Abstract
Brown adipose tissue (BAT) burns substantial amounts of mainly lipids to produce heat. Some studies indicate that BAT activity and core body temperature are lower in males than females. Here we investigated the role of testosterone and its receptor (the androgen receptor; AR) in metabolic BAT activity in male mice. Castration, which renders mice testosterone deficient, slightly promoted the expression of thermogenic markers in BAT, decreased BAT lipid content, and increased basal lipolysis in isolated brown adipocytes. Further, castration increased the core body temperature. Triglyceride-derived fatty acid uptake, a proxy for metabolic BAT activity in vivo, was strongly increased in BAT from castrated mice (4.5-fold increase vs sham-castrated mice) and testosterone replacement reversed the castration-induced increase in metabolic BAT activity. BAT-specific AR deficiency did not mimic the castration effects in vivo and AR agonist treatment did not diminish the activity of cultured brown adipocytes in vitro, suggesting that androgens do not modulate BAT activity via a direct, AR-mediated pathway. In conclusion, testosterone is a negative regulator of metabolic BAT activity in male mice. Our findings provide new insight into the metabolic actions of testosterone.
Introduction
Maintenance of core body temperature is crucial for cellular function and organism survival. Yet, homeostatic body temperature shows certain variation, even within species. For example, body temperature is affected by sex; female mice have an overall higher body temperature than male mice (Sanchez-Alavez et al. 2011). Brown adipose tissue (BAT) is the major site for non-shivering thermogenesis (Morrison 2016), generating heat by oxidation of intracellular lipid stores and uncoupling mitochondrial respiration. Like body temperature, BAT activity may be affected by sex, and most, but not all, human studies report lower BAT activity as assessed by [18F]fluorodeoxyglucose uptake in men compared to women (Pfannenberg et al. 2010, Ouellet et al. 2011, van der Lans et al. 2013, Dinas et al. 2015, Fletcher et al. 2020, Becher et al. 2021). In a recent study, adaptive BAT temperature responses were greater in women than in men, irrespective of the stage of the menstrual cycle (Fuller-Jackson et al. 2020).
Sex hormone-mediated effects may underlie sex differences. Testosterone is the most important sex hormone in male mice with more than ten-fold lower levels in females (Nilsson et al. 2015). Castration, which renders male mice testosterone deficient, increases body temperature (Sanchez-Alavez et al. 2011, Hashimoto et al. 2016) supporting that testosterone is involved in the regulation of body temperature. However, relatively little is known about the potential role of androgens in the regulation of BAT activity and existing data are conflicting. Castration has been shown to decrease BAT weight (Movérare-Skrtic et al. 2006) and increase BAT Ucp1 mRNA expression (Hashimoto et al. 2016), suggestive of increased BAT activity (Schilperoort et al. 2018). In vitro experiments have indicated direct repressing actions of testosterone on BAT activity; one group found that testosterone treatment of brown adipocytes diminished lipolysis and downregulated thermogenic genes, such as Ucp1 and Pgc1a (Rodriguez et al. 2002, Monjo et al. 2003, Rodriguez-Cuenca et al. 2007a). BAT expresses the androgen receptor (AR) (Rodriguez-Cuenca et al. 2007b), the receptor for testosterone. AR agonist treatment increases BAT weight in vivo, which may be an indication of reduced BAT activity (Movérare-Skrtic et al. 2006). However, global AR deficiency in mice has been shown to decrease the expression of Ucp1 in BAT (Fan et al. 2005, Yanase et al. 2008). It is not known whether androgens modulate BAT activity in vivo and through which pathway(s) such an effect could be mediated.
In the current study, we aimed to clarify the role of testosterone in metabolic BAT activity. Further, we investigated potential pathways involved and addressed the question of whether the effects of castration can be mimicked by BAT-specific AR deficiency.
Material and methods
Animals
Male C57Bl/6J mice were purchased from Charles River. Male BAT-specific ARKO mice were generated by breeding AR+/flox female mice (from Dr Verhoeven, Katholieke Universiteit Leuven, Belgium) (De Gendt et al. 2004) with male Ucp1-Cre mice (B6.FVB-Tg(Ucp1-cre)1Evdr/J; Jackson Laboratories). Male mice with the genotype ARflox/Y Ucp1-Cre+/− are BAT-ARKO; littermate controls are AR+/YUcp1-Cre+/−. Littermate controls were used in all experiments. The mice were housed in a temperature- (21 ± 1°C) and humidity-controlled room with a 07:00–19:00 h light cycle and consumed a soy-free chow diet (Cat# 2019 Teklad global 19% protein extruded rodent diets, Harlan Laboratories) and tap water ad libitum. All experiments followed the Institute for Laboratory Animal Research Guide for the Care and Use of Laboratory Animals and were approved by the Ethics Committee on Animal Care and Use in Gothenburg, and the Leiden University Ethical Review Board.
Castration (orchiectomy)
Wild-type, BAT-ARKO, and control mice were anesthetized with isoflurane (IsoFlo® vet., Vnr 002185, Zoetis) and either sham-operated or bilaterally castrated/orchiectomized (ORX) at 10–11 weeks of age unless otherwise specified. Buprenorphine (Temgesic®, RB Pharmaceuticals Ltd) was used for analgesia after all surgical procedures.
Castration and testosterone replacement
Tissues were collected from mice 3 weeks after the bilateral castration or sham operation. Following the surgery, mice were subcutaneously injected at the end of the day with vehicle (pure corn oil, Cat# C8267, Sigma) or testosterone propionate (Cat#86541, Sigma,) every 3 days for 3 weeks. A working solution of testosterone (2.5–3 mg/kg/day for a 25 g mouse) was made by dissolving 45 mg of testosterone propionate in 0.4 mL of 100% ethanol and then adding 30 mL of pure corn oil.
Uptake of radiolabeled triglyceride-derived fatty acids
Glycerol tri[3H]oleate-labeled triglyceride (TG)-rich lipoprotein-like emulsion particles (80 nm) were prepared and characterized as described previously (Rensen et al. 1995). Mice were fasted for 4–6 h and intravenously injected with 200 μL of emulsion particles (1 mg TG per mouse) via the tail vein or retro-orbitally, 2 h before the onset of the dark phase. After 15 min, mice were killed by cervical dislocation and perfused with ice-cold PBS through the heart. Thereafter, organs were harvested and weighed, dissolved overnight at 56°C in Tissue Solubilizer (Amersham Biosciences) and mixed with Ultima Gold scintillation liquid (PerkinElmer). The uptake of glycerol tri[3H]oleate-derived radioactivity was quantified and expressed per organ or per gram of wet tissue weight.
Telemetry and indirect calorimetry
Telemetry devices (G2 E-mitter, MiniMitter, Bend, OR, USA) were implanted via a 1 cm incision through the skin and peritoneum. Following implantation, the peritoneum was stitched with Polysorb 5-0 suture (Covidien, Dublin, Ireland), and the skin was closed with Reflex 7 clips (CellPoint Scientific, Inc., Gaithersburg, MD, USA). The surgery was performed under 3% isoflurane (Baxter, Deerfield, IL, USA) anesthesia, and buprenorphine (Temgesic®, RB Pharmaceuticals Ltd) was administered subcutaneously for analgesia. The mice were left to recover for 1 week before the start of experiments. Oxygen consumption (VO2) was measured by indirect calorimetry in an INCA metabolic system (Somedic, Hörby, Sweden) as previously described (Wernstedt et al. 2006). The system comprises a sealed chamber with regulated airflow and temperature. It also includes sensors for the MiniMitter telemetry system, which are designed to measure core body temperature with 0.01°C accuracy and three-dimensional locomotor activities via the implanted G2 E-mitter transponders. Data were collected every minute for all variables except for VO2, which was measured every second minute, over 21 h at 20°C.
DEXA
Measurements of body composition, fat, and lean mass were performed by dual-energy x-ray absorptiometry (DEXA) using the Lunar PIXImus mouse densitometer (Wipro GE Healthcare).
Tissue collection
Mice were anesthetized, blood was drawn from the left ventricle, and the mice were perfused with saline or PBS under physiological pressure. Interscapular BAT (iBAT) and subscapular BAT (sBAT) were dissected, snap-frozen, and stored at –80°C. Interscapular BAT was also embedded in OCT and frozen slowly for histological analysis.
Histological analysis
Interscapular BAT was cut into serial 10 µm sections and was stained with hematoxylin (Cat# 1820, Histolab) and eosin (Cat# ACRO409430250, VWR) using standard protocols. The area of intracellular lipid vacuoles was quantified by a blind observer using Visiopharm Integrator System (Version 5.3.0.1562, Visiopharm). Immunofluorescence staining of UCP1 was performed by using rabbit anti-mouse UCP1 (polyclonal, Cat#ab23841, Abcam, 1 µg/mL), followed by a secondary antibody AF595-conjugated donkey anti-rabbit IgG (Cat# 711-587-003, Jackson Immuno Research Laboratories; 1 µg/mL) and staining with DAPI (Cat# D9542 Sigma–Aldrich).
