV, Clifton DK & Steiner RA 2006 KiSS-1 neurones are direct targets for leptin in the ob/ob mouse. Journal of Neuroendocrinology 18 298303. (https://doi.org/10.1111/j.1365-2826.2006.01417.x)

    • Search Google Scholar
    • Export Citation
  • Trayhurn P & Fuller L 1980 The development of obesity in genetically diabetic-obese (db/db) mice pair-fed with lean siblings. The importance of thermoregulatory thermogenesis. Diabetologia 19 148153. (https://doi.org/10.1007/BF00421862)

    • Search Google Scholar
    • Export Citation
  • True C, Kirigiti MA, Kievit P, Grove KL & Smith MS 2011 Leptin is not the critical signal for kisspeptin or luteinising hormone restoration during exit from negative energy balance. Journal of Neuroendocrinology 23 10991112. (https://doi.org/10.1111/j.1365-2826.2011.02144.x)

    • Search Google Scholar
    • Export Citation
  • Veldhuis JD, Roemmich JN, Richmond EJ & Bowers CY 2006 Somatotropic and gonadotropic axes linkages in infancy, childhood, and the puberty-adult transition. Endocrine Reviews 27 101140. (https://doi.org/10.1210/er.2005-0006)

    • Search Google Scholar
    • Export Citation
  • Wu Q, Whiddon BB & Palmiter RD 2012 Ablation of neurons expressing agouti-related protein, but not melanin concentrating hormone, in leptin-deficient mice restores metabolic functions and fertility. PNAS 109 31553160. (https://doi.org/10.1073/pnas.1120501109)

    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • View in gallery
    Figure 1

    Absence of leptin induces obesity in mice between the second and third week of life. (A, B, C, D, E, F) Changes in body weight (A and B), body fat mass (C and D) and lean body mass (E and F) in male (A, C, E) and female (B, D, F) Lepob/ob and WT mice. Body weight and composition were determined three times per week from birth until 6 weeks of life (n = 18–28/group). *Significant difference (P < 0.05) between WT and Lepob/ob mice.

  • View in gallery
    Figure 2

    Chronic leptin treatment does not affect the body weight of suckling mice, although it causes earlier vaginal opening. (A, B, C) Body weight changes in 10-day-old C57BL/6 male mice (A; n = 9–11/group), 10-day-old C57BL/6 female mice (B; n = 8–12/group) and 45-day-old C57BL/6 male mice (C; n = 7/group) that received daily injections of leptin for 12 days. (D). Average days required for PBS-treated (n = 8) or leptin-treated (n = 12) female mice to exhibit vaginal opening. Mice received daily injections from P10 to P22. *Significantly different (P < 0.05) compared to PBS-treated mice.

  • View in gallery
    Figure 3

    Acute anorexigenic effect of leptin in suckling mice. (A and B) Changes in body weight in 7-day-old (A; n = 6) or 10-day-old (B; n = 7) C57BL/6 mice 2 and 5 h after an acute injection of PBS and leptin. The effects of leptin on feeding were indirectly evaluated through the weight gain in pups that had been separated from their mothers for 4 h before the test. *P = 0.0493, effect of leptin (two-way ANOVA).

  • View in gallery
    Figure 4

    Temporal characterization of the leptin receptor expression in the hypothalamus of young mice. (A, B, C, D, E, F, G, H, I, J, K and L) Representative photomicrographs showing the expression of the tdTomato reporter protein in the hypothalamus of mice at 7 (P7), 10 (P10) and 16 (P16) days of life. Abbreviations: 3V, third ventricle; OVLT, organum vasculosum lamina terminalis. Scale bar = 200 µm.