Triglyceride analysis of BAT
Lipids within one lobe of interscapular BAT were extracted using the BUME method (Lofgren et al. 2016). Triglycerides were quantified by direct infusion (shotgun) analysis on a QTRAP 5500 mass spectrometer (Sciex, Concord, Canada) equipped with a robotic nanoflow ion source, TriVersa NanoMate (Advion BioSciences, Ithaca, NJ). The analysis was performed in positive ion mode by neutral loss detection of 11 common acyl fragments formed during a collision-induced dissociation according to previous work (Murphy et al. 2007). Glyceryl-d5-hexadecanoate (CDN isotopes, Quebec, Canada) was added during the extraction and used for quantification.
Noradrenaline content in BAT
The NA content of a lobe of interscapular BAT was determined by HPLC followed by electrochemical detection. The tissue was kept cold and homogenized for 3 × 20 s in 500 µL homogenization solution (5 mM EDTA in 0.1 M perchloric acid) using an ultra sonifier (Branson Ultrasonic Sonifier 250). After centrifugation (12,000 g, 4°C, 10 min), the middle layer was transferred to a new tube and 50 µL trichloroacetic acid (100%) was added followed by another round of centrifugation (12,000 g, 4°C, 10 min). The supernatant was filtered (0.22 µm syringe filter, Nylon syringe filters, Skandinaviska Genetec AB, Västra Frölunda, Sweden) and diluted in milliQ water (100×). NA was analyzed on a reversed phase column (Capsel Pak® 50 × 2 mm, 3 μm C18; Phenomenex, Vaerløse, Denmark, operated at 30°C) with a mobile phase (flow rate 0.3 mL/min) consisting of 150 mM NaH2PO4, 4.76 mM citric acid, 3 mM sodium dodecyl sulfate, 50 μM EDTA, as well as 10% MeOH and 15% acetonitrile. NA was detected by electrochemical detection (ESA Coulochem, Thermo Fisher Scientific) operated at 220 mV vs the cell. An external standard containing 2.95 fmol/μL of noradrenaline was used to identify and quantify NA content in the sample (Chromeleon software, Thermo Fisher Scientific).
Serum testosterone
Serum levels of testosterone were measured by gas chromatography–tandem mass spectrometry (GC–MS/MS), as previously described (Nilsson et al. 2015). Briefly, after the addition of isotope-labeled standards, steroids were extracted to chlorobutane, purified on a silica column, and derivatized using pentafluorobenzylhydroxylamine hydrochloride followed by pentafluorobenzoyl chloride. Steroids were analyzed in multiple reactions monitoring mode with ammonia as reagent gas using an Agilent 7000 triple quadrupole mass spectrometer equipped with a chemical ionization source. Assay performance, including intra-assay and inter-assay coefficients of variations (CVs), has been published previously (Nilsson et al. 2015). The lower limit of quantification (LOQ) of the assay is 8 pg/mL and the lower limit of detection (LOD) is 4 pg/mL for testosterone. In 17-week-old male mice that were castrated or sham-castrated at 13 weeks of age, all sham-castrated mice and 5/7 castrated mice had serum testosterone above LOQ of the assay. In the castrated group, two mice had undetectable levels; these values were set to LOD of the assay.
RNA isolation and real-time RT-PCR
Total RNA was extracted from BAT with RNeasy Plus Universal Mini Kit (Cat#73404; Qiagen) according to the manufacturer’s instructions. cDNA was synthesized from total RNA with a high-capacity cDNA RT kit (Cat#4374966; Applied Biosystems). RT-PCR analysis was done with predesigned TaqMan Gene Expression Assays (Applied Biosystems): Ucp1 (Mm01244861_m1), Pgc1a (Ppargc1a; Mm01208835_m1) Elovl3 (Mm00468164_m1), Lpl (Mm00434764_m1), Cd36 (Mm_01135198_m1), Hsl (lipe; Mm00495359_m1), Atgl (Pnpla2; Mm00503040_m1), Plin5 (Mm00508852_m1), Cidea (Mm00432554_m1), Ppara (Ppara_Mm00627559_m1), Pparg (Mm01184322), Ar (Mm0042688_m1), and 18s (Hs99999901_s1) as a reference gene. The analyses were run in Viia 7 Real-time PCR System (Applied Biosystems). Data were normalized to the reference gene 18s, and gene expression was calculated with the 2−ΔΔct method.
DNA quantification
Genomic DNA from interscapular and subscapular BAT, inguinal and mesenteric white adipose tissue, kidney, muscle, and spleen was isolated with DNeasy blood and tissue kit (Cat#69504; Qiagen) according to the manufacturer’s instructions. Amplification of genomic DNA was detected with SyBR green master mix (Cat#4367659; Applied Biosystems) and Viia 7 Real-time PCR System (Applied Biosystems). The following primer pairs were used: Ar exon 2: forward GGACCATGTTTTACCCATCG and reverse CCACAAGTGAGAGCTCCGTA; Ar exon 3: forward TCTATGTGCCAGCAGAAACG and reverse CCCAGAGTCATCCCTGCTT. Ct values for Ar exon 2 were normalized to Ct values for Ar exon 3 by the 2−ΔΔct method.
Cell culture and experiments
Immortalized preadipocytes were cultured as previously described (Kroon et al. 2018). Details of the generation (achieved by doxycycline-controlled expression of simian virus 40 large tumor antigen with a repressor-based Tet-On system) and brown adipocyte properties of the immortalized brown adipocyte cell line (clone #6) have been published previously (Liu et al. 2019). Briefly, preadipocytes were differentiated for 14 days. During the last 3 days of differentiation, cells were grown in a medium containing hormone-deprived (charcoal-stripped) serum. Cells were treated with DHT (10 nM) or vehicle for 8 h, followed by stimulation with NA (1 µM) or vehicle for 16 h. Hereafter, medium was collected to measure glycerol concentrations using a commercially available assay (Instruchemie, Delfzijl, The Netherlands). Cells were differentiated in 96-well Seahorse Bioscience assay plates for measurement of the oxygen consumption ratio (OCR) using the Seahorse Bioscience XF96 extracellular flux Analyzer (Seahorse Bioscience). After differentiation, cells were pre-treated with DHT (10 nM) or vehicle in Agilent Seahorse XF Base Medium supplemented with 10% hormone-deprived serum and 25 mM glucose (pH of final medium adjusted to 7.4) for 8 h before starting Seahorse analysis. NA or vehicle diluted in Seahorse medium was preloaded in the reagent delivery chambers and pneumatically injected into the wells after five baseline measurements, to a final concentration of 1 μM. Cellular OCR was measured in real-time every 8 min.
Isolation of mature brown adipocytes and glycerol release quantification
Interscapular BAT (approx. 100 mg) was minced to 0.5–1 mm3 pieces using scissors. The tissue was digested in 1 mL digestion medium (1 mg/mL collagenase B, Worthington, 1 mg/mL soybean trypsin inhibitor, Worthington and 4% fatty acid-free BSA, Sigma, in Hank's balanced solution, Gibco) for 30 min at 37°C with gentle mixing (300 rpm). Every 10 min, the tissue solution was gently mixed by pipetting. The first two times the tip was cut a bit to make the bigger pieces pass. After 30 min, no tissue pieces were visible, and the cells were washed three times in modified Krebs–Ringer Bicarbonate buffer (KRBB) (15 mM NaHCO3, 1 mM CaCl2, 20 mM HEPES, 4% fatty acid-free BSA, 100 U/mL penicillin and 100 µg/mL streptomycin in KRBB, Sigma). Floating mature adipocytes were washed by centrifugation at low speed (27 g) for 5 min, the infranatant was gently removed by a syringe and the cells were left at room temperature for 30 min. Cells from sham and ORX operated mice were pooled separately and live cells were counted in a NucleoCounter (Chemometec). Cells (3 × 105) were seeded in 300 µL in modified Krebs solution in duplicates and harvested after 3, 6, and 9 h by transferring 125 µL cell suspension to 0.45 µm centrifugal filter units (Millipore). Units were centrifuged at 10,000 g for 30 s, and free glycerol concentration in the supernatant was measured using the Glycerol Assay kit (Sigma MAK117) according to the manufacturer’s protocol.
Statistics
Statistical evaluations were performed with Prism software (GraphPad Software, Inc., version 8.2.1). All variables were tested for normal distribution by Shapiro–Wilk normality test. For variables that passed the normality test with or without log transformation, two-group comparisons were performed by two-tailed unpaired t-test, three-group comparison with one-way ANOVA followed by Dunnett’s post hoc test, and four-group comparison by two-way ANOVA. OCR data were analyzed by two-way ANOVA with repeated measures. Data that did not pass normality tests were analyzed using Mann–Whitney U-test (two groups) or Kruskal–Wallis test followed by Dunn’s post hoc test (three groups). P values < 0.05 were considered statistically significant. Unless otherwise specified, results are represented as mean ± s.e.m.