  • View in gallery
    Figure 5

    Temporal characterization in the capacity of leptin to induce pSTAT3 in the hypothalamus of young mice. (A, B, C, D, E, F, G, H, I, J, K and L) Representative photomicrographs showing the pSTAT3 induced by a s.c. leptin injection in the hypothalamus of C57BL/6 mice at 7 (P7), 10 (P10) and 16 (P16) days of life. Abbreviations: 3V, third ventricle; OVLT, organum vasculosum lamina terminalis. Scale bar = 200 µm. (M) Example of a current-clamp recording of a LepR-expressing neuron that exhibited a hyperpolarization after application of leptin. Dashed line indicates the resting membrane potential (RMP) before leptin treatment. (N) Changes in the RMP induced by leptin in LepR-expressing neurons of the ARH and PMv in 8 to 16-day-old LepR-reporter male mice.

  • View in gallery
    Figure 6

    Hypothalamic expression of several transcripts involved in the energy balance regulation is already altered in pre-obese Lepob/ob mice. (A) Hypothalamic gene expression in 7-day-old (P7) WT (n = 5–8) and Lepob/ob (n = 2–7) male and female mice. (B) Hypothalamic gene expression in 12-day-old (P12) WT (n = 7–8) and Lepob/ob (n = 4–7) male and female mice. *Significant difference (P < 0.05) between WT and Lepob/ob mice.

  • View in gallery
    Figure 7

    Leptin treatment prevents fasting-induced changes in the expression of several hypothalamic transcripts involved in energy-balance regulation. Hypothalamic gene expression in PBS-treated fed (n = 10), PBS-treated fasted (n = 11) and leptin-treated fasted (n = 12) 10-day-old WT mice. *Significantly different (P < 0.05) compared to Fed + PBS group. #Significantly different (P < 0.05) compared to Fasted + PBS group.

  • View in gallery
    Figure 8

    Male and female C57BL/6 or Lepob/ob mice show similar developmental timing of neural projections of arcuate nucleus neurons. (A, B and C) Quantification of the AgRP innervation density in the paraventricular nucleus of the hypothalamus (PVH) of 12-day-old male (n = 5) and female (n = 6) C57BL/6 WT mice. (D, E and F) Quantification of the POMC innervation density in the PVH of 12-day-old male (n = 5) and female (n = 7) C57BL/6 WT mice. (G, H and I) Quantification of the AgRP innervation density in the PVH of 12-day-old male (n = 5) and female (n = 5) Lepob/ob mice. (J, K and L) Quantification of the POMC innervation density in the PVH of 12-day-old male (n = 4) and female (n = 5) Lepob/ob mice. Scale bar = 200 µm.

  • Ahima RS, Prabakaran D, Mantzoros C, Qu D, Lowell B, Maratos-Flier E & Flier JS 1996 Role of leptin in the neuroendocrine response to fasting. Nature 382 250252. (https://doi.org/10.1038/382250a0)

    • Search Google Scholar
    • Export Citation
  • Ahima RS, Dushay J, Flier SN, Prabakaran D & Flier JS 1997 Leptin accelerates the onset of puberty in normal female mice. Journal of Clinical Investigation 99 391395. (https://doi.org/10.1172/JCI119172)

    • Search Google Scholar
    • Export Citation
  • Ahima RS, Bjorbaek C, Osei S & Flier JS 1999 Regulation of neuronal and glial proteins by leptin: implications for brain development. Endocrinology 140 27552762. (https://doi.org/10.1210/endo.140.6.6774)

    • Search Google Scholar
    • Export Citation
  • Andreoli MF, Donato J, Cakir I & Perello M 2019 Leptin resensitisation: a reversion of leptin-resistant states. Journal of Endocrinology 241 R81R96. (https://doi.org/10.1530/JOE-18-0606)

    • Search Google Scholar
    • Export Citation
  • Baquero AF, de Solis AJ, Lindsley SR, Kirigiti MA, Smith MS, Cowley MA, Zeltser LM & Grove KL 2014 Developmental switch of leptin signaling in arcuate nucleus neurons. Journal of Neuroscience 34 99829994. (https://doi.org/10.1523/JNEUROSCI.0933-14.2014)