Results
Castration reduces weight and lipid content of BAT
Castration of male mice reduced mean testosterone levels by 94% (Fig. 1A). We found that castration reduced BAT weight already 6 days after surgery of adult mice, and at 21 days, there was a 34% reduction in iBAT weight (Fig. 1B), with a similar effect on iBAT weight adjusted to body weight (Fig. 1C). The effect on BAT weight was maintained long-term (Fig. 1D). Triglyceride (TG) content of the tissue was also reduced 6 days after castration of adult mice (Fig. 1E). Analysis of the fatty acid (FA) composition of TG showed that castration reduced the relative content of palmitic acid (C16:0) and increased the relative content of the generally less abundant longer chain FAs, such as oleic acid (C18:1), dihomo-γ-linoleic acid (20:3), arachidonic acid (C20:4), and docosahexaenoic acid (C22:6) (Fig. 1F), which may be secondary or consistent with the FA elongation that occurs during BAT activation (Townsend and Tseng 2014). Histological analysis showed that castration reduced the lipid droplet content (Fig. 1G and H) and seemed to increase the intensity of UCP1 staining in BAT (Fig. 1I). Further, castration resulted in a modest upregulation of mRNA expression of genes involved in lipid metabolism (Lpl, Elovl3) and thermogenesis (Pgc1a, Ucp1) in BAT (Fig. 1J). Mature brown adipocytes isolated from castrated mice released significantly more glycerol than brown adipocytes from sham-operated mice (Fig. 1K), supporting increased basal lipolysis in castrated mice. Overall, these results show that testosterone deficiency reduces BAT weight and lipid content and modifies the gene expression of BAT.
Castration reduces weight and lipid content of BAT. (A) Serum testosterone levels in male mice that were sham-operated (n = 8) or castrated (ORX, n = 7) at 13 weeks of age. Serum was collected 4 weeks after surgery. (B) Interscapular BAT (iBAT) weight in mice that were sham-operated (n = 4–9) or castrated (ORX, n = 5–9) at 11–14 weeks of age. iBAT was collected at 3, 6, and 21 days after surgery. (C) iBAT weight relative to body weight 21 days after surgery in sham-operated and ORX mice. (D) iBAT weight in mice that were sham-operated (n = 14) or ORX (n = 15) at 3 weeks of age. iBAT was collected at 35 weeks of age. (E) iBAT triglyceride (TG) content in mice that were sham-operated (n = 4–5) or ORX (n = 4–5) at 12–14 weeks of age. iBAT was collected at 3, 6, and 12 days after surgery. (F) iBAT fatty acid (FA) composition of TG at 12 days following surgery of 14-week-old mice (n = 4 per group). (G, H, I, J and K) Mice were sham-operated (n = 6) or ORX (n = 6) at 11 weeks of age, and iBAT was collected 21 days after surgery. (G and H) Representative images of hematoxylin-eosin stained sections of iBAT and quantification of lipid content. Scale bar, 100 µm. (I) Representative images of UCP1-staining of iBAT. Scale bar, 100 µm. (J) Expression of genes involved in BAT activity, calculated relative to 18S (Ct mean ± s.e.m. for 18S was 7.82 ± 0.05 in ORX and 7.90 ± 0.07 in sham). (K) Glycerol release from isolated brown adipocytes, results are from three separate experiments in duplicate. Glycerol release in sham-castrated mice was 302 ± 63, 180 ± 36, and 133 ± 27 pmol/min/106 cells after 3, 6, and 9 h incubation, respectively. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the sham group (two-tailed unpaired Student’s t-test). Bars indicate means, error bars indicate s.e.m. DGLA, dihomo-γ-linoleic acid; AA, arachidonic acid; EPA, eicosapentaenoic acid; DPA, docosapentaenoic acid; DHA, docosahexaenoic acid.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration reduces weight and lipid content of BAT. (A) Serum testosterone levels in male mice that were sham-operated (n = 8) or castrated (ORX, n = 7) at 13 weeks of age. Serum was collected 4 weeks after surgery. (B) Interscapular BAT (iBAT) weight in mice that were sham-operated (n = 4–9) or castrated (ORX, n = 5–9) at 11–14 weeks of age. iBAT was collected at 3, 6, and 21 days after surgery. (C) iBAT weight relative to body weight 21 days after surgery in sham-operated and ORX mice. (D) iBAT weight in mice that were sham-operated (n = 14) or ORX (n = 15) at 3 weeks of age. iBAT was collected at 35 weeks of age. (E) iBAT triglyceride (TG) content in mice that were sham-operated (n = 4–5) or ORX (n = 4–5) at 12–14 weeks of age. iBAT was collected at 3, 6, and 12 days after surgery. (F) iBAT fatty acid (FA) composition of TG at 12 days following surgery of 14-week-old mice (n = 4 per group). (G, H, I, J and K) Mice were sham-operated (n = 6) or ORX (n = 6) at 11 weeks of age, and iBAT was collected 21 days after surgery. (G and H) Representative images of hematoxylin-eosin stained sections of iBAT and quantification of lipid content. Scale bar, 100 µm. (I) Representative images of UCP1-staining of iBAT. Scale bar, 100 µm. (J) Expression of genes involved in BAT activity, calculated relative to 18S (Ct mean ± s.e.m. for 18S was 7.82 ± 0.05 in ORX and 7.90 ± 0.07 in sham). (K) Glycerol release from isolated brown adipocytes, results are from three separate experiments in duplicate. Glycerol release in sham-castrated mice was 302 ± 63, 180 ± 36, and 133 ± 27 pmol/min/106 cells after 3, 6, and 9 h incubation, respectively. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the sham group (two-tailed unpaired Student’s t-test). Bars indicate means, error bars indicate s.e.m. DGLA, dihomo-γ-linoleic acid; AA, arachidonic acid; EPA, eicosapentaenoic acid; DPA, docosapentaenoic acid; DHA, docosahexaenoic acid.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration reduces weight and lipid content of BAT. (A) Serum testosterone levels in male mice that were sham-operated (n = 8) or castrated (ORX, n = 7) at 13 weeks of age. Serum was collected 4 weeks after surgery. (B) Interscapular BAT (iBAT) weight in mice that were sham-operated (n = 4–9) or castrated (ORX, n = 5–9) at 11–14 weeks of age. iBAT was collected at 3, 6, and 21 days after surgery. (C) iBAT weight relative to body weight 21 days after surgery in sham-operated and ORX mice. (D) iBAT weight in mice that were sham-operated (n = 14) or ORX (n = 15) at 3 weeks of age. iBAT was collected at 35 weeks of age. (E) iBAT triglyceride (TG) content in mice that were sham-operated (n = 4–5) or ORX (n = 4–5) at 12–14 weeks of age. iBAT was collected at 3, 6, and 12 days after surgery. (F) iBAT fatty acid (FA) composition of TG at 12 days following surgery of 14-week-old mice (n = 4 per group). (G, H, I, J and K) Mice were sham-operated (n = 6) or ORX (n = 6) at 11 weeks of age, and iBAT was collected 21 days after surgery. (G and H) Representative images of hematoxylin-eosin stained sections of iBAT and quantification of lipid content. Scale bar, 100 µm. (I) Representative images of UCP1-staining of iBAT. Scale bar, 100 µm. (J) Expression of genes involved in BAT activity, calculated relative to 18S (Ct mean ± s.e.m. for 18S was 7.82 ± 0.05 in ORX and 7.90 ± 0.07 in sham). (K) Glycerol release from isolated brown adipocytes, results are from three separate experiments in duplicate. Glycerol release in sham-castrated mice was 302 ± 63, 180 ± 36, and 133 ± 27 pmol/min/106 cells after 3, 6, and 9 h incubation, respectively. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the sham group (two-tailed unpaired Student’s t-test). Bars indicate means, error bars indicate s.e.m. DGLA, dihomo-γ-linoleic acid; AA, arachidonic acid; EPA, eicosapentaenoic acid; DPA, docosapentaenoic acid; DHA, docosahexaenoic acid.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration increases, and testosterone replacement reduces, fatty acid uptake by BAT
Prolonged BAT activation leads to increased FA uptake to replenish the lipid droplets and secure access to fuel (Hoeke et al. 2016). As castration reduced lipid droplet content and tissue weight of BAT, we hypothesized that castration increases lipid uptake by BAT and that testosterone replacement to castrated mice prevents this effect. To test this hypothesis, we determined the tissue-specific uptake of TG-derived FAs in sham-operated and castrated mice treated with vehicle or testosterone. We showed that testosterone replacement reversed the reduction in BAT weight caused by castration (Fig. 2A). A relatively large percentage of the given dose of TG-derived FAs was taken up by the BAT depots, and FA uptake of BAT was markedly enhanced by castration but returned to levels seen in sham-operated mice upon testosterone replacement (Fig. 2B). Expressed per gram of tissue, the relative FA uptake was higher in BAT compared to other organs (Fig. 2C).