    • Search Google Scholar
    • Export Citation
  • Bellefontaine N, Chachlaki K, Parkash J, Vanacker C, Colledge W, d'Anglemont de Tassigny X, Garthwaite J, Bouret SG & Prevot V 2014 Leptin-dependent neuronal NO signaling in the preoptic hypothalamus facilitates reproduction. Journal of Clinical Investigation 124 25502559. (https://doi.org/10.1172/JCI65928)

    • Search Google Scholar
    • Export Citation
  • Bohlen TM, Silveira MA, Zampieri TT, Frazao R & Donato J Jr 2016 Fatness rather than leptin sensitivity determines the timing of puberty in female mice. Molecular and Cellular Endocrinology 423 1121. (https://doi.org/10.1016/j.mce.2015.12.022)

    • Search Google Scholar
    • Export Citation
  • Bouret SG, Draper SJ & Simerly RB 2004a Formation of projection pathways from the arcuate nucleus of the hypothalamus to hypothalamic regions implicated in the neural control of feeding behavior in mice. Journal of Neuroscience 24 27972805. (https://doi.org/10.1523/JNEUROSCI.5369-03.2004)

    • Search Google Scholar
    • Export Citation
  • Bouret SG, Draper SJ & Simerly RB 2004b Trophic action of leptin on hypothalamic neurons that regulate feeding. Science 304 108110. (https://doi.org/10.1126/science.1095004)

    • Search Google Scholar
    • Export Citation
  • Buonfiglio DC, Ramos-Lobo AM, Silveira MA, Furigo IC, Hennighausen L, Frazao R & Donato J Jr 2015 Neuronal STAT5 signaling is required for maintaining lactation but not for postpartum maternal behaviors in mice. Hormones and Behavior 71 6068. (https://doi.org/10.1016/j.yhbeh.2015.04.004)

    • Search Google Scholar
    • Export Citation
  • Buonfiglio DC, Ramos-Lobo AM, Freitas VM, Zampieri TT, Nagaishi VS, Magalhaes M, Cipolla-Neto J, Cella N & Donato J Jr 2016 Obesity impairs lactation performance in mice by inducing prolactin resistance. Scientific Reports 6 22421. (https://doi.org/10.1038/srep22421)

    • Search Google Scholar
    • Export Citation
  • Campfield LA, Smith FJ, Guisez Y, Devos R & Burn P 1995 Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269 546549. (https://doi.org/10.1126/science.7624778)

    • Search Google Scholar
    • Export Citation
  • Campos AMP, Teixeira PDS, Wasinski F, Klein MO, Bittencourt JC, Metzger M & Donato J Jr 2020 Differences between rats and mice in the leptin action on the paraventricular nucleus of the hypothalamus: implications for the regulation of the hypothalamic-pituitary-thyroid axis. Journal of Neuroendocrinology 32 e12895. (https://doi.org/10.1111/jne.12895)

    • Search Google Scholar
    • Export Citation
  • Caron E, Sachot C, Prevot V & Bouret SG 2010 Distribution of leptin-sensitive cells in the postnatal and adult mouse brain. Journal of Comparative Neurology 518 459476. (https://doi.org/10.1002/cne.22219)

    • Search Google Scholar
    • Export Citation
  • Chehab FF, Mounzih K, Lu R & Lim ME 1997 Early onset of reproductive function in normal female mice treated with leptin. Science 275 8890. (https://doi.org/10.1126/science.275.5296.88)

    • Search Google Scholar
    • Export Citation
  • Clermont Y & Perey B 1957 Quantitative study of the cell population of the seminiferous tubules in immature rats. American Journal of Anatomy 100 241267. (https://doi.org/10.1002/aja.1001000205)

    • Search Google Scholar
    • Export Citation
  • Cravo RM, Frazao R, Perello M, Osborne-Lawrence S, Williams KW, Zigman JM, Vianna C & Elias CF 2013 Leptin signaling in Kiss1 neurons arises after pubertal development. PLoS ONE 8 e58698. (https://doi.org/10.1371/journal.pone.0058698)