Castration increases fatty acid uptake by BAT. (A, B and C) At 10–11 weeks of age, male C57Bl/6J mice were ORX or sham-operated and treated with vehicle or a physiological dose of testosterone (n = 8 per group). 3 weeks after surgery, mice were fasted for 6 h and injected intravenously with glycerol tri[3H]oleate-labeled TG-rich lipoprotein-like emulsion particles. After 15 min, mice were sacrificed and uptake of glycerol tri[3H]oleate-derived radioactivity was determined in various organs such as gonadal white adipose tissue (gWAT), subcutaneous WAT (sWAT), interscapular BAT (iBAT), and subscapular BAT (sBAT). (A) Organ weights. (B) Uptake of glycerol tri[3H]oleate-derived radioactivity per whole organ. (C) Uptake of glycerol tri[3H]oleate-derived radioactivity per gram of wet tissue. *P < 0.05, **P < 0.01 compared to the sham group (one-way ANOVA followed by Dunnett’s post hoc test). Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration increases fatty acid uptake by BAT. (A, B and C) At 10–11 weeks of age, male C57Bl/6J mice were ORX or sham-operated and treated with vehicle or a physiological dose of testosterone (n = 8 per group). 3 weeks after surgery, mice were fasted for 6 h and injected intravenously with glycerol tri[3H]oleate-labeled TG-rich lipoprotein-like emulsion particles. After 15 min, mice were sacrificed and uptake of glycerol tri[3H]oleate-derived radioactivity was determined in various organs such as gonadal white adipose tissue (gWAT), subcutaneous WAT (sWAT), interscapular BAT (iBAT), and subscapular BAT (sBAT). (A) Organ weights. (B) Uptake of glycerol tri[3H]oleate-derived radioactivity per whole organ. (C) Uptake of glycerol tri[3H]oleate-derived radioactivity per gram of wet tissue. *P < 0.05, **P < 0.01 compared to the sham group (one-way ANOVA followed by Dunnett’s post hoc test). Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration increases fatty acid uptake by BAT. (A, B and C) At 10–11 weeks of age, male C57Bl/6J mice were ORX or sham-operated and treated with vehicle or a physiological dose of testosterone (n = 8 per group). 3 weeks after surgery, mice were fasted for 6 h and injected intravenously with glycerol tri[3H]oleate-labeled TG-rich lipoprotein-like emulsion particles. After 15 min, mice were sacrificed and uptake of glycerol tri[3H]oleate-derived radioactivity was determined in various organs such as gonadal white adipose tissue (gWAT), subcutaneous WAT (sWAT), interscapular BAT (iBAT), and subscapular BAT (sBAT). (A) Organ weights. (B) Uptake of glycerol tri[3H]oleate-derived radioactivity per whole organ. (C) Uptake of glycerol tri[3H]oleate-derived radioactivity per gram of wet tissue. *P < 0.05, **P < 0.01 compared to the sham group (one-way ANOVA followed by Dunnett’s post hoc test). Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration-induced increase in metabolic BAT activity is independent of AR in BAT
AR activation by the natural AR agonist dihydrotestosterone (DHT) has been shown to reverse the decrease in BAT weight after castration (Movérare-Skrtic et al. 2006). Therefore, we next investigated whether the castration-induced increase in BAT activity is explained by a reduction in AR signaling in brown adipocytes. Treatment of murine immortalized brown adipocytes with DHT did not affect the basal or noradrenaline (NA)-induced respiration (Fig. 3A) or glycerol release (Fig. 3B), indicating that AR signaling does not have a direct effect on brown adipocytes in vitro. To address the role of AR signaling in BAT function in an in vivo setting, we generated male mice with an AR deletion in brown adipocytes (BAT-ARKO) using an Ucp1-Cre construct. We observed a 40% reduction of Ar exon 2 DNA in total interscapular as well as subscapular BAT DNA (Fig. 3C), as expected from the around 50% adipocyte content of fat depots (Kang et al. 2014). This reduction is in the range of other studies using the Ucp1-Cre construct for targeting brown adipocytes in BAT (Turpin et al. 2014). Further, Ar DNA was reduced by 11% in inguinal (brite) fat, but no deletion was detected in mesenteric (white) fat, muscle, kidney, or spleen (Fig. 3C). mRNA expression of Ar in BAT was reduced by 46% while Ucp1 mRNA levels were unchanged (Fig. 3D). BAT weight was not different between BAT-ARKO and Ucp1-Cre+/− mice and castration similarly reduced BAT weight in both genotypes (Fig. 3E). FA uptake per gram BAT (Fig. 3F) or whole BAT (Fig. 3G) was not affected by genotype and similarly increased in both BAT-ARKO and Ucp1-Cre+/− mice by castration. These results show that the castration-induced increase in metabolic BAT activity is not mimicked by AR depletion in BAT.
Castration-induced increase in metabolic BAT activity is not dependent on AR in BAT. (A and B) Immortalized brown adipocytes were treated with vehicle or DHT (10 nM) for 8 h. (A) Oxygen consumption rate (OCR) before and after stimulation with NA (1 µM) or vehicle (n = 19–22 wells per group). (B) Glycerol release as % of vehicle before and after stimulation with NA (1 µM) or vehicle for 16 h (n = 3 per group). Data were analyzed by two-way repeated-measures ANOVA. Bars indicate means, error bars indicate s.e.m. (C and D) At 12 weeks of age, BAT-ARKO (n = 11), Ucp1-Cre+/− mice (n = 8) were sacrificed and organs were collected. (C) Relative Ar exon 2 DNA from various organs, including interscapular BAT (iBAT), subscapular BAT (sBAT), inguinal WAT (IngWAT), mesenteric WAT (MesWAT), and extensor digitorium longus (EDL) muscle. (D) Ar and Ucp1 mRNA expression in interscapular BAT (iBAT). **P < 0.01, ****P < 0.0001 compared to the Ucp1-Cre+/− group (two-tailed unpaired Student’s t-test). Bars indicate means, error bars indicate s.e.m. (E, F and G) At 10 weeks of age, Ucp1-Cre+/− and BAT-ARKO male mice were castrated (ORX) or sham-operated and at 24 weeks of age tri[3H]oleate-derived radioactivity in BAT was determined (n = 9–10/group). (E) Organ weights. (F and G) Uptake of glycerol tri[3H]oleate-derived radioactivity per gram of wet tissue or whole organ. Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration-induced increase in metabolic BAT activity is not dependent on AR in BAT. (A and B) Immortalized brown adipocytes were treated with vehicle or DHT (10 nM) for 8 h. (A) Oxygen consumption rate (OCR) before and after stimulation with NA (1 µM) or vehicle (n = 19–22 wells per group). (B) Glycerol release as % of vehicle before and after stimulation with NA (1 µM) or vehicle for 16 h (n = 3 per group). Data were analyzed by two-way repeated-measures ANOVA. Bars indicate means, error bars indicate s.e.m. (C and D) At 12 weeks of age, BAT-ARKO (n = 11), Ucp1-Cre+/− mice (n = 8) were sacrificed and organs were collected. (C) Relative Ar exon 2 DNA from various organs, including interscapular BAT (iBAT), subscapular BAT (sBAT), inguinal WAT (IngWAT), mesenteric WAT (MesWAT), and extensor digitorium longus (EDL) muscle. (D) Ar and Ucp1 mRNA expression in interscapular BAT (iBAT). **P < 0.01, ****P < 0.0001 compared to the Ucp1-Cre+/− group (two-tailed unpaired Student’s t-test). Bars indicate means, error bars indicate s.e.m. (E, F and G) At 10 weeks of age, Ucp1-Cre+/− and BAT-ARKO male mice were castrated (ORX) or sham-operated and at 24 weeks of age tri[3H]oleate-derived radioactivity in BAT was determined (n = 9–10/group). (E) Organ weights. (F and G) Uptake of glycerol tri[3H]oleate-derived radioactivity per gram of wet tissue or whole organ. Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration-induced increase in metabolic BAT activity is not dependent on AR in BAT. (A and B) Immortalized brown adipocytes were treated with vehicle or DHT (10 nM) for 8 h. (A) Oxygen consumption rate (OCR) before and after stimulation with NA (1 µM) or vehicle (n = 19–22 wells per group). (B) Glycerol release as % of vehicle before and after stimulation with NA (1 µM) or vehicle for 16 h (n = 3 per group). Data were analyzed by two-way repeated-measures ANOVA. Bars indicate means, error bars indicate s.e.m. (C and D) At 12 weeks of age, BAT-ARKO (n = 11), Ucp1-Cre+/− mice (n = 8) were sacrificed and organs were collected. (C) Relative Ar exon 2 DNA from various organs, including interscapular BAT (iBAT), subscapular BAT (sBAT), inguinal WAT (IngWAT), mesenteric WAT (MesWAT), and extensor digitorium longus (EDL) muscle. (D) Ar and Ucp1 mRNA expression in interscapular BAT (iBAT). **P < 0.01, ****P < 0.0001 compared to the Ucp1-Cre+/− group (two-tailed unpaired Student’s t-test). Bars indicate means, error bars indicate s.e.m. (E, F and G) At 10 weeks of age, Ucp1-Cre+/− and BAT-ARKO male mice were castrated (ORX) or sham-operated and at 24 weeks of age tri[3H]oleate-derived radioactivity in BAT was determined (n = 9–10/group). (E) Organ weights. (F and G) Uptake of glycerol tri[3H]oleate-derived radioactivity per gram of wet tissue or whole organ. Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration, but not AR-knockout in BAT, increases body temperature mainly at ZT 8–12
We next studied whether body temperature changes by castration follows a circadian rhythm. Mice were kept under a standard 12 h light: 12 h darkness cycle and time of the day was denoted as zeitgeber time (ZT), where ZT 0 and ZT 12 corresponds to the start of the light and the dark period, respectively. We specifically addressed time periods with low BAT activity/high locomotor activity (ZT 4–6), high BAT activity/low locomotor activity (ZT 8–12), and high BAT activity/high locomotor activity (ZT 12-18) (van den Berg et al. 2018). Castration, but not AR deficiency in BAT, increased body temperature at ZT 8–12, and the mean body temperature over the 21 h period was higher in castrated mice (Fig. 4A). During ZT 8–12, but not across 21 h, locomotor activity was increased by castration (Fig. 4B). Unadjusted oxygen consumption was reduced by castration (Fig. 4C). In the same mice, castration reduced body weight (Fig. 4D) and lean mass (Fig. 4E) but had no statistically significant effect on fat mass (Fig. 4F). Castration had a minor effect on oxygen consumption adjusted to lean mass, which was increased during ZT 8–12 only (Fig. 4G). The respiratory exchange ratio was similar across the groups (Fig. 4H). Overall, these results demonstrate that there is an effect of castration but not BAT AR deficiency on body temperature and that the effect of castration on body temperature shows a diurnal pattern.
Castration, but not AR-knockout in BAT, increases body temperature mainly at ZT 8–12. (A, B, C, D, E and F) At 11 weeks of age, Ucp1-Cre+/− and BAT-ARKO male mice were ORX (Ucp1-Cre+/− n = 8, BAT-ARKO n = 6) or sham-operated (Ucp1-Cre+/− n = 9, BAT-ARKO n = 6) and at 14 weeks of age body composition was measured by DEXA and at 15–16 weeks indirect calorimetry analysis performed. Times are given as zeitgeber times (ZTs), with ZT0 at the onset of the light period and ZT12 at the onset of the dark period. (A, B, C, G and H) Representative profile of the different parameters (core body temperature, locomotor activity (LMA), oxygen consumption (VO2), and respiratory exchange ratio (RER)) measured over a 21-h period at 20°C and mean values analyzed at different time intervals during the day (ZT 4–6, ZT 8–12 and ZT 12–18) and whole 21 h study period (ZT 4–1). (A) Core body temperature, (B) locomotor activity (LMA), (C) oxygen consumption (unadjusted) (VO2), (D) body weight at 14 weeks of age (E), lean mass, (F) fat mass, (G) oxygen consumption adjusted to lean mass and (H) respiratory exchange ratio (RER). Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration, but not AR-knockout in BAT, increases body temperature mainly at ZT 8–12. (A, B, C, D, E and F) At 11 weeks of age, Ucp1-Cre+/− and BAT-ARKO male mice were ORX (Ucp1-Cre+/− n = 8, BAT-ARKO n = 6) or sham-operated (Ucp1-Cre+/− n = 9, BAT-ARKO n = 6) and at 14 weeks of age body composition was measured by DEXA and at 15–16 weeks indirect calorimetry analysis performed. Times are given as zeitgeber times (ZTs), with ZT0 at the onset of the light period and ZT12 at the onset of the dark period. (A, B, C, G and H) Representative profile of the different parameters (core body temperature, locomotor activity (LMA), oxygen consumption (VO2), and respiratory exchange ratio (RER)) measured over a 21-h period at 20°C and mean values analyzed at different time intervals during the day (ZT 4–6, ZT 8–12 and ZT 12–18) and whole 21 h study period (ZT 4–1). (A) Core body temperature, (B) locomotor activity (LMA), (C) oxygen consumption (unadjusted) (VO2), (D) body weight at 14 weeks of age (E), lean mass, (F) fat mass, (G) oxygen consumption adjusted to lean mass and (H) respiratory exchange ratio (RER). Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration, but not AR-knockout in BAT, increases body temperature mainly at ZT 8–12. (A, B, C, D, E and F) At 11 weeks of age, Ucp1-Cre+/− and BAT-ARKO male mice were ORX (Ucp1-Cre+/− n = 8, BAT-ARKO n = 6) or sham-operated (Ucp1-Cre+/− n = 9, BAT-ARKO n = 6) and at 14 weeks of age body composition was measured by DEXA and at 15–16 weeks indirect calorimetry analysis performed. Times are given as zeitgeber times (ZTs), with ZT0 at the onset of the light period and ZT12 at the onset of the dark period. (A, B, C, G and H) Representative profile of the different parameters (core body temperature, locomotor activity (LMA), oxygen consumption (VO2), and respiratory exchange ratio (RER)) measured over a 21-h period at 20°C and mean values analyzed at different time intervals during the day (ZT 4–6, ZT 8–12 and ZT 12–18) and whole 21 h study period (ZT 4–1). (A) Core body temperature, (B) locomotor activity (LMA), (C) oxygen consumption (unadjusted) (VO2), (D) body weight at 14 weeks of age (E), lean mass, (F) fat mass, (G) oxygen consumption adjusted to lean mass and (H) respiratory exchange ratio (RER). Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration slightly increases noradrenaline content in BAT
As we did not find evidence for a direct effect of androgens/AR on BAT activity, we next asked whether the regulation of BAT activity by androgens might involve central thermoregulatory pathways. Since the sympathetic nervous system is the most important regulator of BAT thermogenic activity (Kooijman et al. 2015), we hypothesized that castration increases NA content in BAT. Indeed, NA concentration in BAT was slightly increased within 6 days following castration (Fig. 5A). This effect was maintained for at least 21 days after surgery and was present even without correction for the weight of the lobe (Fig. 5B).
Castration increases noradrenaline content in BAT. (A and B) Noradrenaline content in interscapular BAT (iBAT) in mice that were sham-operated or castrated (ORX) at 13 weeks of age. iBAT was collected at 6 (n = 9 per group) and 21 days (n = 7 per group) after surgery. (A) Noradrenaline levels normalized to iBAT weight, expressed as % of corresponding sham-operated control. (B) Noradrenaline levels per lobe iBAT, expressed as % of corresponding sham-operated control. Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration increases noradrenaline content in BAT. (A and B) Noradrenaline content in interscapular BAT (iBAT) in mice that were sham-operated or castrated (ORX) at 13 weeks of age. iBAT was collected at 6 (n = 9 per group) and 21 days (n = 7 per group) after surgery. (A) Noradrenaline levels normalized to iBAT weight, expressed as % of corresponding sham-operated control. (B) Noradrenaline levels per lobe iBAT, expressed as % of corresponding sham-operated control. Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Castration increases noradrenaline content in BAT. (A and B) Noradrenaline content in interscapular BAT (iBAT) in mice that were sham-operated or castrated (ORX) at 13 weeks of age. iBAT was collected at 6 (n = 9 per group) and 21 days (n = 7 per group) after surgery. (A) Noradrenaline levels normalized to iBAT weight, expressed as % of corresponding sham-operated control. (B) Noradrenaline levels per lobe iBAT, expressed as % of corresponding sham-operated control. Data were analyzed by two-way ANOVA. Bars indicate means, error bars indicate s.e.m.
Citation: Journal of Endocrinology 251, 1; 10.1530/JOE-20-0263
Discussion
Here we investigated the role of androgens in BAT activity in male mice. We demonstrated that androgen depletion by castration increases metabolic BAT activity. Mechanistically, the link between androgens and metabolic BAT activity is independent of AR in BAT.