    • Search Google Scholar
    • Export Citation
  • da Silva RP, Zampieri TT, Pedroso JA, Nagaishi VS, Ramos-Lobo AM, Furigo IC, Camara NO, Frazao R & Donato J Jr 2014 Leptin resistance is not the primary cause of weight gain associated with reduced sex hormone levels in female mice. Endocrinology 155 42264236. (https://doi.org/10.1210/en.2014-1276)

    • Search Google Scholar
    • Export Citation
  • de Luca C, Kowalski TJ, Zhang Y, Elmquist JK, Lee C, Kilimann MW, Ludwig T, Liu SM & Chua SC Jr 2005 Complete rescue of obesity, diabetes, and infertility in db/db mice by neuron-specific LEPR-B transgenes. Journal of Clinical Investigation 115 34843493. (https://doi.org/10.1172/JCI24059)

    • Search Google Scholar
    • Export Citation
  • Donahue LR & Beamer WG 1993 Growth hormone deficiency in 'little' mice results in aberrant body composition, reduced insulin-like growth factor-I and insulin-like growth factor-binding protein-3 (IGFBP-3), but does not affect IGFBP-2, -1 or -4. Journal of Endocrinology 136 91104. (https://doi.org/10.1677/joe.0.1360091)

    • Search Google Scholar
    • Export Citation
  • Donato J Jr, Frazao R, Fukuda M, Vianna CR & Elias CF 2010 Leptin induces phosphorylation of neuronal nitric oxide synthase in defined hypothalamic neurons. Endocrinology 151 54155427. (https://doi.org/10.1210/en.2010-0651)

    • Search Google Scholar
    • Export Citation
  • Donato J Jr, Cravo RM, Frazão R, Gautron L, Scott MM, Lachey J, Castro IA, Margatho LO, Lee S & Lee C et al.2011 Leptin’s effect on puberty in mice is relayed by the ventral premammillary nucleus and does not require signaling in Kiss1 neurons. Journal of Clinical Investigation 121 355368. (https://doi.org/10.1172/JCI45106)

    • Search Google Scholar
    • Export Citation
  • Donato J Jr, Lee C, Ratra DV, Franci CR, Canteras NS & Elias CF 2013 Lesions of the ventral premammillary nucleus disrupt the dynamic changes in Kiss1 and GnRH expression characteristic of the proestrus-estrus transition. Neuroscience 241 6779. (https://doi.org/10.1016/j.neuroscience.2013.03.013)

    • Search Google Scholar
    • Export Citation
  • Dubuc PU 1976 The development of obesity, hyperinsulinemia, and hyperglycemia in ob/ob mice. Metabolism: Clinical and Experimental 25 15671574. (https://doi.org/10.1016/0026-0495(7690109-8)

    • Search Google Scholar
    • Export Citation
  • Egan OK, Inglis MA & Anderson GM 2017 Leptin signaling in AgRP neurons modulates puberty onset and adult fertility in mice. Journal of Neuroscience 37 38753886. (https://doi.org/10.1523/JNEUROSCI.3138-16.2017)

    • Search Google Scholar
    • Export Citation
  • Garcia-Galiano D, Cara AL, Tata Z, Allen SJ, Myers MG Jr, Schipani E & Elias CF 2020 ERalpha signaling in GHRH/Kiss1 dual phenotype neurons plays sex-specific roles in growth and puberty. Journal of Neuroscience 40 94559466. (https://doi.org/10.1523/JNEUROSCI.2069-20.2020)

    • Search Google Scholar
    • Export Citation
  • Godbole VY, Grundleger ML & Thenen SW 1980 Early development of lipogenesis in genetically obese (ob/ob) mice. American Journal of Physiology 239 E265E268. (https://doi.org/10.1152/ajpendo.1980.239.4.E265)