In the present study, we used lipid tracers to show that castration increased lipid uptake by BAT in vivo, which is an indirect measure of an increased metabolic BAT activity (Hoeke et al. 2016, Schilperoort et al. 2016). Compared to glucose uptake, lipid uptake is a better measure of BAT metabolic activity, as activated BAT selectively increases oxidation of lipids over glucose and replenishes intracellular lipid stores by taking up triglyceride-derived FA (Ouellet et al. 2012, Schilperoort et al. 2016, Carpentier et al. 2018). It should be noted that a high increase in FA uptake may even be underestimated given that rapid combustion of [3H]oleate by BAT will result in the release of radiolabel from BAT in the form of 3H2O. As lipoprotein lipase is important for this uptake (Bartelt et al. 2011), the large increase in FA uptake seems incongruent with the minor regulation of Lpl mRNA by castration found here. However, lipoprotein lipase activity is also regulated post-transcriptionally and post-translationally (Basu & Bornfeldt 2020). Further, other yet unidentified factors may mediate the increased FA uptake. The increased FA uptake after castration is in line with our other observations (i.e. lower BAT weight, reduced lipid content in BAT, increased expression of several lipolytic and thermogenic genes in BAT, and increased basal lipolysis of isolated brown adipocytes) that suggest increased BAT activity, although BAT thermogenic activity has not been directly assessed in our study. While we found a modest increase in Ucp1 mRNA levels by castration, UCP1 activity is predominantly regulated through post-transcriptional and post-translational mechanisms (Cannon & Nedergaard 2004, Takahashi et al. 2015), which have not been studied here. Our finding that castration reduces BAT weight and increases Ucp1 mRNA expression in BAT is consistent with previous observations (Movérare-Skrtic et al. 2006, Hashimoto et al. 2016).
Previous in vitro studies suggest that androgen/AR signaling in BAT directly impairs brown adipocyte activity. Concentrations of testosterone as low as 1 nM have been reported to decrease lipolysis (estimated by glycerol release) and expression of Pgc1a, an important regulator of mitochondrial biogenesis and thermogenic function, in murine brown adipocytes (Monjo et al. 2003, Rodriguez-Cuenca et al. 2007a). Treatment of brown adipocytes with high doses (100 nM) of testosterone also reduced expression of Ucp1, an effect that was blocked by the AR antagonist flutamide (Rodriguez et al. 2002). Here we could not replicate the effects on glycerol release using the natural AR agonist DHT, which is about 2- to 3-fold more potent than testosterone (Wright et al. 1996). Also, we did not find any effect of 10 nM DHT on cellular respiration, a direct measure of brown adipocyte activity. Consistent with our in vitro data, we found that BAT-specific AR deficiency had no effects on BAT weight, TG-derived FA uptake by BAT, or body temperature. Of note, our BAT-ARKO mice displayed around 40% reduction of AR exon 2 DNA and 46% reduction of Ar mRNA in BAT. Although only around 50% of the cells in fat are adipocytes (Kang et al. 2014), and this knockout degree is in the range of other studies using the Ucp1-Cre construct for targeting of brown adipocytes in BAT (Turpin et al. 2014), we cannot exclude residual AR activity in brown adipocytes in our model, which is a limitation of the study. Surprisingly, global AR knockout (G-ARKO) mice exhibit decreased expression of Ucp1 in BAT (Fan et al. 2005, Yanase et al. 2008), which thus does not mimic the effect of castration. In this model, deletion of AR occurs at the embryonic stage causing multiple developmental effects, which could in part explain the difference in Ucp1 expression observed between G-ARKO and castrated mice. Collectively, these data do not support that brown adipocytes are important AR target cells for the variables studied here.
We found that castration increases body temperature, in line with two previous reports in male mice: one assessed body temperature by weekly measurements of rectal temperature (Hashimoto et al. 2016), and the second invasively measured body temperature over 5 days (Sanchez-Alavez et al. 2011). While we show that increased metabolic BAT activity following castration could be reversed with testosterone replacement, we have not performed similar studies addressing body temperature. In a recent study, DHT treatment reduced core body temperature in castrated male mice during the inactive period of the day (Cintron-Colon et al. 2019), supporting AR-mediated effects of androgens on body temperature. To our knowledge, there are no studies addressing whether men with low testosterone levels due to endocrine disorders or treatments have increased body temperature; simple association studies between these variables will likely be confounded by disorders such as obesity (Kahn & Brannigan 2017). Interestingly, both androgen withdrawal (androgen deprivation therapy of prostate cancer) in men (Jones et al. 2012, Gonzalez et al. 2018) and estrogen withdrawal (menopause) in women (Freedman 2014) have been associated with the occurrence of hot flashes. In menopausal women, hot flashes seem to be triggered by small elevations in core body temperature acting within a narrowed thermoneutral zone (Freedman 2014), while to our knowledge there are no similar studies performed in men with testosterone deficiency.
In mass spectrometry-based analyses performed by our group (shown here and in Nilsson et al. 2015), testosterone levels were around 25–50 pg/mL in female mice, as compared to 225–8000 pg/mL in gonadal-intact male mice (showing a large biological variation), and 4–25 pg/mL in castrated male mice. Thus, it is conceivable that testosterone-mediated regulation of BAT activity and body temperature may contribute to sex differences in these variables. Notably, while female mice have an overall higher body temperature than male mice (Sanchez-Alavez et al. 2011), the sex difference in BAT activity in rodents is less established. Further, there is a paucity of studies directly comparing body temperature or BAT activity in castrated male rodents with gonadal-intact females, which also display variation in body temperature across the ovarian cycle (Sanchez-Alavez et al. 2011). BAT from male rats reportedly exhibits a lower Ucp1 expression and mitochondrial respiration as compared to BAT from female rats (Rodriguez-Cuenca et al. 2002), although the results of that study may be confounded by body weight differences between male and female rats. Sex differences in BAT activity in humans are supported by most, but not all, studies (Pfannenberg et al. 2010, Ouellet et al. 2011, van der Lans et al. 2013, Dinas et al. 2015, Fletcher et al. 2020, Becher et al. 2021). In a recent study, adaptive BAT temperature responses were greater in women than in men, irrespective of cycle stage (Fuller-Jackson et al. 2020). However, during the follicular phase only, the increase in BAT temperature during cold exposure was lower in women vs men (Fuller-Jackson et al. 2020). These data support that factor(s) that vary during the ovarian cycle are important regulators of BAT activity in women, requiring awareness in studies of the sexual dimorphism in BAT physiology.
In the present study, we found that castration slightly increased NA content in BAT. This finding may support that castration increases the sympathetic outflow to BAT, as sympathetic activation following cold-induced thermogenesis causes increased NA release to BAT (Blaszkiewicz et al. 2019). As NA from sympathetic nerve endings activates murine β3-adrenergic receptors in BAT, leading to increased lipolysis, FA uptake from blood, and heat production by the mitochondria (Hoeke et al. 2016), an increased NA content in BAT is in line with BAT activation. Importantly, other mechanisms for increased tissue NA content, such as altered NA reuptake or turnover, cannot be excluded. Of note, testosterone generally increases sympathetic nervous signaling (Dibner & Black 1976, Keast 2000, Ermis et al. 2010), but it is plausible that androgens modulate sympathetic output in a tissue-specific manner. Future experiments should address the involvement of central thermoregulatory pathways, which may be mediated by hypothalamic, medullary, and/or spinal sites (Nakamura & Nakamura 2018).
The effects of castration on metabolic BAT activity and body temperature shown in the present study may be associated or independent of each other. Notably, thermogenic BAT activity has not been studied here. In line with other studies showing castration-induced muscle wasting (Jiao et al. 2009, Serra et al. 2013), we confirmed that castration reduces lean mass in male mice. Skeletal muscle is an important site for thermogenesis (Periasamy et al. 2017) and loss of muscle mass reduces its thermogenic contribution to body temperature. Therefore, it is possible that castration increases BAT activity as a compensatory mechanism. It has been reported that reduced thermogenic capacity in muscle increases UCP1-dependent thermogenesis in BAT (Bal et al. 2017). Interestingly, we found that locomotor activity as well as body temperature was increased by castration at ZT 8–12. During the same time frame, we found increased oxygen consumption, which may be related to both of these findings. However, the effect on oxygen consumption was minor and only appeared after normalization for lean mass. Further research is needed to unravel the physiological relevance of these findings.
In conclusion, we show that testosterone is a negative regulator of metabolic BAT activity in male mice. This finding provides new insight into the metabolic actions of androgens, which may have important clinical implications. To date, there are no clinical studies examining the role of androgens on BAT activity. Our findings raise the question of whether androgen deficiency may modulate responses to BAT-directed therapeutic interventions, an area of intense ongoing research. Future research efforts should address the importance of androgens for BAT activity in humans.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the Swedish Research Council (2017-02141 to Å T), the Swedish Heart-Lung Foundation (20180564 to Å T), AFA Insurance (Å T), the Novo Nordisk Foundation (NNF18OC0034464 to Å T), and grants from the Swedish state under the agreement between the Swedish government and the county councils (the ALF-agreement; ALFGBG-721451 to Å T) and the Netherlands Cardiovascular Research Initiative: an initiative with the support of the Dutch Heart Foundation (CVON2017-20 GENIUS-II to P C N R). M S is supported by a grant from the Board of Directors of Leiden University Medical Center (LUMC).