    • Search Google Scholar
    • Export Citation
  • Goodbody AE & Trayhurn P 1982 Studies on the activity of brown adipose tissue in suckling, pre-obese, ob/ob mice. Biochimica et Biophysica Acta 680 119126. (https://doi.org/10.1016/0005-2728(8290002-0)

    • Search Google Scholar
    • Export Citation
  • Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK & Friedman JM 1995 Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269 543546. (https://doi.org/10.1126/science.7624777)

    • Search Google Scholar
    • Export Citation
  • Hull D & Vinter J 1984 The development of cold-induced thermogenesis and the structure of brown adipocyte mitochondria in genetically-obese (ob/ob) mice. British Journal of Nutrition 52 3339. (https://doi.org/10.1079/bjn19840068)

    • Search Google Scholar
    • Export Citation
  • Huvenne H, Le Beyec J, Pepin D, Alili R, Kherchiche PP, Jeannic E, Frelut ML, Lacorte JM, Nicolino M & Viard A et al.2015 Seven novel deleterious LEPR mutations found in early-onset obesity: a DeltaExon6-8 shared by subjects from Reunion Island, France, suggests a founder effect. Journal of Clinical Endocrinology and Metabolism 100 E757E766. (https://doi.org/10.1210/jc.2015-1036)

    • Search Google Scholar
    • Export Citation
  • Kaplan ML & Leveille GA 1981 Development of lipogenesis and insulin sensitivity in tissues of the ob/ob mouse. American Journal of Physiology 240 E101E 107. (https://doi.org/10.1152/ajpendo.1981.240.2.E101)

    • Search Google Scholar
    • Export Citation
  • Larson BA, Sinha YN & Vanderlaan WP 1976 Serum growth hormone and prolactin during and after the development of the obese-hyperglycemic syndrome in mice. Endocrinology 98 139145. (https://doi.org/10.1210/endo-98-1-139)

    • Search Google Scholar
    • Export Citation
  • Mistry AM, Swick A & Romsos DR 1999 Leptin alters metabolic rates before acquisition of its anorectic effect in developing neonatal mice. Am J Physiol-Reg I 277 R742R747. (https://doi.org/10.1152/ajpregu.1999.277.3.R742)

    • Search Google Scholar
    • Export Citation
  • Mizuno TM & Mobbs CV 1999 Hypothalamic agouti-related protein messenger ribonucleic acid is inhibited by leptin and stimulated by fasting. Endocrinology 140 814817. (https://doi.org/10.1210/endo.140.2.6491)

    • Search Google Scholar
    • Export Citation
  • Nagaishi VS, Cardinali LI, Zampieri TT, Furigo IC, Metzger M & Donato J Jr 2014 Possible crosstalk between leptin and prolactin during pregnancy. Neuroscience 259 7183 (https://doi.org/10.1016/j.neuroscience.2013.11.050)

    • Search Google Scholar
    • Export Citation
  • Neill JD 2006 Knobil and Neill's Physiology of Reprodution. St. Louis: Elsevier Academic Press.

  • Nelson JF, Karelus K, Felicio LS & Johnson TE 1990 Genetic influences on the timing of puberty in mice. Biology of Reproduction 42 649655. (https://doi.org/10.1095/biolreprod42.4.649)

    • Search Google Scholar
    • Export Citation
  • Partsch CJ, Heger S & Sippell WG 2002 Management and outcome of central precocious puberty. Clinical Endocrinology 56 129148. (https://doi.org/10.1046/j.0300-0664.2001.01490.x)

    • Search Google Scholar
    • Export Citation
  • Pedroso JAB, Ramos-Lobo AM & Donato J Jr 2019 SOCS3 as a future target to treat metabolic disorders. Hormones 18 127136. (https://doi.org/10.1007/s42000-018-0078-5)

    • Search Google Scholar
    • Export Citation
  • Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T & Collins F 1995 Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269 540543. (https://doi.org/10.1126/science.7624776)