Author contribution statement
M L R, M S, I J, E S E, V P, J K, M H, S K, M E, J B, C O, J O J, M C L, P C N R, and Å T designed the studies. M L R, M S, I J, E S E, V P, J K, M H, S K, Å T conducted experiments, acquired and/or analyzed data. M L R, M S, P C N R, and Å T wrote the manuscript. All authors approved the submission of the manuscript.
Acknowledgements
The authors thank Annelie Carlsson, Rosita Stomberg, Kristina Skålén, and Matias Ekstrand (Wallenberg Laboratory for Cardiovascular and Metabolic Research, University of Gothenburg) and Hetty Sips, Trea Streefland, and Chris van der Bent (Division of Endocrinology, Department of Medicine, LUMC, Leiden) for their excellent technical assistance.
References
Bal NC, Singh S, Reis FCG, Maurya SK, Pani S, Rowland LA & Periasamy M 2017 Both brown adipose tissue and skeletal muscle thermogenesis processes are activated during mild to severe cold adaptation in mice. Journal of Biological Chemistry 292 16616–16625. (https://doi.org/10.1074/jbc.M117.790451)
Bartelt A, Bruns OT, Reimer R, Hohenberg H, Ittrich H, Peldschus K, Kaul MG, Tromsdorf UI, Weller H & Waurisch C et al.2011 Brown adipose tissue activity controls triglyceride clearance. Nature Medicine 17 200–205. (https://doi.org/10.1038/nm.2297)
Basu D & Bornfeldt KE 2020 Hypertriglyceridemia and atherosclerosis: using human research to guide mechanistic studies in animal models. Frontiers in Endocrinology 11 504. (https://doi.org/10.3389/fendo.2020.00504)
Becher T, Palanisamy S, Kramer DJ, Eljalby M, Marx SJ, Wibmer AG, Butler SD, Jiang CS, Vaughan R & Schoder H et al.2021 Brown adipose tissue is associated with cardiometabolic health. Nature Medicine 27 58–65. (https://doi.org/10.1038/s41591-020-1126-7)
Blaszkiewicz M, Willows JW, Johnson CP & Townsend KL 2019 The importance of peripheral nerves in adipose tissue for the regulation of energy balance. Biology 8 10. (https://doi.org/10.3390/biology8010010)
Cannon B & Nedergaard J 2004 Brown adipose tissue: function and physiological significance. Physiological Reviews 84 277–359. (https://doi.org/10.1152/physrev.00015.2003)
Carpentier AC, Blondin DP, Virtanen KA, Richard D, Haman F & Turcotte ÉE 2018 Brown adipose tissue energy metabolism in humans. Frontiers in Endocrinology 9 447. (https://doi.org/10.3389/fendo.2018.00447)
Cintron-Colon R, Shankar K, Sanchez-Alavez M & Conti B 2019 Gonadal hormones influence core body temperature during calorie restriction. Temperature 6 158–168. (https://doi.org/10.1080/23328940.2019.1607653)
De Gendt K, Swinnen JV, Saunders PT, Schoonjans L, Dewerchin M, Devos A, Tan K, Atanassova N, Claessens F & Lecureuil C et al.2004 A Sertoli cell-selective knockout of the androgen receptor causes spermatogenic arrest in meiosis. PNAS 101 1327–1332. (https://doi.org/10.1073/pnas.0308114100)
Dibner MD & Black IB 1976 Elevation of sympathetic ganglion tyrosine hydroxylase activity in neonatal and adult rats by testosterone treatment. Journal of Neurochemistry 27 323–324. (https://doi.org/10.1111/j.1471-4159.1976.tb01591.x)
Dinas PC, Nikaki A, Jamurtas AZ, Prassopoulos V, Efthymiadou R, Koutedakis Y, Georgoulias P & Flouris AD 2015 Association between habitual physical activity and brown adipose tissue activity in individuals undergoing PET-CT scan. Clinical Endocrinology 82 147–154. (https://doi.org/10.1111/cen.12620)
Ermis N, Deniz F, Kepez A, Kara B, Azal O & Kutlu M 2010 Heart rate variability of young men with idiopathic hypogonadotropic hypogonadism. Autonomic Neuroscience: Basic and Clinical 152 84–87. (https://doi.org/10.1016/j.autneu.2009.08.018)
Fan W, Yanase T, Nomura M, Okabe T, Goto K, Sato T, Kawano H, Kato S & Nawata H 2005 Androgen receptor null male mice develop late-onset obesity caused by decreased energy expenditure and lipolytic activity but show normal insulin sensitivity with high adiponectin secretion. Diabetes 54 1000–1008. (https://doi.org/10.2337/diabetes.54.4.1000)
Fletcher LA, Kim K, Leitner BP, Cassimatis TM, O’Mara AE, Johnson JW, Halprin MS, McGehee SM, Brychta RJ & Cypess AM et al.2020 Sexual dimorphisms in adult human brown adipose tissue. Obesity 28 241–246. (https://doi.org/10.1002/oby.22698)
Freedman RR 2014 Menopausal hot flashes: mechanisms, endocrinology, treatment. Journal of Steroid Biochemistry and Molecular Biology 142 115–120. (https://doi.org/10.1016/j.jsbmb.2013.08.010)
Fuller-Jackson JP, Dordevic AL, Clarke IJ & Henry BA 2020 Effect of sex and sex steroids on brown adipose tissue heat production in humans. European Journal of Endocrinology 183 343–355. (https://doi.org/10.1530/EJE-20-0184)
Gonzalez BD, Small BJ, Cases MG, Williams NL, Fishman MN, Jacobsen PB & Jim HSL 2018 Sleep disturbance in men receiving androgen deprivation therapy for prostate cancer: the role of hot flashes and nocturia. Cancer 124 499–506. (https://doi.org/10.1002/cncr.31024)
Hashimoto O, Noda T, Morita A, Morita M, Ohtsuki H, Sugiyama M & Funaba M 2016 Castration induced browning in subcutaneous white adipose tissue in male mice. Biochemical and Biophysical Research Communications 478 1746–1750. (https://doi.org/10.1016/j.bbrc.2016.09.017)
Hoeke G, Kooijman S, Boon MR, Rensen PC & Berbée JF 2016 Role of brown fat in lipoprotein metabolism and atherosclerosis. Circulation Research 118 173–182. (https://doi.org/10.1161/CIRCRESAHA.115.306647)
Jiao Q, Pruznak AM, Huber D, Vary TC & Lang CH 2009 Castration differentially alters basal and leucine-stimulated tissue protein synthesis in skeletal muscle and adipose tissue. American Journal of Physiology: Endocrinology and Metabolism 297 E1222–E1232. (https://doi.org/10.1152/ajpendo.00473.2009)
Jones JM, Kohli M & Loprinzi CL 2012 Androgen deprivation therapy-associated vasomotor symptoms. Asian Journal of Andrology 14 193–197. (https://doi.org/10.1038/aja.2011.101)
Kahn BE & Brannigan RE 2017 Obesity and male infertility. Current Opinion in Urology 27 441–445. (https://doi.org/10.1097/MOU.0000000000000417)
Kang S, Kong X & Rosen ED 2014 Adipocyte-specific transgenic and knockout models. Methods in Enzymology 537 1–16. (https://doi.org/10.1016/B978-0-12-411619-1.00001-X)
Keast JR 2000 Effects of testosterone on pelvic autonomic pathways: progress and pitfalls. Journal of the Autonomic Nervous System 79 67–73. (https://doi.org/10.1016/s0165-1838(9900087-9)
Kooijman S, van den Heuvel JK & Rensen PCN 2015 Neuronal control of brown fat activity. Trends in Endocrinology and Metabolism 26 657–668. (https://doi.org/10.1016/j.tem.2015.09.008)
Kroon J, Koorneef LL, van den Heuvel JK, Verzijl CRC, van de Velde NM, Mol IM, Sips HCM, Hunt H, Rensen PCN & Meijer OC 2018 Selective glucocorticoid receptor antagonist CORT125281 activates brown adipose tissue and alters lipid distribution in male mice. Endocrinology 159 535–546. (https://doi.org/10.1210/en.2017-00512)
Liu J, Kuipers EN, Sips HCM, Dorleijn JC, van Dam AD, Christodoulides C, Karpe F, Zhou G, Boon MR & Rensen PCN et al.2019 Conditionally immortalized brown preadipocytes can switch between proliferative and differentiated states. Biochimica et Biophysica Acta: Molecular and Cell Biology of Lipids 1864 158511. (https://doi.org/10.1016/j.bbalip.2019.08.007)
Lofgren L, Forsberg GB & Stahlman M 2016 The bume method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue. Scientific Reports 6 27688. (https://doi.org/10.1038/srep27688)