    • Search Google Scholar
    • Export Citation
  • Ramos-Lobo AM & Donato J Jr 2017 The role of leptin in health and disease. Temperature 4 258291. (https://doi.org/10.1080/23328940.2017.1327003)

    • Search Google Scholar
    • Export Citation
  • Ramos-Lobo AM, Furigo IC, Teixeira PDS, Zampieri TT, Wasinski F, Buonfiglio DC & Donato J Jr 2018 Maternal metabolic adaptations are necessary for normal offspring growth and brain development. Physiological Reports 6. (https://doi.org/10.14814/phy2.13643)

    • Search Google Scholar
    • Export Citation
  • Ramos-Lobo AM, Teixeira PD, Furigo IC, Melo HM, de M Lyra E Silva N, De Felice FG & Donato J Jr 2019 Long-term consequences of the absence of leptin signaling in early life. eLife 8 e40970. (https://doi.org/10.7554/eLife.40970)

    • Search Google Scholar
    • Export Citation
  • Ring LE & Zeltser LM 2010 Disruption of hypothalamic leptin signaling in mice leads to early-onset obesity, but physiological adaptations in mature animals stabilize adiposity levels. Journal of Clinical Investigation 120 29312941. (https://doi.org/10.1172/JCI41985)

    • Search Google Scholar
    • Export Citation
  • Schwartz MW, Seeley RJ, Woods SC, Weigle DS, Campfield LA, Burn P & Baskin DG 1997 Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes 46 21192123. (https://doi.org/10.2337/diab.46.12.2119)

    • Search Google Scholar
    • Export Citation
  • Scott MM, Lachey JL, Sternson SM, Lee CE, Elias CF, Friedman JM & Elmquist JK 2009 Leptin targets in the mouse brain. Journal of Comparative Neurology 514 518532. (https://doi.org/10.1002/cne.22025)

    • Search Google Scholar
    • Export Citation
  • Silveira MA, Furigo IC, Zampieri TT, Bohlen TM, de Paula DG, Franci CR, Donato J Jr & Frazao R 2017 STAT5 signaling in kisspeptin cells regulates the timing of puberty. Molecular and Cellular Endocrinology 448 5565. (https://doi.org/10.1016/j.mce.2017.03.024)

    • Search Google Scholar
    • Export Citation
  • Smith JT, Acohido BV, Clifton DK & Steiner RA 2006 KiSS-1 neurones are direct targets for leptin in the ob/ob mouse. Journal of Neuroendocrinology 18 298303. (https://doi.org/10.1111/j.1365-2826.2006.01417.x)

    • Search Google Scholar
    • Export Citation
  • Trayhurn P & Fuller L 1980 The development of obesity in genetically diabetic-obese (db/db) mice pair-fed with lean siblings. The importance of thermoregulatory thermogenesis. Diabetologia 19 148153. (https://doi.org/10.1007/BF00421862)

    • Search Google Scholar
    • Export Citation
  • True C, Kirigiti MA, Kievit P, Grove KL & Smith MS 2011 Leptin is not the critical signal for kisspeptin or luteinising hormone restoration during exit from negative energy balance. Journal of Neuroendocrinology 23 10991112. (https://doi.org/10.1111/j.1365-2826.2011.02144.x)

    • Search Google Scholar
    • Export Citation
  • Veldhuis JD, Roemmich JN, Richmond EJ & Bowers CY 2006 Somatotropic and gonadotropic axes linkages in infancy, childhood, and the puberty-adult transition. Endocrine Reviews 27 101140. (https://doi.org/10.1210/er.2005-0006)

    • Search Google Scholar
    • Export Citation
  • Wu Q, Whiddon BB & Palmiter RD 2012 Ablation of neurons expressing agouti-related protein, but not melanin concentrating hormone, in leptin-deficient mice restores metabolic functions and fertility. PNAS 109 31553160. (https://doi.org/10.1073/pnas.1120501109)

    • Search Google Scholar
    • Export Citation