Monjo M, Rodriguez AM, Palou A & Roca P 2003 Direct effects of testosterone, 17 beta-estradiol, and progesterone on adrenergic regulation in cultured brown adipocytes: potential mechanism for gender-dependent thermogenesis. Endocrinology 144 4923–4930. (https://doi.org/10.1210/en.2003-0537)
Morrison SF 2016 Central control of body temperature. F1000 Research 5 880.(https://doi.org/10.12688/f1000research.7958.1)
Movérare-Skrtic S, Venken K, Andersson N, Lindberg MK, Svensson J, Swanson C, Vanderschueren D, Oscarsson J, Gustafsson JA & Ohlsson C 2006 Dihydrotestosterone treatment results in obesity and altered lipid metabolism in orchidectomized mice. Obesity 14 662–672. (https://doi.org/10.1038/oby.2006.75)
Murphy RC, James PF, McAnoy AM, Krank J, Duchoslav E & Barkley RM 2007 Detection of the abundance of diacylglycerol and triacylglycerol molecular species in cells using neutral loss mass spectrometry. Analytical Biochemistry 366 59–70. (https://doi.org/10.1016/j.ab.2007.03.012)
Nakamura Y & Nakamura K 2018 Central regulation of brown adipose tissue thermogenesis and energy homeostasis dependent on food availability. Pflugers Archiv 470 823–837. (https://doi.org/10.1007/s00424-017-2090-z)
Nilsson ME, Vandenput L, Tivesten Å, Norlen AK, Lagerquist MK, Windahl SH, Borjesson AE, Farman HH, Poutanen M & Benrick A et al.2015 Measurement of a comprehensive sex steroid profile in rodent serum by high-sensitive gas chromatography-tandem mass spectrometry. Endocrinology 156 2492–2502. (https://doi.org/10.1210/en.2014-1890)
Ouellet V, Routhier-Labadie A, Bellemare W, Lakhal-Chaieb L, Turcotte E, Carpentier AC & Richard D 2011 Outdoor temperature, age, sex, body mass index, and diabetic status determine the prevalence, mass, and glucose-uptake activity of 18F-FDG-detected BAT in humans. Journal of Clinical Endocrinology and Metabolism 96 192–199. (https://doi.org/10.1210/jc.2010-0989)
Ouellet V, Labbe SM, Blondin DP, Phoenix S, Guerin B, Haman F, Turcotte EE, Richard D & Carpentier AC 2012 Brown adipose tissue oxidative metabolism contributes to energy expenditure during acute cold exposure in humans. Journal of Clinical Investigation 122 545–552. (https://doi.org/10.1172/JCI60433)
Periasamy M, Herrera JL & Reis FCG 2017 Skeletal muscle thermogenesis and its role in whole body energy metabolism. Diabetes and Metabolism Journal 41 327–336. (https://doi.org/10.4093/dmj.2017.41.5.327)
Pfannenberg C, Werner MK, Ripkens S, Stef I, Deckert A, Schmadl M, Reimold M, Häring HU, Claussen CD & Stefan N 2010 Impact of age on the relationships of brown adipose tissue with sex and adiposity in humans. Diabetes 59 1789–1793. (https://doi.org/10.2337/db10-0004)
Rensen PC, van Dijk MC, Havenaar EC, Bijsterbosch MK, Kruijt JK & van Berkel TJ 1995 Selective liver targeting of antivirals by recombinant chylomicrons: a new therapeutic approach to hepatitis B. Nature Medicine 1 221–225. (https://doi.org/10.1038/nm0395-221)
Rodriguez AM, Monjo M, Roca P & Palou A 2002 Opposite actions of testosterone and progesterone on UCP1 mRNA expression in cultured brown adipocytes. Cellular and Molecular Life Sciences 59 1714–1723. (https://doi.org/10.1007/pl00012499)
Rodriguez-Cuenca S, Pujol E, Justo R, Frontera M, Oliver J, Gianotti M & Roca P 2002 Sex-dependent thermogenesis, differences in mitochondrial morphology and function, and adrenergic response in brown adipose tissue. Journal of Biological Chemistry 277 42958–42963. (https://doi.org/10.1074/jbc.M207229200)
Rodriguez-Cuenca S, Monjo M, Gianotti M, Proenza AM & Roca P 2007a Expression of mitochondrial biogenesis-signaling factors in brown adipocytes is influenced specifically by 17beta-estradiol, testosterone, and progesterone. American Journal of Physiology: Endocrinology and Metabolism 292 E340–E346. (https://doi.org/10.1152/ajpendo.00175.2006)
Rodriguez-Cuenca S, Monjo M, Frontera M, Gianotti M, Proenza AM & Roca P 2007b Sex steroid receptor expression profile in brown adipose tissue. Effects of hormonal status. Cellular Physiology and Biochemistry 20 877–886. (https://doi.org/10.1159/000110448)
Sanchez-Alavez M, Alboni S & Conti B 2011 Sex- and age-specific differences in core body temperature of C57BL/6 mice. Age 33 89–99. (https://doi.org/10.1007/s11357-010-9164-6)
Schilperoort M, Hoeke G, Kooijman S & Rensen PC 2016 Relevance of lipid metabolism for brown fat visualization and quantification. Current Opinion in Lipidology 27 242–248. (https://doi.org/10.1097/MOL.0000000000000296)
Schilperoort M, van Dam AD, Hoeke G, Shabalina IG, Okolo A, Hanyaloglu AC, Dib LH, Mol IM, Caengprasath N & Chan YW et al.2018 The GPR120 agonist TUG-891 promotes metabolic health by stimulating mitochondrial respiration in brown fat. EMBO Molecular Medicine 10 e8047. (https://doi.org/10.15252/emmm.201708047)
Serra C, Sandor NL, Jang H, Lee D, Toraldo G, Guarneri T, Wong S, Zhang A, Guo W & Jasuja R et al.2013 The effects of testosterone deprivation and supplementation on proteasomal and autophagy activity in the skeletal muscle of the male mouse: differential effects on high-androgen responder and low-androgen responder muscle groups. Endocrinology 154 4594–4606. (https://doi.org/10.1210/en.2013-1004)
Takahashi A, Adachi S, Morita M, Tokumasu M, Natsume T, Suzuki T & Yamamoto T 2015 Post-transcriptional stabilization of Ucp1 mRNA protects mice from diet-induced obesity. Cell Reports 13 2756–2767. (https://doi.org/10.1016/j.celrep.2015.11.056)
Townsend KL & Tseng YH 2014 Brown fat fuel utilization and thermogenesis. Trends in Endocrinology and Metabolism 25 168–177. (https://doi.org/10.1016/j.tem.2013.12.004)
Turpin SM, Nicholls HT, Willmes DM, Mourier A, Brodesser S, Wunderlich CM, Mauer J, Xu E, Hammerschmidt P & Bronneke HS et al.2014 Obesity-induced CerS6-dependent C16:0 ceramide production promotes weight gain and glucose intolerance. Cell Metabolism 20 678–686. (https://doi.org/10.1016/j.cmet.2014.08.002)
van den Berg R, Kooijman S, Noordam R, Ramkisoensing A, Abreu-Vieira G, Tambyrajah LL, Dijk W, Ruppert P, Mol IM & Kramar B et al.2018 A diurnal rhythm in brown adipose tissue causes rapid clearance and combustion of plasma lipids at wakening. Cell Reports 22 3521–3533. (https://doi.org/10.1016/j.celrep.2018.03.004)
van der Lans AA, Hoeks J, Brans B, Vijgen GH, Visser MG, Vosselman MJ, Hansen J, Jorgensen JA, Wu J & Mottaghy FM et al.2013 Cold acclimation recruits human brown fat and increases nonshivering thermogenesis. Journal of Clinical Investigation 123 3395–3403. (https://doi.org/10.1172/JCI68993)
Wernstedt I, Edgley A, Berndtsson A, Faldt J, Bergstrom G, Wallenius V & Jansson JO 2006 Reduced stress- and cold-induced increase in energy expenditure in interleukin-6-deficient mice. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 291 R551–R 557. (https://doi.org/10.1152/ajpregu.00514.2005)
Wright AS, Thomas LN, Douglas RC, Lazier CB & Rittmaster RS 1996 Relative potency of testosterone and dihydrotestosterone in preventing atrophy and apoptosis in the prostate of the castrated rat. Journal of Clinical Investigation 98 2558–2563. (https://doi.org/10.1172/JCI119074)
Yanase T, Fan W, Kyoya K, Min L, Takayanagi R, Kato S & Nawata H 2008 Androgens and metabolic syndrome: lessons from androgen receptor knock out (ARKO) mice. Journal of Steroid Biochemistry and Molecular Biology 109 254–257. (https://doi.org/10.1016/j.jsbmb.2008.03.017)
